SEARCH · PubMed Health

Results for “SOS Response, Genetics”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 505 records · Page 28Linked to original sources

PubMed1998

Transcriptional regulation of the Prevotella ruminicola recA gene.

The regulation of the recA gene expression in the obligately anaerobic rumen bacterium Prevotella ruminicola was investigated by monitoring the recA-specific transcript level. P. ruminicola recA forms a monocistronic unit, but no SOS-box sequences resembling those of Escherichia coli or Bacillus subtilis can be identified upstream of the recA coding region. At the same time, we observed a fivefold increase in the level of recA mRNA in response to DNA damaging agents, mitomycin C and methyl methanesulfonate, as well as under conditions of oxidative stress. No induction was detected when growth of P. ruminicola was arrested by shifting to acidic (pH 4.8) conditions. Primer extension experiment revealed the three very close transcriptional start sites for recA. The putative -10 and -35 RNA polymerase binding regions were proposed on the basis of transcript mapping. These regions bear very little similarity to the E. coli (sigma70) and B. subtilis (sigmaA) consensus sequences, as well as to the recognition sites of other minor sigma-factors. Transcript mapping experiments in E. coli expressing P. ruminicola recA confirmed that the transcription machineries of these two bacteria recognize completely different regulatory sequences on the template to initiate transcription. Preliminary DNase I footprinting analysis data revealed that the region of imperfect dyad symmetry (AATTATAATCAATTATAAAT) found between the putative -10 region and the translation initiation codon may serve as an SOS-box-like regulatory sequence in P. ruminicola. This sequence bears no similarity to the known SOS-box sequences and, in particular, to that of E. coli and other Gram-negative bacteria.

Animals↗

PubMed2005

Immobilization as a technical possibility for long-term storage of bacterial biosensors.

For applications in field experiments, the recombinant strain Salmonella typhimurium TA1535 was immobilized to permit its immediate utilization after long storage periods. Salmonella typhimurium TA1535 cells contain the plasmid that has an inducible SOS promoter fused to a promoterless luxCDABFE operon from Photobacterium leiognathi. The induction of bioluminescence occurs in the presence of the DNA-damaging agent mitomycin C which stimulates the bacterial SOS response. Early stationary phase cells were immobilized at a cell concentration of 10(10) CFU/ml in microtiter plates and stored up to 6 weeks at 4 degrees C in a sealed container. Even after 4 weeks of storage, the bioluminescence kinetics and yield in response to different concentrations of mitomycin C were not significantly different from those of freshly prepared samples.

Biosensing Techniques↗

PubMed1997

Functional dissection of a cell-division inhibitor, SulA, of Escherichia coli and its negative regulation by Lon.

SulA is induced in Escherichia coli by the SOS response and inhibits cell division through interaction with FtsZ. To determine which region of SulA is essential for the inhibition of cell division, we constructed a series of N-terminal and C-terminal deletions of SulA and a series of alanine substitution mutants. Arginine at position 62, leucine at 67, tryptophan at 77 and lysine at 87, in the central region of SulA, were all essential for the inhibitory activity. Residues 3-27 and the C-terminal 21 residues were dispensable for the activity. The mutant protein lacking N-terminal residues 3-47 was inactive, as was that lacking the C-terminal 34 residues. C-terminal deletions of 8 and 21 residues increased the growth-inhibiting activity in lon+ cells, but not in lon- cells. The wild-type and mutant SulA proteins were isolated in a form fused to E. coli maltose-binding protein, and tested in vitro for sensitivity to Lon protease. Lon degraded wild-type SulA and a deletion mutant lacking the N-terminal 93 amino acids, but did not degrade the derivative lacking 21 residues at the C-terminus. Furthermore, the wild-type SulA and the N-terminal deletion mutant formed a stable complex with Lon, while the C-terminal deletion did not. MBP fused to the C-terminal 20 residues of SulA formed a stable complex with, but was not degraded by Lon. When LacZ protein was fused at its C-terminus to 8 or 20 amin acid residues from the C-terminal region of SulA the protein was stable in lon+ cells. These results indicate that the C-terminal 20 residues of SulA permit recognition by, and complex formation with, Lon, and are necessary, but not sufficient, for degradation by Lon.

