SEARCH · PubMed Health

Results for “genomic tandem array”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 505 records · Page 28Linked to original sources

PubMed2005

Integrating gene and protein expression data: pattern analysis and profile mining.

Proteomics and functional genomics are emerging new research fields devoted to the study of the entire collection of proteins and mRNA transcripts (collectively known as gene products) that define a biological system. DNA microarrays are now a popular platform for measuring changes in messenger RNA transcript levels on a genome-wide scale, while gel-free shotgun profiling methods based on tandem mass spectrometry are increasingly being used to determine the identity, modification states, and relative abundance of large numbers of proteins. By defining the behavior of entire biological pathways and networks under various physiological states, these studies aim to extend traditional reductionist molecular genetic approaches regarding the biological roles of the vast array of uncharacterized gene products. A key goal is to determine how the information encoded by the myriad of expressed gene products is integrated at the molecular, cellular, and even whole organism level to create the dynamic biochemical processes and complex physiological controls that sustain life. While comparison of the complementary information contained in proteomic and mRNA data sets poses considerable analytical challenges, these efforts should provide added insight into the fundamental mechanisms underlying physiology, development, and the emergence of disease. Here, we outline several analytical approaches, methods, and tools that have proven to be helpful in the face of this important challenge.

Algorithms↗

PubMed2000

A polymorphic multigene family encoding an immunodominant protein from Babesia microti.

Human babesiosis in the United States is caused predominantly by Babesia microti, a tick-transmitted blood parasite. Improved testing methods for the detection of infection with this parasite are needed, since asymptomatic B. microti infection represents a potential threat to the blood supply in areas where B. microti is endemic. We performed immunoscreening of an expression library of genomic DNA from a human isolate of B. microti (strain MN1). Among 17 unique immunoreactive clones, we identified 9 which represent a related family of genes with little sequence homology to other known sequences but with an architecture resembling that of several surface proteins of Plasmodium. Within this family, a tandem array of a degenerate six-amino-acid repeat (SEAGGP, SEAGWP, SGTGWP, SGTVGP) was found in various lengths between relatively well conserved segments at the N and C termini. In order to examine within-clone variation, we developed a PCR protocol for direct recovery of a specific bmn1-6 homologue directly from 30 human blood isolates, 4 corresponding hamster isolates, and 5 geographically corresponding Peromyscus leucopus (white-footed mouse) isolates. Isolates from the hamsters had the same sequences as those found in the corresponding human blood, suggesting that genetic variation of bmn1-6 does not occur during passage. However, clones from different patients were often substantially different from each other with regard to the number and location of the degenerate repeats within the bmn1-6 homologue. Moreover, we found that strains that were closely related geographically were also closely related at the sequence level; nine patients, all from Nantucket Island, Mass., harbored clones that were indistinguishable from each other but that were distinct from those found in other northeastern or upper midwestern strains. We conclude that considerable genetic and antigenic diversity exists among isolates of B. microti from the United States and that geographic clustering of subtypes may exist. The nature of the bmn1-6 gene family suggests a mechanism of antigenic variation in B. microti that may occur by recombination, differential expression, or a combination of both mechanisms.

Amino Acid Sequence↗

PubMed1984

Integration and expression of several molecular forms of Rous sarcoma virus DNA used for transfection of mouse cells.

To assess the factors required for integration and expression of retroviral DNA, we have examined viral DNA, RNA, and protein in NIH/3T3 mouse cells transformed by transfection with various forms of cloned Rous sarcoma virus (RSV) DNA. Linear RSV DNA molecules, derived from circular DNA containing two long terminal repeats (LTRs) and permuted by cleavage at the SacI restriction endonuclease site in the leader sequence, were integrated near the ends of the linear molecule, with the LTRs on the 3' side of the src gene. Integration of a subgenomic RSV DNA fragment containing the viral src gene without intact LTRs also occurred near the ends of the linear molecule. Head-to-tail tandem arrays of RSV DNA species were observed in some transformed cell lines that received fully digested DNA and in all cell lines that received DNA ligated to produce oligomers before transfection. Closed circular RSV DNA, with one or two LTRs, integrated without apparent specificity within several regions of the viral genome. After transfection with SacI-permuted RSV DNA still linked to arms of the lambda bacteriophage vector DNA, bacteriophage sequences were joined to host DNA. Transformed cell lines produced by transfection with the various forms of RSV DNA produced similar levels of viral src protein, although the efficiency of successful transformation varied by at least two orders of magnitude. Analyses of viral polyadenylated RNA, together with the patterns of viral DNA in transformed cells, indicated that viral DNA can be integrated and expressed without regard to LTR sequences, with adjacent host DNA presumably supplying signals required for the promotion and processing of functional src mRNA.

