SEARCH · PubMed Health

Results for “Nested Genes”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 487 records · Page 27Linked to original sources

PubMed1978

Reiterated genes with varying location in intercalary heterochromatin regions of Drosophila melanogaster polytene chromosomes.

The localization of two cloned D. melanogaster DNA fragments in polytene chromosomes was determined by means of in situ hybridization. These different fragments (Dm 225 and Dm 234B) are present in the genome in hundreds copies and contain genes whose transcription yields two different classes in abundant mRNA (Ilyin et al., 1976, 1977; Tchurikov et al., 1978). About 20--30 sites of these genes are demonstrable in the polytene chromosomes of a given stock. There are small but significant variations in the number and localization of these sites among individuals of the same stock. On the other hand, different stocks of D. melanogaster have an utterly different distribution of revealed hybridization sites in the polytene chromosomes. The location of both fragments (Dm 225 and Dm 234) was found to be virtually identical within any given stock of D. melanogaster. 69 sites for localization of Dm 225 or Dm 234 genes were detected in the chromosomes of 11 individuals studied. At least 50 (and up to 62) of them coincide with intercalary heterochromatin regions which are known to be characterized by ectopic pairing, late replication and the presence of "weak spots" in the chromosome. The ability of Dm225 and Dm 234 to code for the "abundant" classes of messenger RNA (Ilyin et al., 1976) and the fact that their location may coincide with the histone and ribosomal genes suggest that intercalary heterochromatin regions are "nests" containing various types of actively transcribable tandem-repeated genes coding for common "household" cell functions.

Animals↗

PubMed2003

Cloning and characterisation of a glucoamylase gene (GlaM) from the dimorphic zygomycete Mucor circinelloides.

This article reports a novel strategy for the cloning of glucoamylase genes using conserved sequences and semi-nested PCR and its application in cloning the GlaM glucoamylase gene and cDNA from the dimorphic zygomycete Mucor circinelloides. The deduced 609-amino-acid enzyme (including signal peptide) is 63% identical to the Rhizopus oryzae raw starch-degrading glucoamylase and is the third glucoamylase reported to have the putative starch-binding domain placed N-terminally. The C-terminal catalytic domain is separated from the starch-binding domain by a serine/threonine-rich linker. An alignment of the cloned gene and cDNA sequences showed that the gene contains three introns. The transcriptional start site and the site of polyadenylation were defined by primer extension and 3'RACE, respectively. The atypical Kozak sequence is identical to the one used in R. oryzae in positions -1 to -4. Northern slot blots revealed that glucoamylase transcription is induced during growth on starch and repressed by glucose. In silico analysis of the 1.9-kb promoter sequence cloned by inverse PCR revealed the presence of several putative regulatory elements, most notably a 19-bp sequence containing six overlapping copies of the Saccharomyces cerevisiae Nrg1p binding sequence.

Amino Acid Sequence↗

PubMed2005

Investigation of seven Vibrio virulence genes among Vibrio alginolyticus and Vibrio parahaemolyticus strains from the coastal mariculture systems in Guangdong, China.

AIMS: To investigate the distribution of the virulence of two Vibrio species among different strains obtained from the mariculture systems on the coast of Guangdong in China and the correlation between the virulence strains and the virulence genes among Vibrio alginolyticus. METHODS: Besides three strains, 72 V. alginolyticus strains and seven Vibrio parahaemolyticus strains were examined by PCR or semi-nested PCR for the virulence genes (tlh, trh, tdh, toxR, toxRS, ctxA, VPI). Additionally, the virulence of 18 V. alginolyticus strains was tested. SIGNIFICANCE AND IMPACT OF THE STUDY: Virulence genes homologous to those in the V. parahaemolyticus and Vibrio cholerae are widely distributed among V. alginolyticus and V. parahaemolyticus in the coastal mariculture systems in Guangdong, China. Some of the V. alginolyticus strains are pathogenic to aquatic animals, and might have derived their virulence genes from V. parahaemolyticus or V. cholerae, representing a possible reservoir of these genes. However, there is no correlation between presence and absence of the virulence genes used to investigate V. alginolyticus and its virulent strains. In this report, we also show that tlh is distributed among V. alginolyticus.

China↗

PubMed2000

Emx2 is required for growth of the hippocampus but not for hippocampal field specification.