ATP-Binding Cassette Transporters↗

PubMed1999

The SOS response is induced by replication fork blockage at a Ter site located on a pUC-derived plasmid: dependence on the distance between ori and Ter sites.

A new model system for the study of the SOS response has been developed. In this system the response is induced by blocking the replication fork at a Ter site located in pUC-derived plasmids. Blockage of the fork is dependent on the expression of the Ter binding protein, Tus, encoded on another plasmid, in which the tus gene is under the control of the ara promoter. SOS induction can, therefore, be controlled by arabinose. The extent of the SOS response was monitored by measuring the activity of beta-galactosidase, expressed from a lacZ gene fused to the 5' region of the sfiA gene, a typical SOS-responsive gene. Expression of the fusion gene is completely dependent on recA+ and lexA+ genes. Using this system, we found that the distance between the ori and Ter sites is directly correlated with the strength of SOS induction. The properties of this system are discussed.

Bacterial Proteins↗

PubMed2004

Transcriptional analysis of dynamic heat-shock response by the hyperthermophilic bacterium Thermotoga maritima.

The thermal stress response of the hyperthermophilic bacterium Thermotoga maritima was characterized using a 407-open reading frame-targeted cDNA microarray. Transient gene expression was followed for 90 min, following a shift from 80 degrees C to 90 degrees C. While some aspects of mesophilic heat-shock response were conserved in T. maritima, genome content suggested differentiating features that were borne out by transcriptional analysis. Early induction of predicted heat-shock operons hrcA-grpE-dnaJ (TM0851-TM0850-TM0849), groES-groEL (TM0505-TM0506), and dnaK-sHSP (TM0373-TM0374) was consistent with conserved CIRCE elements upstream of hrcA and groES. Induction of the T. maritima rpoE/ sigW and rpoD/ sigA homologs suggests a mechanism for global heat-shock response in the absence of an identifiable ortholog to a major heat-shock sigma factor. In contrast to heat-shock response in Escherichia coli, the majority of genes encoding ATP-dependent proteases were downregulated, including clpP (TM0695), clpQ (TM0521), clpY (TM0522), lonA (TM1633), and lonB (TM1869). Notably, T. maritima showed indications of a late heat-shock response with the induction of a marR homolog (TM0816), several other putative transcriptional regulators (TM1023, TM1069), and two alpha-glucosidases (TM0434 and TM1068). Taken together, the results reported here indicate that, while T. maritima shares core elements of the bacterial heat-shock response with mesophiles, the thermal stress regulatory strategies of this organism differ significantly. However, it remains to be elucidated whether these differences are related to thermophilicity or phylogenetic placement.

Base Sequence↗

PubMed1991

Genotoxicity of 1,3-dichloro-2-propanol in the SOS chromotest and in the Ames test. Elucidation of the genotoxic mechanism.

1,3-Dichloro-2-propanol (1,3-DCP-OH, glycerol dichlorohydrin) is of great importance in many industrial processes and has been detected in foodstuffs, in particular in soup spices and instant soups. It has been shown to be carcinogenic, genotoxic and mutagenic. Its genotoxic mechanisms are, however, not yet entirely understood. We have investigated whether alcohol dehydrogenase (ADH) catalysed activation to the highly mutagenic and carcinogenic 1,3-dichloroacetone or formation of epichlorohydrin or other genotoxic compounds play a role for mutagenicity and genotoxicity. In our studies, no indications of ADH catalysed formation of 1,3-dichloropropane could be found, although we could demonstrate a clear activation by ADH in the case of 2-chloropropenol. Formation of allyl chloride could also be excluded. We found, however, clear evidence that epichlorohydrin formed chemically in the buffer and medium used in the test is responsible for genotoxicity. No indication was found that enzymatic formation of epichlorohydrin plays a role. Additional mutagenicity and genotoxicity studies with epichlorohydrin also confirmed the hypothesis that genotoxic effects of 1,3-DCP-OH depend on the chemical formation of epichlorohydrin.

Alcohol Dehydrogenase↗

PubMed1988

A mutant LexA repressor harboring a cleavage motif cysteine-glycine remains inducible.

