SEARCH · PubMed Health

Results for “rRNA structure”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 505 records · Page 28Linked to original sources

PubMed2000

The spacing between functional Cis-elements of U3 snoRNA is critical for rRNA processing.

The sequences and structural features of Xenopus laevis U3 small nucleolar RNA (snoRNA) necessary for pre-rRNA cleavage at sites 1 and 2 to form 18 S rRNA were assayed by depletion/rescue experiments in Xenopus oocytes. Mutagenesis results demonstrated that the putative stem of U3 domain I is unnecessary for 18 S rRNA processing. A model consistent with earlier experimental data is proposed for the structure of domain I when U3 is not yet bound to pre-rRNA. For its function in rRNA processing, a newly discovered element (5' hinge) was revealed to be important but not as critical as the 3' hinge region in Xenopus U3 snoRNA for 18 S rRNA formation. Base-pairing is proposed to occur between the U3 5' hinge and 3' hinge and complementary regions in the external transcribed spacer (ETS); these interactions are phylogenetically conserved, and are homologous to those previously described in yeast (5' hinge-ETS) and trypanosomes (3' hinge-ETS). A model is presented where the base-pairing of the 5' hinge and 3' hinge of U3 snoRNA with the ETS of pre-rRNA helps to correctly position U3 boxes A'+A for their function in rRNA processing. Like an earlier proposal for yeast, boxes A' and A of Xenopus may base-pair with 18 S sequences in pre-rRNA. We present the first direct experimental evidence in any system that box A' is essential for U3 snoRNA function in 18 S rRNA formation. The analysis of insertions and deletions indicated that the spacing between the U3 elements is important, suggesting that they base-pair with the ETS and 18 S regions of pre-rRNA at the same time.

Animals↗

PubMed1997

The RNA binding domain of ribosomal protein L11: three-dimensional structure of the RNA-bound form of the protein and its interaction with 23 S rRNA.

The three-dimensional solution structure has been determined by NMR spectroscopy of the 75 residue C-terminal domain of ribosomal protein L11 (L11-C76) in its RNA-bound state. L11-C76 recognizes and binds tightly to a highly conserved 58 nucleotide domain of 23 S ribosomal RNA, whose secondary structure consists of three helical stems and a central junction loop. The NMR data reveal that the conserved structural core of the protein, which consists of a bundle of three alpha-helices and a two-stranded parallel beta-sheet four residues in length, is nearly the same as the solution structure determined for the non-liganded form of the protein. There are however, substantial chemical shift perturbations which accompany RNA binding, the largest of which map onto an extended loop which bridges the C-terminal end of alpha-helix 1 and the first strand of parallel beta-sheet. Substantial shift perturbations are also observed in the N-terminal end of alpha-helix 1, the intervening loop that bridges helices 2 and 3, and alpha-helix 3. The four contact regions identified by the shift perturbation data also displayed protein-RNA NOEs, as identified by isotope-filtered three-dimensional NOE spectroscopy. The shift perturbation and NOE data not only implicate helix 3 as playing an important role in RNA binding, but also indicate that regions flanking helix 3 are involved as well. Loop 1 is of particular interest as it was found to be flexible and disordered for L11-C76 free in solution, but not in the RNA-bound form of the protein, where it appears rigid and adopts a specific conformation as a result of its direct contact to RNA.

Amino Acid Sequence↗

PubMed1990

Organization of the 5S rRNA genes in the soybean Glycine max (L.) Merrill and conservation of the 5S rDNA repeat structure in higher plants.

The 5S rRNA gene of the soybean Glycine max (L.) Merr. has been cloned on a 556-bp fragment of DNA and sequenced. This fragment contains two copies of the soybean 5S rDNA sequence, one intact and one truncated, separated by noncoding DNA. We have used this clone to investigate the organization of the 5S genes within the soybean genome and the extent of their methylation. Our results demonstrate that soybean 5S genes are clustered, organized into tandem repeats of 330 bp, and extensively methylated. Hybridization of the 5S sequence to Southern transfers of soybean DNA digested with BamHI reveals a striking ladderlike pattern. Hybridization of the soybean 5S sequence to a wide variety of plant DNAs results in similar patterns, suggesting that the 5S rDNA sequence, gene organization, and methylation pattern are conserved in many higher plants.

Base Sequence↗

PubMed1998

A common motif organizes the structure of multi-helix loops in 16 S and 23 S ribosomal RNAs.