The vertebrate Emx genes are expressed in a nested pattern in early embryonic cerebral cortex, such that a medial strip of cortex expresses Emx2 but not Emx1. This pattern suggests that Emx genes could play a role in specifying different areas or fields of the cortex along the mediolateral axis. Such a role has been supported by the observation that in mice lacking functional Emx2 the hippocampus is shrunken and the most medial field of the cortex, the hippocampal dentate gyrus, appears by cytoarchitecture to be missing (Pellegrini et al., 1996; Yoshida et al., 1997). Use of region-specific molecular markers shows, however, that hippocampal fields are specified and correctly positioned in the Emx2 mutant. In particular, a dentate cell population is generated, although it fails to form a morphological gyrus. This failure may be part of a more widespread medial cortical defect in the mutant. Examination of cortical cell proliferation and differentiation indicates a disruption of the maturation of the medial cortex in the absence of Emx2. Thus, Emx2 is required for normal growth and maturation of the hippocampus but not for the specification of cells to particular hippocampal field identities.

Animals↗

PubMed1991

Establishment of imaginal discs and histoblast nests in Drosophila.

In Drosophila the homeotic genes of the bithorax-complex (BX-C) and Antennapedia-complex (ANT-C) specify the identity of segments. Adult segment primordia are established in the embryo as the histoblast nests of the abdomen and the imaginal discs of the head, thorax and terminalia. We have used a molecular probe for the limb primordia and in vivo culture to describe the nature of the adult primordia in mutants in which the pattern of homeotic gene expression was altered. The results suggest that the histoblast or disc 'mode' of development is initiated by the extended germ band stage through activity of the BX-C and ANT-C and is relatively inflexible thereafter [corrected].

Animals↗

PubMed1999

[Detection of fetal DNA in maternal plasma using the nested polymerase chain reaction].

OBJECTIVE: To search for a new method of non-invasive prenatal gene diagnosis. METHODS: A single-copy human DYS14 gene of Y-chromosome of fetal DNA sequence was amplified by nested polymerase chain reaction (PCR) from twelve pregnant maternal plasma (12-40 weeks). A 239 bp and 198 bp specific fragment were obtained. The maternal plasma samples of twelve pregnant women were used directly for nested PCR. RESULTS The fragment was identified in 8 of 10 male-bearing pregnant women plasma. The diagnostic accordance rate was 80% (8/10), 6 to 8 women gave positive signals in two consecutive amplifications, 2 of 8 women gave positive signals in the second amplification. The rate of positive was increased greatly by nested PCR (from 60% to 80%). None of the other 2 female-bearing pregnant women had positive results. The final accuracy of 83.3% (10/12) was attained in all cases. CONCLUSION: The finding of circulating fetal DNA in maternal plasma may have new implications for non-invasive prenatal gene diagnosis, and the nested PCR possesses the advantages of sensitivity and specificity which improves the clinical application.

Adult↗

PubMed2004

Monoclonal gammopathy of undetermined significance (MGUS) is associated with an increased frequency of Epstein-Barr Virus (EBV) latently infected B lymphocytes in long-term renal transplant patients.

Monoclonal gammopathy of undetermined significance (MGUS) is a common phenomenon in kidney transplant patients that might be a prestage of posttransplant lymphoproliferative disease (PTLD). Because the role of Epstein-Barr virus (EBV) for PTLD development is well established, we wondered about the association between EBV and MGUS. Thus, B-cells from kidney transplant patients (25 with and 100 without MGUS) and from 100 healthy controls were analyzed for EBV latent (EBER1) and lytic (EA, VCA) gene expression by RT-nested PCR. The EBV load was measured by real-time PCR. A significantly higher EBV load and expression of the nonimmunogenic latency associated EBER 1 gene was observed in patients with MGUS compared to both control groups (P < .001). In addition, a rare detection of the highly immunogenic lytic transcripts demonstrated a linkage between latency-associated EBV infection and MGUS in transplant patients. This pattern was similar to EBV-associated B-cell lymphomas in nonimmunosuppressed patients. It contrasted with PTLD patients who express higher EBV loads and both lytic and latent EBV transcripts. These data suggest that transplant patients with MGUS demonstrate a more sufficient control of EBV-infected B-cells. Nevertheless, EBV monitoring should be performed in patients with EBV-associated MGUS for early detection of later PTLD.