Animals↗

PubMed1998

Chromosome-specific molecular organization of maize (Zea mays L.) centromeric regions.

A set of oat-maize chromosome addition lines with individual maize (Zea mays L.) chromosomes present in plants with a complete oat (Avena sativa L.) chromosome complement provides a unique opportunity to analyze the organization of centromeric regions of each maize chromosome. A DNA sequence, MCS1a, described previously as a maize centromere-associated sequence, was used as a probe to isolate cosmid clones from a genomic library made of DNA purified from a maize chromosome 9 addition line. Analysis of six cosmid clones containing centromeric DNA segments revealed a complex organization. The MCS1a sequence was found to comprise a portion of the long terminal repeats of a retrotransposon-like repeated element, termed CentA. Two of the six cosmid clones contained regions composed of a newly identified family of tandem repeats, termed CentC. Copies of CentA and tandem arrays of CentC are interspersed with other repetitive elements, including the previously identified maize retroelements Huck and Prem2. Fluorescence in situ hybridization revealed that CentC and CentA elements are limited to the centromeric region of each maize chromosome. The retroelements Huck and Prem2 are dispersed along all maize chromosomes, although Huck elements are present in an increased concentration around centromeric regions. Significant variation in the size of the blocks of CentC and in the copy number of CentA elements, as well as restriction fragment length variations were detected within the centromeric region of each maize chromosome studied. The different proportions and arrangements of these elements and likely others provide each centromeric region with a unique overall structure.

Base Sequence↗

PubMed1987

The neurogenic gene Delta of Drosophila melanogaster is expressed in neurogenic territories and encodes a putative transmembrane protein with EGF-like repeats.

The decision of an ectodermal cell to take on a neural or an epidermal fate depends on its interactions with the neighbouring cells. In Drosophila melanogaster, the available evidence suggests that a regulatory signal necessary for epidermal commitment is built by the products of the so-called neurogenic genes. We have cloned 180 kb of genomic DNA surrounding the neurogenic gene Delta (Dl). Restriction fragment-length polymorphisms were mapped to a region of 25 kb. These 25 kb of DNA are assumed to contain essential parts, or all, of the Dl gene. Northern blots detect two developmentally regulated transcripts, of 5.4 and 4.6 kb, which are associated with the region where the mutants map. Serveral cDNA clones were recovered from embryonic cDNA libraries by homology to the 25 kb of genomic DNA. The complete sequence of a cDNA clone containing an insert of 4.73 kb was determined. The conceptual translation of the longest open reading frame yields a protein of 880 amino acids. This protein displays characteristics of a membrane protein, with intercellular, transmembrane and extracellular domains. The extracellular domain contains a tandem array of nine EGF-like repeats. In in situ hybridizations to tissue sections, transcripts homologous to Dl are detected in all territories with neurogenic abilities, e.g. the neurogenic ectoderm and the primordia of the sensory organs. Initially all cells of these neurogenic territories express Dl, but later on transcription of Dl becomes restricted to the cells that have adopted the neural fate. The topological specificity in the transcription of Dl corresponds to the one expected for a regulatory signal that mediates epidermal commitment.

Journal Article↗

PubMedDate not supplied

Two-pore domain potassium channels: new sites of local anesthetic action and toxicity.

Potassium (K+) channels form the largest family of ion channels with more than 70 such genes identified in the human genome. They are organized in 3 superfamilies according to their predicted membrane topology: (1) subunits with 6 membrane-spanning segments and 1-pore domain, (2) subunits with 2 membrane-spanning segments and 1-pore domain, and (3) subunits with 4 membrane-spanning segments and 2-pore domains arrayed in a tandem position. The last family has most recently been identified and comprises the so-called 2-pore domain potassium (K2P) channels, believed responsible for background or leak K+ currents. Despite their recent discovery, interest in them is growing rapidly with more than 270 references in the literature reported (www.ipmc.cnrs.fr/~duprat/2p/ref2p.htm#2P, accessed October 30, 2004). K2P channels are widely expressed in the central nervous system and are involved in the control of the resting membrane potential and the firing pattern of excitable cells. This article will therefore review recent findings on actions of local anesthetics with respect to 2P channels. It begins with an overview of the role of background K+ channels in neuronal excitability and nerve conduction and is followed by a description of the K2P channel family including experimental evidence for the contribution of K2P channels to the mechanism of action and toxicity of local anesthetics.

Anesthetics, Local↗

PubMed1998

Evolution of satellite DNAs from the genus Palorus--experimental evidence for the "library" hypothesis.