Phylogenetic and chemical probing data indicate that a modular RNA motif, common to loop E of eucaryotic 5 S ribosomal RNA (rRNA) and the alpha-sarcin/ricin loop of 23 S rRNA, organizes the structure of multi-helix loops in 16 S and 23 S ribosomal RNAs. The motif occurs in the 3' domain of 16 S rRNA at positions 1345-1350/1372-1376 (Escherichia coli numbering), within the three-way junction loop, which binds ribosomal protein S7, and which contains nucleotides that help to form the binding site for P-site tRNA in the ribosome. The motif also helps to structure a three-way junction within domain I of 23 S, which contains many universally conserved bases and which lies close in the primary and secondary structure to the binding site of r-protein L24. Several other highly conserved hairpin, internal, and multi-helix loops in 16 S and 23 S rRNA contain the motif, including the core junction loop of 23 S and helix 27 in the core of 16 S rRNA. Sequence conservation and range of variation in bacteria, archaea, and eucaryotes as well as chemical probing and cross-linking data, provide support for the recurrent and autonomous existence of the motif in ribosomal RNAs. Besides its presence in the hairpin ribozyme, the loop E motif is also apparent in helix P10 of bacterial RNase P, in domain P7 of one sub-group of group I introns, and in domain 3 of one subgroup of group II introns.

Catalysis↗

PubMed2006

The mitochondrial genome of the entomophagous endoparasite Xenos vesparum (Insecta: Strepsiptera).

In this study, the nearly complete sequence (14,519 bp) of the mitochondrial DNA (mtDNA) of the entomophagous endoparasite Xenos vesparum (Insecta: Strepsiptera) is described. All protein coding genes (PCGs) are in the arrangement known to be ancestral for insects, but three tRNA genes (trnA, trnS(gcu), and trnL(uag)) have transposed to derived positions and there are three tandem copies of trnH, each of which is potentially functional. All of these rearrangements except for that of trnL(uag) is within the short span between nad3 and nad4 and there are numerous blocks of unassignable sequence in this region, perhaps as remnants of larger scale predisposing rearrangements. X. vesparum mtDNA nucleotide composition is strongly biased toward A and T, as is typical for insect mtDNAs. There is also a significant strand skew in the distribution of these nucleotides, with the J-strand being richer in A than T and in C than G, and the N-strand showing an opposite skew for complementary pairs of nucleotides. The hypothetical secondary structure of the LSU rRNA has also been reconstructed, obtaining a structural model similar to that of other insects.

Animals↗

PubMed1979

Nucleotide sequences of chloroplast 5S ribosomal ribonucleic acid in flowering plants.

Evidence for the sequence of duckweed (Lemna minor) chloroplast 5S rRNA was derived from the analysis of partial and complete enzymic digests of the 32P-labelled molecule. The possible sequence of the chloroplast 5S rRNA from three other flowering plants was deduced by complete digestion with T1 ribonuclease and comparison of the sequences of the oligonucleotide products with homologous sequences in the duckweed 5S rRNA. This analysis indicates that the chloroplast 5S rNA species differ appreciably from their cytosol counterparts but bear a strong resemblance to one another and to the 5S rRNA species of prokaryotes. Structural features apparently common to all 5S rRNA molecules are also discussed.

Autoradiography↗

PubMed1997

Ribosomal protein S15 from Thermus thermophilus--cloning, sequencing, overexpression of the gene and RNA-binding properties of the protein.

A 6-kb DNA fragment from an extreme thermophile, Thermus thermophilus, carrying the genes for cytochrome oxidase ba3 subunit I (cbaA) and the ribosomal protein S15 (rpsO) was cloned into Escherichia coli. The gene rpsO was sequenced. The deduced amino acid sequence exhibits 59% identity to the corresponding protein from E. coli. Expression of rpsO in E. coli requires the use of a fully repressed inducible promoter because S15 from T. thermophilus is toxic for E. coli cells. When purified without denaturation from either overproducing E. coli strain or from T. thermophilus ribosomes, the S15 protein is stable and binds a cloned T. thermophilus 16S rRNA fragment (nucleotides 559-753), with low identical dissociation constants (2.5 nM), thus demonstrating that the thermophilic protein folds correctly in a mesophilic bacterium. The rRNA fragment bound corresponds in position and structure to the 16S rRNA fragment of E. coli. A similar high affinity was also found for the binding of S15 from T. thermophilus or E. coli to the corresponding E. coli 16S rRNA fragment, whereas a slightly lower affinity was observed in binding experiments between E. coli S15 and T. thermophilus 16S rRNA fragment. These results suggest that S15 from T. thermophilus recognizes similar determinants in both rRNA fragments. Competition experiments support this conclusion.