Adult↗

PubMed2000

Comparison of PCR detection methods for B1, P30, and 18S rDNA genes of T. gondii in aqueous humor.

PURPOSE: Comparison of polymerase chain reaction (PCR) amplification of three Toxoplasma gondii genes in aqueous humor. METHODS: Nested PCRs carried out using published methods were optimized for maximum sensitivity and specificity. Five pairs of oligonucleotide primers, directed against the B1, P30, and ribosomal genes, were used and compared to determine which sequences were most effective in detecting T. gondii DNA. Methods were developed with DNA templates in water and were subsequently applied to both normal and inflamed aqueous. RESULTS: After one round of PCR amplification, P30 and ribosomal primers were able to detect 1 pg genomic T. gondii DNA. However, those directed against the B1 gene were able to detect 50 fg (approximately single tachyzoite). This level of sensitivity was also achieved using the P30 primers after a second round of PCR; however, only primers based on the B1 gene maintained this level of sensitivity in both normal and inflamed aqueous. B1-specific primers did not amplify sequences from fungal, bacterial, or human lymphocyte DNA. The sensitivity of T. gondii detection using B1 gene-specific primers was not compromised when large amounts of human lymphocyte DNA were present, and application to an ocular sample or retinal section from patients with toxoplasma chorioretinitis was successful in confirming the presence of T. gondii DNA. CONCLUSIONS: The B1 PCR protocol appears to be the most sensitive protocol in the detection of T. gondii DNA and has been successful in identification of T. gondii DNA in ocular fluids and retinal sections. This provides direct evidence of the presence of T. gondii within the eye and may therefore help in the management of toxoplasma retinochoroiditis.

Animals↗

PubMed2001

Novel protein domains and repeats in Drosophila melanogaster: insights into structure, function, and evolution.

Sequence database searching methods such as BLAST, are invaluable for predicting molecular function on the basis of sequence similarities among single regions of proteins. Searches of whole databases however, are not optimized to detect multiple homologous regions within a single polypeptide. Here we have used the prospero algorithm to perform self-comparisons of all predicted Drosophila melanogaster gene products. Predicted repeats, and their homologs from all species, were analyzed further to detect hitherto unappreciated evolutionary relationships. Results included the identification of novel tandem repeats in the human X-linked retinitis pigmentosa type-2 gene product, repeated segments in cystinosin, associated with a defect in cystine transport, and 'nested' homologous domains in dysferlin, whose gene is mutated in limb girdle muscular dystrophy. Novel signaling domain families were found that may regulate the microtubule-based cytoskeleton and ubiquitin-mediated proteolysis, respectively. Two families of glycosyl hydrolases were shown to contain internal repetitions that hint at their evolution via a piecemeal, modular approach. In addition, three examples of fruit fly genes were detected with tandem exons that appear to have arisen via internal duplication. These findings demonstrate how completely sequenced genomes can be exploited to further understand the relationships between molecular structure, function, and evolution.

Amino Acid Sequence↗

PubMed1997

A novel nested-PCR strategy for the detection of rearranged immunoglobulin heavy-chain genes in B cell tumors.

Several methods have been developed for the detection of minimal residual disease (MRD) in B cell tumors. Chromosomal translocations or the rearrangement of the immunoglobulin heavy chain (IgH) and T cell receptor genes are generally employed. We report a novel PCR method to detect MRD using IgH genes. IgH rearranged variable region (VDJ) were amplified from tumor specimens using consensus primers for variable and joining region genes. Complementarity-determining regions (CDR) were identified and used to generate tumor-specific primers. Two-round amplifications using primers derived from CDRs and joining or constant regions were performed for MRD detection. IgH nested-PCR approach was tested on a panel of 75 B cell tumors including acute lymphoblastic and chronic lymphocytic leukemias, non-Hodgkin's lymphomas and multiple myelomas. A VDJ sequence was obtained in 62 out of 75 cases (83%). Sensitivity using DNA or cDNA templates was 10(-5) and (-6), respectively. This method is specific and sensitive and provides a simple, non-radioactive approach for the evaluation of MRD in B cell tumors.

Burkitt Lymphoma↗

PubMed2003

The presence of parvovirus B19 VP and NS1 genes in the synovium is not correlated with rheumatoid arthritis.

