SEARCH · PubMed Health

Results for “PHOSPHOTRANSFERASES”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 487 records · Page 27Linked to original sources

PubMed1996

Molecular analysis of the scrA and scrB genes from Klebsiella pneumoniae and plasmid pUR400, which encode the sucrose transport protein Enzyme II Scr of the phosphotransferase system and a sucrose-6-phosphate invertase.

The Klebsiella pneumoniae genes scrA and scrB are indispensable for sucrose (Scr) utilisation. Gene scrA codes for an Enzyme IIScr (IIScr) transport protein of the phosphoenolpyruvate-dependent carbohydrate: phosphotransferase system (PTS), while scrB encodes a sucrose 6-phosphate specific invertase. A 3.7 kbscr AB DNA fragment has been cloned from K. pneumoniae and expressed in Escherichia coli. Its nucleotide sequence was determined and the coding regions for scrA (1371 bp) and scrB (1401 bp) were identified by genetic complementation, enzyme activity test and radiolabelling of the gene products. In addition, the nucleotide sequence of the scrB gene from conjugative plasmid pUR400 isolated from Salmonella typhimurium was also determined and errors in the previously published sequence of the scrA gene of pUR400 were corrected. Extensive similarity was found between the sequences of ScrA and other Enzymes II, as well as between the two invertases and other sucrose hydrolysing enzymes. Based on the analysis of seven IIScr proteins, a hypothetical model of the secondary structure of IIScr is proposed.

Amino Acid Sequence↗

PubMed1995

Regulation of glycerol and maltose uptake by the IIAGlc-like domain of IINag of the phosphotransferase system in Salmonella typhimurium LT2.

In Enterobacteriaceae the nonphosphorylated form of IIAGlc of the phosphoenolpyruvate-dependent phosphotransferase system (PTS) can inhibit the uptake and subsequent metabolism of glycerol and maltose by binding to, and inhibiting, glycerol kinase and the MalK protein of the maltose transport system, respectively. In this report we show that the IIAGlc-like domain of the membrane-bound IIN-acetylglucosamine (IINag) of the PTS can replace IIAGlc in a Salmonella typhimurium crr mutant strain that lacks all soluble IIAGlc. The inhibition was most severe in cells which were partially induced for the glycerol or maltose uptake systems. The Streptococcus thermophilus lactose transporter LacS, which also contains a IIAGlc-like domain, could not replace IIAGlc. Neither IINag nor LacS could replace IIAGlc in activation of adenylate cyclase.

Acetylglucosamine↗

PubMed1991

Evolutionary relationships among the permease proteins of the bacterial phosphoenolpyruvate: sugar phosphotransferase system. Construction of phylogenetic trees and possible relatedness to proteins of eukaryotic mitochondria.

The amino acid sequences of 15 sugar permeases of the bacterial phosphoenolpyruvate-dependent phosphotransferase system (PTS) were divided into four homologous segments, and these segments were analyzed to give phylogenetic trees. The permease segments fell into four clusters: the lactose-cellobiose cluster, the fructose-mannitol cluster, the glucose-N-acetylglucosamine cluster, and the sucrose-beta-glucoside cluster. Sequences of the glucitol and mannose permeases (clusters 5 and 6, respectively) were too dissimilar to establish homology with the other permeases, but short regions of statistically significant sequence similarities were noted. The functional and structural relationships of these permease segments are discussed. Some of the homologous PTS permeases were found to exhibit sufficient sequence similarity to subunits 4 and 5 of the eukaryotic mitochondrial NADH dehydrogenase complex to suggest homology. Moreover, subunits 4 and 5 of this complex appeared to be homologous to each other, suggesting that these PTS and mitochondrial proteins comprise a superfamily. The integral membrane subunits of the evolutionarily divergent mannose PTS permease, the P and M subunits, exhibited limited sequence similarity to subunit 6 of the mitochondrial F1F0-ATPase and subunit 5b of cytochrome oxidase, respectively. These results suggest that PTS sugar permeases and mitochondrial proton-translocating proteins may be related, although the possibility of convergent evolution cannot be ruled out.

Acetylglucosamine↗

PubMed1994

Membrane-bound neomycin phosphotransferase confers drug-resistance in mammalian cells: a marker for high-efficiency targeting of genes encoding secreted and cell-surface proteins.