Amino Acid Sequence↗

PubMed2000

Dhr1p, a putative DEAH-box RNA helicase, is associated with the box C+D snoRNP U3.

Putative RNA helicases are involved in most aspects of gene expression. All previously characterized members of the DEAH-box family of putative RNA helicases are involved in pre-mRNA splicing. Here we report the analysis of two novel DEAH-box RNA helicases, Dhr1p and Dhr2p, that were found to be predominantly nucleolar. Both genes are essential for viability, and MET-regulated alleles were therefore created. Depletion of Dhr1p or Dhr2p had no detectable effect on pre-mRNA splicing in vivo or in vitro. Both Dhr1p and Dhr2p were, however, required for 18S rRNA synthesis. Depletion of Dhr2p inhibited pre-rRNA cleavage at sites A(0), A(1), and A(2), while Dhr1p depletion inhibited cleavage at sites A(1) and A(2). No coprecipitation of snoRNAs was detected with ProtA-Dhr2p, but Dhr1p-ProtA was stably associated with the U3 snoRNA. Depletion of Dhr1p inhibited processing steps that require base pairing of U3 to the 5' end of the 18S rRNA. We speculate that Dhr1p is targeted to the preribosomal particles by the U3-18S rRNA interaction and is required for the structural reorganization of the rRNA during formation of the central pseudoknot.

Base Sequence↗

PubMed1984

Paramecium mitochondrial genes. II. Large subunit rRNA gene sequence and microevolution.

Mature Paramecium mitochondrial large subunit rRNA consists of two stable segments: a 20 S segment described previously and a unique 283-base segment similar to 5.8 S rRNAs typically found in eucaryotic cytoplasmic RNA. pBR325 clones of both gene regions from both Paramecium primaurelia and Paramecium tetraurelia were sequenced and aligned. The gene segments lie adjacent to each other very near the replicative terminal end of the linear Paramecium mitochondrial genome and are transcribed from a common 23 S precursor. The precise gene ends were determined using nuclease S1 protection; the large subunit rRNA gene complex (consisting of "5.8 S-like" rRNA, a 19-26-base excised region, and 20 S rRNA) spans about 2654 base pairs. The gene complex is preceded by a 15-base poly(T) tract and terminates randomly within a 20-base A + T-rich segment immediately preceding the tRNATyr gene. The sequences from the two species were 4% divergent, the changes consisting of 59% transitions, 38% transversions, and 3% insertions or deletions. The sequences were aligned with Escherichia coli 23 S rRNA, and a secondary structure model is presented for the entire molecule based on structures proposed for E. coli 23 S rRNA.

Animals↗

PubMed1980

The 3'-terminal sequence of the small subunit ribosomal RNA from hamster mitochondria.

The 220 3'-terminal nucleotides of the small ribosomal subunit RNA (13S) of hamster (BHK-21) cell mitochondria have been sequenced and the positions of post-transcriptionally methylated residues within this sequence have been established. Also, we have derived the secondary structure of the 3'-terminus of mitochondrial 13S rRNA by 1) searching nucleotide sequences of 13S rRNA, procaryotic 16S rRNA and eucaryotic 18S rRNA for common secondary structures and 2) using single-strand specific endonucleases to map secondary interactions in 13S rRNA. The pyrimidine tract CCUCC in E. coli 16S rRNA, which participates in base-pairing with bacterial mRNA, is absent in mitochondrial 13S rRNA. We believe that the binding of mRNA to mammalian mitochondrial ribosomes is not mediated by a conventional Shine-Dalgarno interaction.

Animals↗

PubMed2001

Ribosomal protein L5 has a highly twisted concave surface and flexible arms responsible for rRNA binding.