OBJECTIVE: To amplify both NS1 and VP genes of Parvovirus B19 DNA in synovial membrane (SM) and serum obtained from patients with rheumatoid arthritis (RA) and to analyze whether the presence of viral DNA is correlated with synovitis. METHODS: DNA obtained from 30 SM and 24 serum samples from RA patients was analyzed using single round-polymerase chain reaction (PCR) and nested PCR for both VP and NS1 genes of parvovirus B19. Twenty-four SM and serum samples from sex and age matched subjects with osteoarthritis (OA) or joint trauma served as controls. RESULTS: The first round PCR was negative for NS1 in RA samples. After nested PCR, NS1 was detected in the SM of 6/30 patients and of 10/24 controls and in the serum of 4/24 patients and controls. Nested PCR for the VP gene detected viral DNA in the SM of 7/30 patients with RA and of 7/24 of the controls and in the serum of 5/24 patients and of 2/24 controls. Altogether parvovirus DNA was found in the SM of 11/30 (36.6%) patients and of 12/24 (50%) controls and in the serum of 8/24 (33.3%) patients with RA and of 5/24 (20.8%) controls. CONCLUSION: Our results suggest that the amplification by nested PCR of both NS1 and VP genes is necessary to define the presence of viral DNA in tissue samples and confirm that the presence of parvovirus B19 DNA is similar in RA and control SM, suggesting that simple detection of viral DNA is not sufficient to confirm a link between the virus and RA.

Adult↗

PubMed2003

[Diagnosing achondroplasia by single cell nested-PCR].

OBJECTIVE: To research on the reliability of diagnosing achondroplasia (ACH) on single cell level and to provide a basis for preimplantation genetic diagnosis(PGD). METHODS: The high-frequency mutation region G380R of fibroblast growth factor receptor 3(FGFR3) gene was amplified by nested-PCR with single lymphocyte and single blastomere. The products of PCR were digested by restriction enzyme Bfm I, then the digested products were detected by 10% polyacrylamida gel electrophoresis(PAGE). RESULTS: The amplification success rate, allele dropout rate and correct diagnosis rate of single lymphocyte's PCR were 90.4%, 8.2% and 91.8%,respectively. The amplification success rate of single blastomere was 75.4%. CONCLUSION: The diagnosis of ACH by single cell nested-PCR is comparatively stable and reliable.

Achondroplasia↗

PubMed1999

Polymerase chain reaction/denaturing gradient gel electrophoresis (PCR/DGGE): sensitivity, band pattern analysis, and methodologic optimization.

Polymerase chain reaction/denaturing gradient gel electrophoresis (PCR/DGGE) has been gaining popularity as a preferred method to determine the clonality of T-cell populations in small or sparsely infiltrated specimens such as skin biopsies. T-cell receptor (TCR)-gamma gene rearrangements are amplified using nested consensus primers in two rounds of PCR and then are separated by DGGE. Sensitivity is better than with conventional Southern blot analysis but not fully defined. In addition to a discrete primary band resulting from a monoclonal TCR-gamma gene rearrangement, there are often weaker secondary bands of unknown origin. Our goals were to define the PCR/DGGE clonal detection threshold, determine the genesis of the multiband pattern, and optimize methods to minimize extraneous bands. Titration studies showed that the sensitivity of PCR/DGGE for detecting clonal T-cell DNA is affected by the polyclonal T-cell content of the background DNA. The detection threshold is 0.001% using keratinocyte DNA as diluent but only 1% with tonsil DNA. Analysis of monoclonal T-cell lines showed that multiple bands can be produced by a single TCR-gamma gene rearrangement. Mixing of inner and outer primer pair PCR products showed that this is an artifact resulting from different sized PCR products produced during the two rounds of nested PCR required for optimal specificity. Repeat DGGE of isolated bands ruled out variable mobility of partially melted PCR products. Reduction of first round PCR product used as second round target from 10 microl to 1 microl, or a decrease of first round primers from 40 pmole to 5 pmole, resulted in diminished secondary bands without compromising primary band intensity. These results show that: 1) PCR/DGGE has a realistic clonal detection threshold of 0.1% to 1%, 2) multiple bands are consistent with a monoclonal T-cell population, and 3) conditions can be optimized to minimize artifactual secondary bands.

DNA↗

PubMed1995

A regulatory element in the promoter of the human granulocyte-macrophage colony-stimulating factor gene that has related sequences in other T-cell-expressed cytokine genes.