An efficient method for inactivating genes is the use of silent selectable markers that are expressed only after homologous recombination into the active target gene. However, use of this approach for genes encoding secreted or membrane-anchored proteins may produce hybrid proteins comprising the N-terminal signal sequence from the target gene linked to the protein conferring drug resistance. Such chimeric enzymes will be secreted, precluding selection for drug resistance. To overcome this problem, we tested the possibility of anchoring in the membrane the cytoplasmic neomycin phosphotransferase (NPT). We constructed a fusion gene with a transmembrane domain connecting the N-terminal signal sequence of a membrane-targeted protein and the neo gene. Expression of this gene yielded G418-resistant colonies of C2C12 cells which contained assayable NPT activity. Comparison of enzyme activity in cell extract fractions verified that the active fusion protein was insoluble, presumably through localization to a membrane compartment. Transmembrane neo cassettes should serve as integration-activated markers capable of targeting genes encoding secreted or cell surface proteins.

Amino Acid Sequence↗

PubMed1998

Coupling physiology and gene regulation in bacteria: the phosphotransferase sugar uptake system delivers the signals.

In many bacteria a crucial link between metabolism and regulation of catabolic genes is based on the phosphotransferase sugar uptake system (PTS). We summarize the mechanisms of the signaling pathways originating from PTS and leading to regulation of transcription. A protein domain, called PTS regulation domain (PRD), is linked to many antiterminators and transcriptional activators and regulates their activity depending on its state of phosphorylation. Two sites can be phosphorylated in most PRDs: HPr-dependent modification at one site leads to activation while enzyme II dependent phosphorylation of the other site renders it inactive. In addition, PTS components are used to generate cofactors for regulators of transcription. The paradigm is the enzyme II dependent activity of adenylate cyclase determining the cyclic AMP level in Escherichia coli and thereby the activity of the catabolite activator protein. In many gram-positive bacteria catabolite repression is mediated by the catabolite control protein CcpA, which requires HPr Ser-46 phosphate as a cofactor to regulate transcription of catabolic genes. HPr Ser-46 phosphate is produced by HPr kinase, the activity of which is under metabolic control via the concentrations of glycolytic intermediates. These recent results establish a multifaceted regulatory role for PTS in addition to its well-established function in active sugar uptake.

Cyclic AMP↗

PubMed2003

Dependency of sugar transport and phosphorylation by the phosphoenolpyruvate-dependent phosphotransferase system on membranous phosphatidylethanolamine in Escherichia coli: studies with a pssA mutant lacking phosphatidylserine synthase.

An isogenic pair of Escherichia coli strains lacking ( pssA) and possessing (wild-type) the enzyme phosphatidylserine synthase was used to estimate the effects of the total lack of phosphatidylethanolamine (PE), the major phospholipid in E. coli membranes, on the activities of several sugar permeases (enzymes II) of the phosphoenolpyruvate:sugar phosphotransferase system (PTS). The mutant exhibits greatly elevated levels of phosphatidylglycerol (PG), a lipid that has been reported to stimulate the in vitro activities of several PTS permeases. The activities, thermal stabilities, and detergent sensitivities of three PTS permeases, the glucose enzyme II (II(Glc)), the mannose enzyme II (II(Man)) and the mannitol enzyme II (II(Mtl)), were characterized. Western blot analyses revealed that the protein levels of II(Glc) were not appreciably altered by the loss of PE. In the pssA mutant, II(Glc) and II(Man) activities were depressed both in vivo and in vitro, with the in vivo transport activities being depressed much more than the in vitro phosphorylation activities. II(Mtl) also exhibited depressed transport activity in vivo but showed normal phosphorylation activities in vitro. II(Man) and II(Glc) exhibited greater thermal lability in the pssA mutant membranes than in the wild-type membranes, but II(Mtl) showed enhanced thermal stability. All three enzymes were activated by exposure to TritonX100 (0.4%) or deoxycholate (0.2%) and inhibited by SDS (0.1%), but II(Mtl) was the least affected. II(Man) and, to a lesser degree, II(Glc) were more sensitive to detergent treatments in the pssA mutant membranes than in the wild-type membranes while II(Mtl) showed no differential effect. The results suggest that all three PTS permeases exhibit strong phospholipid dependencies for transport activity in vivo but much weaker and differential dependencies for phosphorylation activities in vitro, with II(Man) exhibiting the greatest and II(Mtl) the least dependency. The effects of lipid composition on thermal sensitivities and detergent activation responses paralleled the effects on in vitro phosphorylation activities. These results together with those previously published suggest that, while the in vivo transport activities of all PTS enzymes II require an appropriate anionic to zwitterionic phospholipid balance, the in vitro phosphorylation activities of these same enzymes show much weaker and differential dependencies. Alteration of the phospholipid composition of the membrane thus allows functional dissection of transport from the phosphorylation activities of PTS enzyme complexes.