Ribosomal protein L5 is a 5S rRNA binding protein in the large subunit and plays an essential role in the promotion of a particular conformation of 5S rRNA. The crystal structure of the ribosomal protein L5 from Bacillus stearothermophilus has been determined at 1.8 A resolution. The molecule consists of a five-stranded antiparallel beta-sheet and four alpha-helices, which fold in a way that is topologically similar to the ribonucleoprotein (RNP) domain. The molecular shape and electrostatic representation suggest that the concave surface and loop regions are involved in 5S rRNA binding. To identify amino acid residues responsible for 5S rRNA binding, we made use of Ala-scanning mutagenesis of evolutionarily conserved amino acids occurring in the beta-strands and loop regions. The mutations of Asn37 at the beta1-strand and Gln63 at the loop between helix 2 and beta3-strand as well as that of Phe77 at the tip of the loop structure between the beta2- and beta3-strands caused a significant reduction in 5S rRNA binding. In addition, the mutations of Thr90 on the beta3-strand and Ile141 and Asp144 at the loop between beta4- and beta5-strands moderately reduced the 5S rRNA-binding affinity. Comparison of these results with the more recently analyzed structure of the 50S subunit from Haloarcula marismortui suggests that there are significant differences in the structure at N- and C-terminal regions and probably in the 5S rRNA binding.

Amino Acid Sequence↗

PubMed1993

The rRNA-encoding DNA array has an altered structure in topoisomerase I mutants of Saccharomyces cerevisiae.

All the chromosomes from isogenic TOP1 and top1 strains have similar mobility on pulsed-field gels except for chromosome XII, which fails to migrate into the gels in top1 mutants. Chromosome XII contains the tandem repeats of rRNA-encoding DNA (rDNA). When a segment of chromosome XII containing only rDNA is transferred to chromosome III by a recombination event, chromosome III fails to enter a pulsed-field gel in extracts from top1 strains, indicating that the aberrant migration of chromosome XII in top1 mutants is caused by the presence of rDNA. Failure of chromosome XII to migrate into a pulsed-field gel occurs only in preparations from exponentially growing top1 cultures and not in preparations from stationary-phase top1 cultures. rDNA from a top1 strain does enter the gel if it is cut with an enzyme (Pst I) that cuts the tandem rDNA array into single 9-kb repeat units, indicating that more than a single repeat unit is required to maintain the aberrant structure.

Amino Acid Sequence↗

PubMed2007

Both sulfate-reducing bacteria and Enterobacteriaceae take part in marine biocorrosion of carbon steel.

AIMS: In order to evaluate the part played in biocorrosion by microbial groups other than sulfate-reducing bacteria (SRB), we characterized the phylogenetic diversity of a corrosive marine biofilm attached to a harbour pile structure as well as to carbon steel surfaces (coupons) immersed in seawater for increasing time periods (1 and 8 months). We thus experimentally checked corroding abilities of defined species mixtures. METHODS AND RESULTS: Microbial community analysis was performed using both traditional cultivation techniques and polymerase chain reaction cloning-sequencing of 16S rRNA genes. Community structure of biofilms developing with time on immersed coupons tended to reach after 8 months, a steady state similar to the one observed on a harbour pile structure. Phylogenetic affiliations of isolates and cloned 16S rRNA genes (rrs) indicated that native biofilms (developing after 1-month immersion) were mainly colonized by gamma-proteobacteria. Among these, Vibrio species were detected in majority with molecular methods while cultivation techniques revealed dominance of Enterobacteriaceae such as Citrobacter, Klebsiella and Proteus species. Conversely, in mature biofilms (8-month immersion and pile structure), SRB, and to a lesser extent, spirochaetes were dominant. CONCLUSIONS: Corroding activity detection assays confirmed that Enterobacteriaceae (members of the gamma-proteobacteria) were involved in biocorrosion of metallic material in marine conditions. SIGNIFICANCE AND IMPACT OF THE STUDY: In marine biofilms, metal corrosion may be initiated by Enterobacteriaceae.

Base Sequence↗

PubMed1991

Sequence organization and RNA structural motifs directing the mouse primary rRNA-processing event.

The first processing step in the maturation of mouse precursor rRNA involves cleavage at nucleotide ca. +650, at the 5' border of a 200-nucleotide region that is conserved across mammals and contains the sequences that direct the processing. To identify the relevant sequence elements, we used rRNAs with small internal mutations and short pre-rRNA substrates. Much of the region can be mutated without appreciable effect, but nucleotides +655 to +666 appear to be absolutely required and short segments surrounding +750 and +810 markedly stimulate processing. The minimal processing signal corresponds to rRNA nucleotides +645 to +672. Formation of a ribonucleoprotein complex of retarded electrophoretic mobility is evidently necessary but not sufficient for processing. Computer-assisted analysis suggested a phylogenetic- and mutant-supported secondary structure in which the minimal processing signal forms a stem with the +655 region in the loop, and there is a separate branched duplex containing the downstream stimulatory sequences. Use of antisense RNA, in trans and in cis, to sequester the +655 region in a duplex supported the hypothesis that this critical region was needed in a single-stranded conformation for processing and for specific complex formation.