Using site-directed mutagenesis of the lexA gene we have changed the amino acid Ala-84 of the LexA repressor for a cysteine. The reason for this change was the striking homology between LexA and UmuD and the comparable size of the two amino acid side chains. Using an in vivo repression/induction assay it is shown that the LexA-Cys-84 mutant remains inducible by mitomycin C and UV irradiation essentially in the same way as the wild-type repressor.

Bacterial Proteins↗

PubMed1994

Phosphorylation of Escherichia coli proteins during the SOS response.

1. The phosphorylation of Escherichia coli proteins was analyzed comparatively before and after induction of the SOS response in a temperature-sensitive mutant strain. 2. The presence of phosphorylated proteins was evidenced by gel electrophoresis and autoradiography after labelling with radioactive orthophosphate in vivo or radioactive adenosine triphosphate in vitro. 3. Significant changes in the intensity of protein labelling were observed upon induction of the SOS functions: six proteins were found to be more phosphorylated while two others were less phosphorylated. Moreover, five additional proteins appeared to become phosphorylated exclusively during the SOS response. The molecular mass and isoelectric point of these various proteins were determined. 4. For most proteins, the changes in the pattern of protein phosphorylation were concomitant with variations in the amount of protein synthesized. 5. The changes in the pattern of phosphoproteins observed during the SOS response were not due to the temperature shift required experimentally for expressing the SOS phenotype. 6. Phosphorylation was found to be catalyzed by protein kinases that modify amino acid residues at hydroxyl groups in protein substrates. 7. Both in vivo and in vitro studies brought evidence that neither RecA nor LexA, the two key regulatory proteins of the SOS functions, were capable of undergoing phosphorylation.

Bacterial Proteins↗

PubMed1987

RecA protein and SOS. Correlation of mutagenesis phenotype with binding of mutant RecA proteins to duplex DNA and LexA cleavage.

The RecA protein of Escherichia coli is required for SOS-induced mutagenesis in addition to its recombinational and regulatory roles. We have suggested that RecA might participate directly in targeted mutagenesis by binding preferentially to the site of the DNA damage (e.g. pyrimidine dimer) because of its partially unwound nature; DNA polymerase III will then encounter RecA-coated DNA at the lesion and might replicate across the damaged site more often but with reduced fidelity. In support of this proposal, we have found that the phenotype of wild-type and mutant RecA for mutagenesis correlates with capacity to bind to double-stranded DNA. Wild-type RecA binds more efficiently to ultraviolet (u.v.)-irradiated, duplex DNA than to non-irradiated DNA. The RecA441 (Tif) protein that is constitutive for mutagenesis binds extremely well to double-stranded DNA with no lesions, whereas the RecA430 protein that is defective in mutagenesis binds poorly even to u.v.-irradiated DNA. The RecA phenotype also correlates with capacity to use duplex DNA as a cofactor for cleavage of the LexA repressor protein for SOS-controlled operons. Wild-type RecA provides efficient cleavage of LexA only with u.v.-irradiated duplex DNA; RecA441 cleaves well with non-irradiated DNA; RecA430 gives very poor cleavage even with u.v.-irradiated DNA. We conclude that the interaction of RecA with damaged double-stranded DNA is likely to be a critical component of SOS mutagenesis and to define a pathway for the LexA cleavage reaction as well.

Bacterial Proteins↗

PubMed1987

Differential repression of SOS genes by unstable lexA41 (tsl-1) protein causes a "split-phenotype" in Escherichia coli K-12.

The lexA41 (formerly tsl-1) mutant was isolated as an ultraviolet light-resistant, temperature-sensitive derivative of its ultraviolet light-sensitive lexA3(Ind-) parent. Cells exhibit a so-called "split-phenotype", a phenomenon in which only a subset of the SOS responses can be detected physiologically following inducing treatments. lexA41 has been cloned and sequenced; the mutant gene retains the lexA3 mutation (Gly to Asp at position 85) and has a second mutation, lexA41 (Ala to Thr at position 131). We show that LexA41 protein is not cleaved by the RecA protein-catalyzed pathway in vivo, but the mutant protein is degraded by the Lon protease at both 32 degrees C and 42 degrees C. beta-Galactosidase activities of lac fusions to 13 different SOS promoters were measured at 30 degrees C and 42 degrees C to determine levels of expression and were found to vary considerably. The temperature-sensitive phenotype is a result of increased expression of sulA, which encodes a division inhibitor, at 42 degrees C. Excision repair genes, including uvrA, uvrB and uvrD, are constitutively expressed at 30 degrees C accounting for the ultraviolet light resistance of the lexA41 mutant, but the SOS mutagenesis operon, umuD,C, is not adequately derepressed, thereby explaining the failure to induce mutagenesis in this background. This differential expression of SOS genes gives a plausible explanation of the split-phenotype associated with lexA41.