Bacterial Proteins↗

PubMed2005

The glycolytic genes pfk and pyk from Lactobacillus casei are induced by sugars transported by the phosphoenolpyruvate:sugar phosphotransferase system and repressed by CcpA.

In Lactobacillus casei BL23, phosphofructokinase activity was higher in cells utilizing sugars transported by the phosphoenolpyruvate:sugar phosphotransferase system (PTS). The phosphofructokinase gene (pfk) was cloned from L. casei and shown to be clustered with the gene encoding pyruvate kinase (pyk). pfk and pyk genes are cotranscribed and induced upon growth on sugars transported by the PTS. Contrarily to the model proposed for Lactococcus lactis, where the global catabolite regulator protein (CcpA) is involved in PTS-induced transcription of pfk and pyk, a ccpA mutation resulted in a slight increase in pfk-pyk expression in L. casei. This weak regulation was evidenced by CcpA binding to a region of the pfk-pyk promoter which contained two cre sequences significantly deviated from the consensus. The PTS induction of pfk-pyk seems to be counteracted by the CcpA-mediated repression. Our results suggest that the need to accommodate the levels of pfk-pyk mRNA to the availability of sugars is fulfilled in L. casei by a PTS/CcpA-mediated signal transduction different from L. lactis.

Amino Acid Sequence↗

PubMed2006

Characterisation of a glucose phosphotransferase system in Clostridium acetobutylicum ATCC 824.

The transport of glucose by the solventogenic anaerobe Clostridium acetobutylicum was investigated. Glucose phosphoenolpyruvate (PEP)-dependent phosphotransferase system (PTS) activity was detected in extracts prepared from cultures grown on glucose and extract fractionation revealed that both soluble and membrane components are required for activity. Glucose PTS activity was inhibited by the analogue methyl alpha-glucoside, indicating that the PTS enzyme II belongs to the glucose-glucoside (Glc) family of proteins. Consistent with this conclusion, labelled methyl alpha-glucoside was phosphorylated by PEP in cell-free extracts and this activity was inhibited by glucose. A single gene encoding a putative enzyme II of the glucose family, which we have designated glcG, was identified from the C. acetobutylicum ATCC 824 genome sequence. In common with certain other low-GC gram-positive bacteria, including Bacillus subtilis, the C. acetobutylicum glcG gene appears to be associated with a BglG-type regulator mechanism, as it is preceded by a transcription terminator that is partially overlapped by a typical ribonucleic antiterminator (RAT) sequence, and is downstream of an open reading frame that appears to encode a transcription antiterminator protein. This is the first report of a glucose transport mechanism in this industrially important organism.

Amino Acid Sequence↗

PubMed2001

Characterization of sugar mixtures utilization by an Escherichia coli mutant devoid of the phosphotransferase system.

Due to catabolite repression in microorganisms, sugar mixtures cannot be metabolized in a rapid and efficient manner. Therefore, the development of mutant strains that avoid this regulatory system is of special interest to fermentation processes. In the present study, the utilization of sugar mixtures by an Escherichia coli mutant strain devoid of the phosphotransferase system (PTS) was characterized. This mutant can transport glucose (PTS- Glucose+ phenotype) by a non-PTS mechanism as rapidly as its wild-type parental strain. In cultures grown in minimal medium supplemented with glucose-xylose or glucose-arabinose mixtures, glucose repressed arabinose- or xylose-utilization in the wild-type strain. However, under the same culture conditions with the PTS- Glucose+ mutant, glucose and arabinose were co-metabolized, but glucose still exerted a partial repressive effect on xylose consumption. In cultures growing with a triple mixture of glucose-arabinose-xylose, the wild-type strain sequentially utilized glucose, arabinose and finally, xylose. In contrast, the PTS- Glucose+ strain co-metabolized glucose and arabinose, whereas xylose was utilized after glucose-arabinose depletion. As a result of glucose-arabinose co-metabolism, the PTS- Glucose+ strain consumed the total amount of sugars contained in the culture medium 16% faster than the wild-type strain. [14C]-Xylose uptake experiments showed that in the PTS- Glucose+ strain, galactose permease increases xylose transport capacity and the observed partial repression of xylose utilization depends on the presence of intracellular glucose.