Satellite DNA profiles have been characterized in the congeneric species Palorus ratzeburgii, Palorus subdepressus, Palorus genalis, and Palorus ficicola (Coleoptera, Insecta), each of which contains a single, A + T-rich satellite DNA comprising a considerable portion of the genome (20%-40%). These satellites exhibit insignificant mutual sequence similarity. Using PCR assay, it has been shown that all four sequences are present in each of the tested Palorus species: one of them is amplified into a high copy number or a major satellite, while the three others are in the form of low-copy-number repeats estimated to make up approximately 0.05% of the genome. Each of the four satellites is interspecifically high conserved concerning the sequence, monomer length, and tandem repeat organization. Major, as well as low-copy-number, satellites are colocalized in the regions of pericentromeric heterochromatin on all chromosomes of the complement. The low-copy-number satellites are dispersed between the large arrays of the major satellite over the whole heterochromatic block. Our results explain satellite DNA evolution, confirming the hypothesis that related species share a "library" of conserved satellite sequences, some of which could be amplified into a major satellite. Due to the evolutionary dynamics of satellite DNAs, the content of the "library" is variable; the elimination of some sequences parallels the creation of the new ones. Quantitative changes in satellite DNAs, induced by occasional amplification of satellite repeat from the "library", could possibly occur in the course of the speciation process, thus forming a species-specific profile of satellite DNAs.

Animals↗

PubMed2003

Coexpression of neighboring genes in Caenorhabditis elegans is mostly due to operons and duplicate genes.

In many eukaryotic species, gene order is not random. In humans, flies, and yeast, there is clustering of coexpressed genes that cannot be explained as a trivial consequence of tandem duplication. In the worm genome this is taken a step further with many genes being organized into operons. Here we analyze the relationship between gene location and expression in Caenorhabditis elegans and find evidence for at least three different processes resulting in local expression similarity. Not surprisingly, the strongest effect comes from genes organized in operons. However, coexpression within operons is not perfect, and is influenced by some distance-dependent regulation. Beyond operons, there is a relationship between physical distance, expression similarity, and sequence similarity, acting over several megabases. This is consistent with a model of tandem duplicate genes diverging over time in sequence and expression pattern, while moving apart owing to chromosomal rearrangements. However, at a very local level, nonduplicate genes on opposite strands (hence not in operons) show similar expression patterns. This suggests that such genes may share regulatory elements or be regulated at the level of chromatin structure. The central importance of tandem duplicate genes in these patterns renders the worm genome different from both yeast and human.

Animals↗

PubMed1998

Genomic organization of six tomato polygalacturonases and 5' upstream sequence identity with tap1 and win2 genes.

Recently, three polygalacturonase (PG) cDNAs (TAPG1, TAPG2, and TAPG4) were identified in a library prepared from tomato (Lycopersicon esculentum cv. Rutgers) leaf abscission zones. Genomic clones encoding these three cDNAs have been identified. Moreover, the genomic clones include three additional PG genes, TPG3, TAPG5 and TPG6, which have not been previously reported. A transcript for TAPG5 was detected in the RNA from leaf and flower abscission zones; however, transcripts for TPG3 and TPG6 were not. DNA sequence analysis revealed that TAPG1, TAPG2, and TPG3 are linked in a close tandem array. TAPG4, TAPG5 and TPG6 are also closely linked to each other but in divergent and inverted orientations and are not closely linked to TAPG1, TAPG2, or TPG3. TAPG4, TAPG5 and TPG6 map to the middle of chromosome 12. TPG6 contains two introns. The other five PG genes include four exons and three introns. The relative positions of introns 1 and 2 are shared by all six PG genes. The position of intron 3 is conserved in the other five. The structure of the tomato fruit PG gene, which contains 8 introns, is compared with that of the six PG genes described above. Of interest is an approximately 300 bp inverted repeat found in TAPG1, TAPG2 and TAPG4 that shares significant sequence identity with sequence in the first intron of the tomato anionic peroxidase gene, tap1. RNA blot analysis indicates that the transcript for an anionic peroxidase increases during abscission. In addition, a 250 bp sequence found in TPG3 shares high sequence identity with a 5' upstream region in a wound-induced win2 gene from potato. Potential sites of transcriptional regulation in these genes are discussed.

Base Sequence↗

PubMed1986

Genomic and structural organization of Drosophila melanogaster G elements.