Bacterial Proteins↗

PubMed1990

Nature of the SOS-inducing signal in Escherichia coli. The involvement of DNA replication.

The SOS genes of Escherichia coli, which include many DNA repair genes, are induced by DNA damage. Although the central biochemical event in induction, activation of RecA protein through binding of single-stranded DNA and ATP to promote cleavage of the LexA repressor, is known, the cellular event that provides this activation following DNA damage has not been well understood. We provide evidence here that the major pathway of induction after damage by a typical agent, ultraviolet light, requires an active replication fork; this result supports the model that DNA replication leaves gaps where elongation stops at damage-induced lesions, and thus provides the single-stranded DNA that activates RecA protein. In order to detect quantitatively the immediate product of the inducing signal, activated RecA protein, we have designed an assay to measure the rate of disappearance of intact LexA repressor. With this assay, we have studied the early phase of the induction process. LexA cleavage is detectable within minutes after DNA damage and occurs in the absence of protein synthesis. By following the reaccumulation of LexA in the cell, we detect repair of DNA and the disappearance of the inducing signal. Using this assay, we have measured the LexA content of wild-type and various mutant cells, characterized the kinetics and conditions for development of the inducing signal after various inducing treatments and, finally, have shown the requirement for DNA replication in SOS induction by ultraviolet light.

Bacterial Proteins↗

PubMed1987

Induction of the SOS system in a dam-3 mutant: a diagnostic strain for chemicals causing DNA mismatches.

We have developed a strain of E. coli in which expression of the SOS function sfiA, monitored by means of a sfiA::lacZ operon fusion, is efficiently triggered by the two base analogues 2-aminopurine and 5-bromo-2'-deoxyuridine. This strain resulted from introduction of a dam-3 mutation into a Uvr+, Rfa+ derivative of strain PQ37 used in the SOS chromotest, a bacterial colorimetric assay for genotoxins (Quillardet et al., 1982). The dam-3 mutation affects the mismatch correction system in E. coli. We show that the SOS-inducing capacity of a weak SOS inducer such as the alkylating agent ethyl methanesulfonate was also increased in the dam-3 strain. We provide evidence that the increase in SOS inducibility due to the dam-3 mutation is specific for compounds causing DNA mismatches and propose the use of the dam-3 derivative of PQ37 as a diagnostic strain for such agents. This diagnostic strain can be a useful addition to the SOS chromotest.

2-Aminopurine↗

PubMed1987

Enhanced reactivation of ultraviolet-irradiated human cytomegalovirus in normal host cells.

Enhanced survival of UV-irradiated human cytomegalovirus (HCMV) is demonstrated in normal human cells exposed to UV light prior to infection. The UV fluence that gave rise to maximum UV reactivation falls in the range of 15 J/m2. A large number of temperature-sensitive HCMV mutants were found under the peak of reactivation. These results confirm the existence of inducible SOS functions in human cells.

Cell Line↗

PubMed1987

recA-dependent and recA-independent N-ethyl-N-nitrosourea mutagenesis at a plasmid-encoded herpes simplex virus thymidine kinase gene in Escherichia coli.

We have compared isogenic recA13/recA+ Escherichia coli K-12 strains for the induction by N-ethyl-N-nitrosourea (ENU) of forward mutations at a plasmid-encoded herpes simplex virus type 1 thymidine kinase (HSV-tk) gene. Treatment of plasmid-bearing bacteria with ENU resulted in a dose-dependent increase in the mutant frequencies of the chromosomal udk locus and of the plasmid HSV-tk locus in both recA13 and recA+ strains. Although the recA13 strain was considerably more sensitive to the cytotoxic effects of ENU treatment than was the recA+ strain, the ENU-induced mutation frequency at both loci was greater for the recA+ strain than for the recA13 strain. When plasmid DNA modified by in vitro reaction with ENU was used to transform recA13, recA+, and UV pre-irradiated recA+ strains, an increase in the HSV-tk mutant frequency was observed in all 3 cases. The induction of mutations in recA13 and recA+ strains followed a similar dose-response, while the ENU-induced HSV-tk mutant frequency was significantly greater for UV pre-irradiated recA+ bacteria. These results indicate that fixation of ENU-induced premutagenic lesions can occur by both recA-dependent and recA-independent pathways.