Carbohydrate Metabolism↗

PubMed2003

Silencing of hygromycin phosphotransferase (hph) gene during sexual cycle and its reversible inactivation in heterokaryon of Neurospora crassa.

We transformed wild-type Neurospora crassa with hph gene encoding hygromycin phosphotransferase to obtain hygromycin-resistant (HygR) transformants and studied their behavior in the vegetative and sexual phases of growth. During vegetative growth in the absence of hygromycin, the hph gene was stable for at least three successive transfers with conidia. On the other hand, the behavior of the transformants in the sexual phase was different. The segregation of hph gene in the meiotic progeny was in accordance with the Mendelian ratio as inferred from PCR analysis. However, in spite of inheriting the hph gene, a proportion of the meiotic progeny failed to grow in the presence of hygromycin. This suggested that the hph gene is silenced in some progeny. The silencing effect was not confined to hph gene expression, since one-half of the meiotic progeny also showed poor conidiation. Genomic Southern analysis indicated deletions/rearrangements of the transgene in the progeny. A heterokaryon between silenced and non-silenced strains was able to grow on hygromycin-containing medium, showing that silencing was recessive. Silencing was reversed in homokaryotic nuclei extracted from such heterokaryon.

Crosses, Genetic↗

PubMed2004

Molecular characteristics of phosphoenolpyruvate: mannose phosphotransferase system in Streptococcus bovis.

To elucidate the regulatory mechanism of catabolite control in Streptococcus bovis, we investigated the molecular properties and gene expression of the mannose-specific phosphoenolpyruvate (PEP)-dependent sugar: phosphotransferase system (PTS). The mannose PTS gene cluster (man) was found to comprise a gene encoding enzyme (E) II AB (manL) and genes encoding EIIC (manM), EIID (manN), and a putative regulator (manO). The gene cluster (man operon) was transcribed from one transcriptional start site, which was located 40 bp upstream of the manL start codon. However, two transcriptional start sites were found between manN and manO in primer extension analysis, and the manO may be transcribed independently from the man operon. The man operon and manO were constitutively transcribed without being affected by culture conditions, such as the sugar supplied (glucose, galactose, fructose, maltose, lactose, sucrose, or mannose), growth rate, or pH.

Mannose↗

PubMed2007

Identification of a 20-bp regulatory element of the Arabidopsis pyrophosphate:fructose-6-phosphate 1-phosphotransferase alpha2 gene that is essential for expression.

Arabidopsis harbors two alpha and two beta genes of pyrophosphate:fructose-6-phosphate 1-phosphotransferase (PFP). The spatial expression patterns of the two AtPFPalpha genes were analyzed using transgenic plants containing a promoter::ss-glucuronidase (GUS) fusion construct. Whereas the AtPFPalpha1 promoter was found to be ubiquitously active in all tissues, the AtPFPalpha2 promoter is preferentially expressed in specific heterotrophic regions of the Arabidopsis plant such as the trichomes of leaves, cotyledon veins, roots, and the stamen and gynoecium of the flowers. Serial deletion analysis of the AtPFPalpha2 promoter identified a key regulatory element from nucleotides -194 to -175, CGAAAAAGGTAAGGGTATAT, which we have termed PFPalpha2 and which is essential for AtPFPalpha2 gene expression. Using a GUS fusion construct driven by this 20-bp sequence in conjunction with a -46 CaMV35S minimal promoter, we also demonstrate that PFPalpha2 is sufficient for normal AtPFPalpha2 expression. Hence, this element can not only be used to isolate essential DNA-binding protein(s) that control the expression of the carbon metabolic enzyme AtPFPalpha2, but has also the potential to be utilized in the production of useful compounds in a specific organ such as the leaf trichomes.

Arabidopsis↗

PubMed2001

Physiological relevance of fructose 2,6-bisphosphate in the regulation of spinach leaf pyrophosphate:fructose 6-phosphate 1-phosphotransferase.