The properties and the genomic organization of G elements, a moderately repeated DNA family of D. melanogaster, are reported. G elements lack terminal repeats, generate target site duplications at the point of insertion and exhibit at one end a stretch of A residues of variable length. In a large number of recombinant clones analyzed G elements occur in tandem arrays, interspersed with specific ribosomal DNA (rDNA) segments. This arrangement results from the insertion of members of the G family within the nontranscribed spacer (NTS) of rDNA units. Similarity of the site of integration of G elements to that of ribosomal DNA insertions suggests that distinct DNA sequences might have been inserted into rDNA through a partly common pathway.

Animals↗

PubMed1999

Human minisatellites, repeat DNA instability and meiotic recombination.

Minisatellites include some of the most variable loci in the human genome and are superb for dissecting processes of tandem repeat DNA instability. Single DNA molecule analysis has revealed different mutation processes operating in the soma and germline. Low-level somatic instability results in simple intra-allelic rearrangements. In contrast, high frequency germline instability involves complex gene conversions and is therefore recombinational in nature, almost certainly occurring at meiosis. To determine whether true meiotic crossovers occur at human minisatellites, we have used polymorphisms near the repeat array to recover recombinant DNA molecules directly from sperm DNA. Analysis of minisatellite MS32 has revealed an intense and highly localised meiotic crossover hotspot centred upstream of the array, the first example of a human hotspot defined at the molecular level. This hotspot extends into the beginning of the repeat array, resulting in unequal and equal crossovers. Array crossovers occur much less frequently than array conversions but appear to arise by a common process, most likely by alternative processing of a recombination initiation complex. The location of MS32 at the boundary of a recombination hotspot suggests that this locus has evolved as a by-product of localised meiotic recombination activity, and that minisatellites might in general mark recombinationally proficient hotspots or hot domains in the genome. Finally, sperm crossover analysis makes it possible to explore the molecular rules that govern human meiotic recombination, and to detect phenomena such as meiotic drive that could provide a possible connection between recombination and DNA sequence diversity itself.

DNA↗

PubMed2025

Haplotype-resolved telomere-to-telomere genome assembly of Populus lasiocarpa unveils retrotransposon-driven centromere evolution.

Centromeres, essential for chromosome segregation, exhibit remarkable evolutionary dynamism in sequence composition and structural organization. Here, we report the first haplotype-resolved, telomere-to-telomere genome assembly of Populus lasiocarpa (PLAS) and precisely map all 38 functional centromeres through CENH3 ChIP-Seq. Unlike classical satellite-rich centromeres in model plants, PLAS centromeres lack abundant satellite arrays but are dominated by retrotransposons, particularly RLG and RIL elements, which form intricate nested TE arrays within the functional centromeric regions, disrupting their structural integrity and driving their evolution. Comparative analysis with P. trichocarpa reveals a conserved retrotransposon-dominated architecture, despite minimal sequence conservation. We propose a cyclic model of centromere evolution in which autonomous retrotransposons destabilize functional centromeres through epigenetic erosion, triggering neocentromere formation at pericentromeric sites enriched in transposable elements (TEs) and tandem repeats (TRs). These neocentromeres either succumb to recurrent retrotransposon invasions or stabilize through KARMA-mediated TR expansion, ultimately giving rise to satellite-rich centromeres. Our work redefines centromeres as dynamic, epigenetically plastic domains shaped by retrotransposon-TR antagonism, challenging the satellite-centric paradigm and offering novel insights into plant genome evolution.

Retroelements↗

PubMed2000

Repetitive A-T rich DNA sequences from the Y chromosome of the Mediterranean fruit fly, Ceratitis capitata.

Copies of a repetitive DNA sequence distributed over 90% of the length of the long arm of the Y chromosome of the Mediterranean fruit fly, Ceratitis capitata (medfly), have been characterized. Sequencing reveals that these repeats, ranging in size from approximately 1.3 to 1.7 kb, are A-T rich overall (67%). In most cases the repeat units appear to occur in tandemly linked arrays. The repeat copies also all contain a highly similar internal region, approximately 200 bp in length, with a more extreme A-T content bias. This internal region, designated as the AT element, exhibits an A-T content of at least 83%. This exceeds what has been described for any comparable element among invertebrates. Using primers designed from the DNA sequence, PCR amplification of an internal region encompassing the AT element also reveals that these sequences are present only in the male genome in different strains of the medfly.

AT Rich Sequence↗

PubMedDate not supplied

A minisatellite with fold-back structure is included in the 5'-flanking region of the Adh gene of Scaptodrosophila lebanonensis.