DNA Repair↗

PubMed1988

Induction of the SOS function sfiA in E. coli by systems which generate triplet ketones.

Generation of triplet ketones, either chemically through thermal decomposition of 3-hydroxymethyl-3,4,4-trimethyl-1,2-dioxetane and 3-[N-(pyridino)carbamoyl]methyl-3,4,4-trimethyl-1,2-dioxetane++ + or enzymatically via the aerobic oxidation of isobutyraldehyde trimethylsilyl enol ether catalyzed by horse-radish peroxidase, triggers the SOS function sfiA in E. coli. Although the observed effects are relatively weak and the triplet ketone scavenger tryptophan was ineffective in this system, our results provide evidence for the involvement of triplet ketones in this type of DNA damage. Possible mechanisms are discussed.

Antioxidants↗

PubMed1988

Structural requirement for the induction of the adaptive response in Escherichia coli among N-(substituted alkyl)-N-nitrosoureas.

Using E. coli CSH26 transformed with a plasmid carrying an alkA'-lacZ' fused gene, a series of N-(substituted alkyl)-N-nitrosoureas were subjected to a colorimetric assay to evaluate their capacity to induce the adaptive response, an inducible DNA-repair network in E. coli. Some of these derivatives induced the response in greater or lesser degrees, while others did not. Several structural requirements for the induction were disclosed. The capacity of these derivatives to induce the SOS response, which is another inducible DNA-repair network, was also evaluated using E. coli transformed with a plasmid carrying a umuC'-lacZ' fused gene. Since all the derivatives induced the SOS response, the structural requirements for the adaptive response disclosed in this study are substantially related to the molecular mechanism involved in the adaptive response.

Alkylating Agents↗

PubMed1988

Effects of SOS and MucAB functions on reactivation and mutagenesis of M13 replicative form DNA bearing bulky lesions.

We have previously determined the specificity of -1 frameshifts induced by aflatoxin-B1-2,3-dichloride (AFB1C12) in phage M13 double-strand replicative form (RF) DNA. The system consists of: (i) in vitro adduction of RF DNA of BK8, a lacZ + 1 frameshift derivative of phage M13mp8; (ii) transfection into unirradiated or UV-irradiated bacterial host cells; (iii) scoring and sequencing of revertants (i.e., -1 frameshifts). The previous data had shown that induction of SOS functions enhanced mutagenesis. However, this increase in mutagenesis is not accompanied by enhanced survival in a majority of the strains tested. Here, we present evidence to show that the lack of SOS reactivation is a specific property of the RF DNA system rather than a specific property of the lesion. A model mechanism based on the replicative strategy of transfected RF DNA can account for these observations. In addition, we have calculated individual Weigle mutagenesis factors at 8 major mutagen induced sites reported previously. Analysis of these data indicates that, within a restricted subset of possible mutational events (i.e., -1 frameshifts), Weigle mutagenesis is affected by both the DNA sequence environment of the mutation site as well as the repair phenotype of the cell.

Aflatoxin B1↗

PubMed1988

Evidence for a specific regulation of recA gene transcription in Escherichia coli.

The kinetics of the recA, sfiA and umuDC genes transcription were studied during a double SOS-inducing treatment in Escherichia coli cells using several strains carrying lacZ gene fusions. A transient inhibition in recA, but not in sfiA or umuDC promoted beta-galactosidase synthesis was detected after successive UV-irradiations. Results obtained with a recA--lacZ fusion introduced in several DNA-repair mutants demonstrated that neither a lower LexA inactivation nor a decrease in the production of the inducing signal are the events through which the successive UV-irradiation promoted the arrest of recA transcription. On the contrary, a specific UV-dose-dependent delay appears to be the reason for the inhibition of the recA gene transcription in cells irradiated twice.

Adenosine Triphosphate↗