Granulocyte-macrophage colony-stimulating factor (GM-CSF) is a cytokine with a broad spectrum of cell-differentiating and colony-stimulating activities. It is expressed by several undifferentiated (bone marrow stromal cells, fibroblasts) and fully differentiated (T cells, macrophages, and endothelial cells) cells. Its expression in T cells is activation dependent. We have found a regulatory element in the promoter of the GM-CSF gene which contains two symmetrically nested inverted repeats (-192 CTTGGAAAGGTTCATTAATGAAAACCCCCAAG -161). In transfection assays with the human GM-CSF promoter, this element has a strong positive effect on the expression of a reporter gene by the human T-cell line Jurkat J6 upon stimulation with phorbol dibutyrate and ionomycin or anti-CD3 antibody. This element also acts as an enhancer when inserted into a minimal promoter vector. In DNA band-retardation assays this sequence produces six specific bands that involve one or the other of the inverted repeats. We have also shown that a DNA-protein complex can be formed involving both repeats and probably more than one protein. The external inverted repeat contains a core sequence CTTGG...CCAAG, which is also present in the promoters of several other T-cell-expressed human cytokines (interleukins 4, 5, and 13). The corresponding elements in GM-CSF and interleukin 5 promoters compete for the same proteins in band-retardation assays. The palindromic elements in these genes are larger than the core sequence, suggesting that some of the interacting proteins may be different for different genes. Considering the strong positive regulatory effect and their presence in several T-cell-expressed cytokine genes, these elements may be involved in the coordinated expression of these cytokines in T-helper cells.

Base Sequence↗

PubMed2000

[Cloning and expression of full-length subtype E and subtype B gag gene from uncultured PBMCs of HIV-1 infected individuals in China].

OBJECTIVE: To clone and express subtype E and subtype B gag gene of the prevalent HIV-1 strain in China. METHODS: One HIV-1 positive sample, whose subtype had been determined as sub-type E and one HIV-1 positive sample, whose subtype had been determined as subtype B by sequence analysis of partial env gene were chosen to be amplified by nested PCR. We got two full-length fragments of gag gene and incorporated them first into plin8Pr55 and then into pFastBacl. RESULTS: Sequence analysis showed the cloned gag genes have the complete open-reading frames and have no major deletion and insertion. Using the Bac-toBac system, we obtained the recombinant baculoviruses containing gag genes. Western-blot analysis showed that insect cells infected with gag recombinant baculoviruses expressed HIV-1 gag antigen. Thin section electron microscopy showed that virus-like particles (VLPs) formed in insect cells was infected with gag. CONCLUSIONS: The cloning and expression of gag genes of the prevalent HIV-1 stains in China revealed that the cloned genes have intact structure and function and this paves the way for the development of HIV-1 vaccines targeted at the epidemic of HIV-1 in China, also for the study of biological functions of gag gene and development of diagnostic kits of HIV-1.

Animals↗

PubMed2006

HPV prevalence, E6 sequence variation and physical state of HPV16 isolates from patients with cervical cancer in Sichuan, China.

OBJECTIVES: Infection with high-risk human papillomavirus (hr-HPV) is an important factor associated with cervical cancer. The genetic mutation of HPV16 E6 and integration of HPV16 DNA in the cervical carcinoma tissues are considered important genetic changes in cervical lesion progression. But the studies of hr-HPV epidemiology are relatively less in the area of Sichuan, China. Therefore, we investigated the prevalence of 9 high-risk subtypes and analyzed the genetic mutation characteristic of HPV16 E6 and physical state of HPV16 DNA. METHODS: The fragments of L1 and E6 genes were amplified by PCR or nested PCR and then directly sequenced. Further, the multiplex PCR for HPV16 E2 and E6 genes was performed for detection of integration. RESULTS: HPV16, 58 and 18 were prominent, accounting for 78.6%, 20.0% and 9.7%, respectively in 145 isolates. E6 variants revealed that the European (EP) prototype and East Asia (EA) strain were 26 (23.0%) and 34 (30.1%), respectively. Furthermore, there were 14 base substitutions in E6 regions of the study group, of which 12 resulted in amino acid changes and the rest was silent mutation. Significantly, the 240G substitution exactly located the P53 degradation site. Overall, 8 of 114 (7.0%) isolates only contained integrated HPV16 DNA, 43 (37.7%) only contained episomal DNA and 63 (55.3%) contained both integrated and episomal DNA. The proportion of disruption of an intact E2 gene in the patients with cervical cancer is much lower than that in the previous studies. CONCLUSIONS: HPV16, 58 and 18 were mainly prevailing subtypes in patients with cervical cancer from Sichuan areas, China and EP/EA strains were predominant in these areas. Some mutations of E6 gene, which lead to the amino acid changes, may be more potentially carcinogenic and the proportion of disruption of an intact E2 gene is much lower.