A tandem repetitive sequence with a repeat unit of 12 bp has been found 1.3 kb upstream of the Adh gene of Scaptodrosophila lebanonensis. This repetitive sequence extends over 4.3 kb and consists of two inverted arrays (a fold-back segment). The repeated unit with a consensus sequence GAATACAGAATA is highly conserved and the nucleotide substitutions are not distributed randomly among the 12 bp. In situ hybridization in S. lebanonensis polytene chromosomes revealed two signals, one at the 60A section, the Adh locus, and a second site in the same chromosome at the 60C section close to the telomere. This same pattern of hybridization is obtained in all the analyzed strains including the subspecies S. lebanonensis casteeli. The minisatellite sequence accounts for about 0.03-0.04% of the S. lebanonensis genome and showed intraspecific variability in tandem repeat numbers. Possible functions of this sequence are discussed.

5' Flanking Region↗

PubMed1988

Mitotic recombination in the rDNA of S. cerevisiae is suppressed by the combined action of DNA topoisomerases I and II.

We have found that mitotic recombination within the S. cerevisiae rDNA cluster (200 tandemly repeated 9.1 kb units) is strongly suppressed and that this suppression requires the combined action of DNA topoisomerases I and II. Strains with a null mutation in the TOP1 gene (encoding topoisomerase I) or a ts mutation in the TOP2 gene (encoding topoisomerase II) grown at a semipermissive temperature show 50- to 200-fold higher frequencies of mitotic recombination in rDNA relative to TOP+ controls. Suppression of recombination is specific to the rDNA because the recombination frequency at another tandem array, the CUP1 locus, at a simple HIS4 duplication, or among dispersed repeats (MAT and HML or HMR) is not elevated in top1 or top2 mutants. The high frequency of mitotic recombination within the rDNA cluster in topoisomerase mutants shows that both TOP1 and TOP2 are required for suppression of recombination in this region of the genome.

Blotting, Southern↗

PubMed1992

Structure of the pericentric long arm region of the human Y chromosome.

We have analysed the sequence organization of the DNA in the pericentric region of the long arm of the human Y chromosome. The structures of one cosmid and three yeast artificial chromosome clones were determined. The region consists of a mosaic of the known 5, 48 and 68 base-pair tandemly repeated sequences and at least five novel repeated sequence families. A long range-map of approximately 3.5 x 10(6) base-pairs of genomic DNA was constructed that placed the clones between about 500 x 10(3) and 850 x 10(3) base-pairs from the long arm edge of the centromeric alphoid DNA array.

Animals↗

PubMed1978

The nucleotide sequence of oocyte 5S DNA in Xenopus laevis. I. The AT-rich spacer.

The primary sequence of the principal spacer region in X. laevis oocyte 5S DNA has been determined. The spacer is AT-rich and comprises half or more of each repeating unit. The sequence is internally repetitious; most of it can be represented by the following set of oligonucleotides: CAACAGTTTTCAAAAGGTTTCGAAGTTTTT(T). The spacer, which varies in length from about 360 to 570 or more nucleotides, can be subdivided into a region (A2) which is variable in length in different repeating units, flanked by regions (A1, A3, B1) which are relatively constant in length. The A2 region consists, on the average, of 5-6 tandem copies of the oligonucleotide CAAAGTTTGAGTTTT; variation in the redundancy of this oligonucleotide accounts for much of the repeat length variation in the genomic 5S DNA. Most copies of this oligonucleotide are identical, although several differing by 1 or 2 nucleotides have been detected in plasmid-cloned 5S DNA fragments. Regions A1 and A3 comprise a linear array of similar, but not identical, oligonucleotides; most repeating units contain very similar A1 and A3 sequences. Region B1 is a sequence of 49 nucleotides immediately adjacent to the 5' terminus of the 5S rRNA sequence. It is GC-rich, much less repetitive than the remainder of the spacer and contains several palindromes, but no regions of dyad symmetry. This sequence is identical in all six of the single cloned repeating units of 5S DNA analyzed.

Adenine↗

PubMed1988

A subfamily of alphoid repetitive DNA shared by the NOR-bearing human chromosomes 14 and 22.

The nucleotide sequence of members of an alpha-repeat subfamily shared by human chromosomes 14 and 22 is presented. This subfamily is organized into a higher-order repeat unit composed of a tandem repetition of an ordered array of four related but distinct 340-bp repeat dimers. An analogous situation has been described for a related but distinct subfamily shared by chromosomes 13 and 21. These two subfamilies were further shown not to be present on the homologous chimpanzee chromosomes and therefore must have arisen by rearrangement of the human genome after separation of the two species. The sequence homology between the 13/21 and the 14/22 subfamilies is about 85%. The 14/22 subfamily represents the only major alphoid DNA species on these two chromosomes and is not present elsewhere in the human genome. Fluorescent in situ hybridizations show that sequences from the 13/21 and 14/22 subfamilies can be used as specific markers for their respective chromosomes.

Animals↗