A major problem in defining the physiological role of pyrophosphate:fructose 6-phosphate 1-phosphotransferase (PFP, EC 2.7.1.90) is the 1,000-fold discrepancy between the apparent affinity of PFP for its activator, fructose 2,6-bisphosphate (Fru-2,6-P2), determined under optimum conditions in vitro and the estimated concentration of this signal metabolite in vivo. The aim of this study was to investigate the combined influence of metabolic intermediates and inorganic phosphate (Pi) on the activation of PFP by Fru-2,6-P2. The enzyme was purified to near-homogeneity from leaves of spinach (Spinacia oleracea L.). Under optimal in vitro assay conditions, the activation constant (Ka) of spinach leaf PFP for Fru-2,6-P2 in the glycolytic direction was 15.8 nM. However, in the presence of physiological concentrations of fructose 6-phosphate, inorganic pyrophosphate (PPi), 3-phosphoglycerate (3PGA), phosphoenolpyruvate (PEP), ATP and Pi the Ka of spinach leaf PFP for Fru-2,6-P2 was up to 2000-fold greater than that measured in the optimised assay and Vmax decreased by up to 62%. Similar effects were observed with PFP purified from potato (Solanum tuberosum L.) tubers. Cytosolic metabolites and Pi also influenced the response of PFP to activation by its substrate fructose 1,6-bisphosphate (Fru-1,6-P2). When assayed under optimum conditions in the gluconeogenic direction, the Ka of spinach leaf PFP for Fru-1,6-P2 was approximately 50 microM. Physiological concentrations of PPi, 3PGA, PEP, ATP and Pi increased Ka up to 25-fold, and decreased Vmax by over 65%. From these results it was concluded that physiological concentrations of metabolites and Pi increase the Ka of PFP for Fru-2,6-P2 to values approaching the concentration of the activator in vivo. Hence, measured changes in cytosolic Fru-2,6-P2 levels could appreciably alter the activation state of PFP in vivo. Moreover, the same levels of metabolites increase the Ka of PFP for Fru-1,6-P2 to an extent that activation of PFP by this compound is unlikely to be physiologically relevant.

Buffers↗

PubMed2002

Streptomyces olivaceoviridis possesses a phosphotransferase system that mediates specific, phosphoenolpyruvate-dependent uptake of N-acetylglucosamine.

We recently described the ABC transporter Ngc (encoded by the ncgEFG operon) from Streptomyces olivaceoviridis, the first of its kind to be shown to transport N-acetylglucosamine and N,N'-diacetylchitobiose (chitobiose). A chromosomal mutant carrying a disruption of the ngcE gene, which encodes the sugar binding protein, was still able to transport N-acetylglucosamine. This phenotype can now be attributed to a functional phosphoenolpyruvate (PEP)-dependent phosphotransferase system (PTS). Two adjacent homologous genes, ptsC1 and ptsC2, were identified, and deduced to encode proteins which are 56% identical and can be predicted to contain eight transmembrane regions. PtsC1 (432 amino acids) and PtsC2 (403 residues) each correspond to a single EIIC domain; such domains are otherwise known only in several bacterial multidomain permeases for glucose/mannose or N-acetylglucosamine. The C-terminal sequences of PtsC1 and PtsC2 correspond to the motifs LKTPGREP and LPTRGRES, respectively. The ptsB gene located upstream of ptsC1 is predicted to encode a homologue of the EIIB domains usually found in bacterial multidomain permeases. Physiological and biochemical analyses of ngcE mutants carrying disruptive insertions in ptsC1 or ptsC2 or both revealed that, when grown on N-acetylglucosamine, the membrane component PtsC2, unlike PtsC1, mediates PEP-dependent, specific (K(m)=5 micro M) transport of N-acetylglucosamine, but not of other hexoses. Cross-complementation of membrane and cytoplasmic fractions from the various mutants led to the conclusion that S. olivaceoviridis also expresses the functional soluble components HPr, EI and EIIA of the PTS system. During growth on xylose, uptake of this pentose occurred if ptsC1 or ptsC2 was intact, but not in a mutant containing disrupted forms of both genes.

Acetylglucosamine↗

PubMed2001

Thermoadaptation of a mesophilic hygromycin B phosphotransferase by directed evolution in hyperthermophilic Archaea: selection of a stable genetic marker for DNA transfer into Sulfolobus solfataricus.

A mutated version of the hygromycin B phosphotransferase (hph(mut)) gene from Escherichia coli, isolated by directed evolution at 75 degrees C in transformants of a thermophilic strain of Sulfolobus solfataricus, was characterized with respect to its genetic stability in both the original mesophilic and the new thermophilic hosts. This gene was demonstrated to be able to express the hygromycin B resistance phenotype and to be steadily maintained and propagated also in other, more thermophilic strains of S. solfataricus, i.e., up to 82 degrees C. Furthermore, it may be transferred to S. solfataricus cells by cotransformation with pKMSD48, another extrachromosomal element derived from the virus SSV1 of Sulfolobus shibatae, without any loss of stability and without affecting the replication and infectivity of this viral DNA. The hph(mut) and the wild-type gene products were expressed at higher levels in E. coli and purified by specific affinity chromatography on immobilized hygromycin B. Comparative characterization revealed that the mutant enzyme had acquired significant thermoresistance and displayed higher thermal activity with augmented catalytic efficiency.