Adenocarcinoma↗

PubMed2001

Cholesterol biosynthesis from lanosterol. A concerted role for Sp1 and NF-Y-binding sites for sterol-mediated regulation of rat 7-dehydrocholesterol reductase gene expression.

The 7-dehydrocholesterol reductase (Dhcr7) is the terminal enzyme in the pathway of cholesterol biosynthesis. We have previously reported that sterol depletion in vivo caused a significant induction of both liver mRNA and enzyme activity of Dhcr7 (Bae, S.-H., Lee, J. N., Fitzky, B. U., Seong, J., and Paik, Y.-K. (1999) J. Biol. Chem. 274, 14624-14631). In this paper, we also observed liver cell-specific sterol-mediated Dhcr7 gene induction in vitro by sterol depletion in rat hepatoma cells, suggesting the presence of sterol-mediated regulatory elements in the Dhcr7 gene. To understand the mechanisms responsible for regulating Dhcr7 expression, we have isolated the 5'-flanking region of the gene encoding rat Dhcr7 and have characterized the potential regulatory elements of the gene that are responsible for sterol-mediated regulation. The Dhcr7 promoter contains binding sites for Sp1 (at -177, -172, -125, and -20), NF-Y (at -88 and -51), and SREBP-1 or ADD1 (at -33). Deletion analysis of the Dhcr7 gene promoter (-1053/+31), employing a nested series of Dhcr7-luciferase constructs, demonstrated that the -179 upstream region of the gene is necessary and sufficient for optimal efficient sterol-regulated transcription. DNase I footprinting and electrophoretic mobility shift assay showed that the SRE1/E box (-33/-22) involved in sterol response of many sterol-related enzyme genes was protected specifically by the overexpressed recombinant ADD1. Mutational analysis for the functional relationship between the identified cis-elements in this region indicate that one of the binding sites for Sp1 (GC box at -125) and NF-Y (CCAAT box at -88) plays a cooperative role in the sterol-mediated activation, in which the latter site also acts as a co-regulator for SREBP-activated Dhcr7 promoter activity. We believe that Dhcr7 is the first enzyme characterized with a sterol-regulatory function in the post-lanosterol pathway. This may be important for understanding the coordinated control of cholesterol biosynthesis as well as the molecular mechanism of Smith-Lemli-Opitz syndrome-related protein in mammals.

Animals↗

PubMed2001

DNA from uncultured organisms as a source of 2,5-diketo-D-gluconic acid reductases.

Total DNA of a population of uncultured organisms was extracted from soil samples, and by using PCR methods, the genes encoding two different 2,5-diketo-D-gluconic acid reductases (DKGRs) were recovered. Degenerate PCR primers based on published sequence information gave internal gene fragments homologous to known DKGRs. Nested primers specific for the internal fragments were combined with random primers to amplify flanking gene fragments from the environmental DNA, and two hypothetical full-length genes were predicted from the combined sequences. Based on these predictions, specific primers were used to amplify the two complete genes in single PCRs. These genes were cloned and expressed in Escherichia coli. The purified gene products catalyzed the reduction of 2,5-diketo-D-gluconic acid to 2-keto-L-gulonic acid. Compared to previously described DKGRs isolated from Corynebacterium spp., these environmental reductases possessed some valuable properties. Both exhibited greater than 20-fold-higher kcat/Km values than those previously determined, primarily as a result of better binding of substrate. The Km values for the two new reductases were 57 and 67 microM, versus 2 and 13 mM for the Corynebacterium enzymes. Both environmental DKGRs accepted NADH as well as NADPH as a cosubstrate; other DKGRs and most related aldo-keto reductases use only NADPH. In addition, one of the new reductases was more thermostable than known DKGRs.

Amino Acid Sequence↗