Animals↗

PubMed2006

Mitochondrial 12S rRNA A827G mutation is involved in the genetic susceptibility to aminoglycoside ototoxicity.

We have analyzed the clinical and molecular characterization of a Chinese family with aminoglycoside-induced and non-syndromic hearing impairment. Clinical evaluations revealed that only those family members who had a history of exposure to aminoglycoside antibiotics subsequently developed hearing loss, suggesting mitochondrial genome involvement. Sequence analysis of the mitochondrial 12S rRNA and tRNA(Ser(UCN)) genes led to the identification of a homoplasmic A827G mutation in all maternal relatives, a mutation that was identified previously in a few sporadic patients and in another Chinese family with non-syndromic deafness. The pathogenicity of the A827G mutation is strongly supported by the occurrence of the same mutation in two independent families and several genetically unrelated subjects. The A827G mutation is located at the A-site of the mitochondrial 12S rRNA gene which is highly conserved in mammals. It is possible that the alteration of the tertiary or quaternary structure of this rRNA by the A827G mutation may lead to mitochondrial dysfunction, thereby playing a role in the pathogenesis of hearing loss and aminoglycoside hypersensitivity. However, incomplete penetrance of hearing impairment indicates that the A827G mutation itself is not sufficient to produce clinical phenotype but requires the involvement of modifier factors for the phenotypic expression. Indeed, aminoglycosides may contribute to the phenotypic manifestation of the A827G mutation in this family. In contrast with the congenital or early-onset hearing impairment in another Chinese family carrying the A827G mutation, three patients in this pedigree developed hearing loss only after use of aminoglycosides. This discrepancy likely reflects the difference of genetic backgrounds, either mitochondrial haplotypes or nuclear modifier genes, between two families.

Aminoglycosides↗

PubMed1999

Sequence specificity of in vivo reverse splicing of the Tetrahymena group I intron.

Reverse splicing of group I introns is proposed to be a mechanism by which intron sequences are transferred to new genes. Integration of the Tetrahymena intron into the Escherichia coli 23S rRNA via reverse splicing depends on base pairing between the guide sequence of the intron and the target site. To investigate the substrate specificity of reverse splicing, the wild-type and 18 mutant introns with different guide sequences were expressed in E. coli. Amplification of intron-rRNA junctions by RT-PCR revealed partial reverse splicing at 69 sites and complete integration at one novel site in the 23S rRNA. Reverse splicing was not observed at some potential target sites, whereas other regions of the 23S rRNA were more reactive than expected. The results indicate that the frequency of reverse splicing is modulated by the structure of the rRNA. The intron is spliced 10-fold less efficiently in E. coli from a novel integration site (U2074) in domain V of the 23S rRNA than from a site homologous to the natural splice junction of the Tetrahymena 26S rRNA, suggesting that the forward reaction is less favored at this site.

Animals↗

PubMed2001

Sequence analysis and structure prediction of aminoglycoside-resistance 16S rRNA:m7G methyltransferases.

Methylation of G1405 within bacterial 16S ribosomal RNA results in high-level resistance to specific combinations of aminoglycoside antibiotics. Only a few closely related methyltransferases (MTases), which carry out the respective modification (here dubbed "Agr", for aminoglycoside resistance), are known. It is not clear, whether they are related to "typical" S-adenosylmethionine (AdoMet)-dependent MTases or not. Demydchuk et al., 1998 proposed that the cofactor-binding region is localized at the C-terminus of Agr MTases, which implies an interesting case of sequence permutation. Since the Agr MTases lack significant sequence similarity to other proteins, we tested that hypothesis using more sensitive sequence/structure threading approach. Structure prediction confirmed the presence of a putative AdoMet-binding site in these proteins, albeit at a distinct location, resembling that of "typical", non-permuted MTases. Additionally, a small alpha-helical domain dissimilar to other proteins in the database was identified in the N-terminal region of Agr MTases. Comparison of a three-dimensional model of the Agr family member with a recently solved structure of reovirus mRNA capping MTase suggests that the mechanism of guanine-N7 methylation in rRNA and mRNA may be different.

Actinomycetales↗

PubMed1992

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

Amino Acid Sequence↗