Adaptation, Biological↗

PubMed2006

An 18 kDa acid phosphatase from chicken heart possesses phosphotransferase activity.

A low molecular weight acid phosphatase was purified to homogeneity from chicken heart with a specific activity of 42 U/mg and a recovery of about 1%. Nearly 800 fold purification was achieved. The molecular weight was estimated to be 18 kDa by SDS-polyacrylamide gel electrophoresis. Para-nitrophenyl phosphate, phenyl phosphate and flavin mononucleotide were efficiently hydrolysed by the enzyme and found to be good substrates. Fluoride and tartrate had no inhibitory effect while phosphate, vanadate and molybdate strongly inhibited the enzyme. The acid phosphatase was stimulated in the presence of glycerol, ethylene glycol, methanol, ethanol and acetone, which reflected the phosphotransferase activity. When phosphate acceptors such as ethylene glycol concentrations were increased, the ratio of phosphate transfer to hydrolysis was also increased, demonstrating the presence of a transphosphorylation reaction where an acceptor can compete with water in the rate limiting step involving hydrolysis of a covalent phospho enzyme intermediate. Partition experiments carried out with two substrates, para-nitrophenyl phosphate and phenyl phosphate, revealed a constant product ratio of 1.7 for phosphotransfer to ethylene glycol versus hydrolysis, strongly supporting the existence of common covalent phospho enzyme intermediate. A constant ratio of K (cat)/K (m), 4.3 x 10(4), found at different ethylene glycol concentrations, also supported the idea that the rate limiting step was the hydrolysis of the phospho enzyme intermediate.

4-Nitrophenylphosphatase↗

PubMed1984

Isoelectrophoretic separation and the detection of soluble proteins containing acid-labile phosphate: use of the phosphoenolpyruvate:sugar phosphotransferase system as a model system for N1-P-histidine- and N3-P-histidine-containing proteins.

Procedures have been developed for the detection of acid-labile phosphorylations of proteins. The phosphoproteins were separated by native isoelectric focusing while maintaining the gel at about 0 degree C, and denaturing urea-Nonidet isoelectric focusing gels were adapted to run at -10 degrees C. The proteins of the bacterial phosphoenolpyruvate:sugar phosphotransferase system (PTS), HPr, which contains 1-P-histidine, and factor IIIglc and enzyme I, which contain 3-P-histidine when they are phosphorylated, were used to develop the conditions. Autoradiography of [32P]-labeled phosphoproteins was carried out on frozen gels which had not been acid fixed in order to avoid hydrolysis of the phosphohistidines . The frozen gels were subsequently fixed and stained, and reautoradiography revealed whether the phosphoproteins were acid stable or labile. In addition to the known proteins of the PTS, at least one other protein whose phosphorylation was dependent on enzyme I and HPr was found in Salmonella typhimurium and Escherichia coli [E.B. Waygood , and R.L. Mattoo (1983) Canad . J. Biochem. Cell Biol. 61, 150-153]. Initial experiments with rat tissues have demonstrated acid-labile phosphorylations in proteins which were either [gamma-32P]ATP or [32P]phosphoenolpyruvate dependent. The interconversion of phosphoenolpyruvate and ATP in crude extracts of bacterial cells was examined, and appropriate controls were found. Protein phosphorylation dependent upon phosphoenolpyruvate was much greater in S. typhimurium and E. coli than the corresponding ATP-dependent phosphorylation, while the opposite was found for rat tissues.

Adenosine Triphosphate↗

PubMed1985

Quantitative in situ gel electrophoretic assay for neomycin phosphotransferase activity in mammalian cell lysates.

A method for the assay of neomycin phosphotransferase activity in eucaryotic cell lysates is described. Total cytoplasmic proteins are fractionated in nondenaturing polyacrylamide gels and then allowed to react in situ with [gamma-32P]ATP and kanamycin. The reaction products are detected by blotting to phosphocellulose paper and autoradiography. The assay is linear with protein concentration and sensitive enough to detect expression in transient assays.

Adenosine Triphosphate↗