PubMed HealthSearch

SEARCH · PubMed Health

Results for “Boxing”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3Linked to original sources

Effects of acute administration of the 5-HT3 receptor antagonist, BRL 46470A, on the behaviour of mice in a two compartment light-dark box and during social interactions in their home cage and an unfamiliar neutral cage.

Adult male CD1 mice received the 5-HT3 receptor antagonist, BRL 46470A, by intraperitoneal injection at three dose levels (2.5 mg/kg, 25 and 2.5 micrograms/kg). Controls were injected with physiological saline. At 30 min after injection, the behaviour of each mouse was examined by ethological procedures, when encountering an untreated partner for 5 min in its home cage and for 5 min in the more aversive situation of an unfamiliar neutral cage. The behaviour of each mouse also was monitored for 5 min in a two compartment light-dark box. At all doses tested, BRL 46470A increased the time spent in the light compartment of the light-dark box. At the smallest dose (2.5 micrograms/kg), the number of transitions between light and dark compartments was increased and there also was an increase (per unit time) in the numbers of squares crossed and number of scans in the light compartment. At all doses tested, BRL 46470A increased social investigation and reduced non-social exploratory activity in both the home cage and the unfamiliar neutral cage. In both test situations, increase of social investigation was maximum at 25 micrograms/kg, and at this dose, aggressive behaviour was also enhanced. In the neutral cage, digging in the sawdust by drug-treated mice showed a progressive dose-related increase. These results indicate potent anxiolytic-like activity by BRL 46470A and also demonstrate increased reactivity to unfamiliar environmental stimuli, such as novel sawdust. The significance of these findings is discussed.

Animals

[Manipulation box to measure the motor performance involving the distal musculature of the arm in primates (author's transl)].

For studies of motor performance in the baboon, regarding precise finger movements, a new latch-box was developed. The device was designed so as to involve mainly the distal musculature of the arm. Handling the different knobs or latches which open the compartments of the box had to be performed in a given motor sequence. Monkeys were trained to use two fingers of the hand: thumb and index. Data are presented which show that, after exclusion of a central nervous structure, it is possible to differentiate the performance obtained with the device described above that obtained in a pointing task, mainly involving the proximal musculature.

Animals

Selective deprivation of paradoxical sleep and consolidation of shuttle-box avoidance.

Investigated whether paradoxical sleep is implicated in the storage of information acquired during shuttle-box avoidance. Wistar rats were given 5 brief training sessions distributed over the light period of the diurnal cycle. During the intervals between sessions the animals were selectively deprived of paradoxical sleep by awakening them every time they showed this type of sleep. The onset of paradoxical sleep was identified when hippocampal theta rhythm occurred during behavioural sleep. Yoked control animals got the same treatment irrespective of their sleep-waking behaviour, whereas free sleep rats were allowed to sleep undisturbed. In spite of large differences in the amount of paradoxical sleep during the intersession intervals no differences in learning performances were found among the groups. A tendency toward more intertrial crossings was noted in the paradoxical sleep deprived group at the end of training. It is concluded that storage of information acquired during distributed shuttle-box avoidance is not dependent on the presence of paradoxical sleep immediately following learning. Some possibilities are considered that paradoxical sleep may still be involved in memory storage processes.

Animals

Tissue-specific transcription of the rat tyrosine hydroxylase gene requires synergy between an AP-1 motif and an overlapping E box-containing dyad.

Transcription of tyrosine hydroxylase (TH), the rate-limiting enzyme in catecholamine biosynthesis, is regulated in a tissue-specific manner. We have identified sequences from -205 to -182 as the minimal enhancer for TH in pheochromocytoma cells using site-directed mutagenesis. This segment (TGATTCAGAGGCAGGTGCCTGTGA) is composed of an AP-1 motif (TGATTCA) and an overlapping 20 bp dyad whose core resembles an E box site (CANNTG). Interaction between the two elements is necessary both in vivo and in vitro: mutation of either element caused a 65%-95% reduction in transcription, and the combination of the two elements conferred cell-specific activation on a heterologous promoter; separation of the two elements by an additional helical turn not only disrupted a DNA-protein complex unique to the two elements, but also abolished expression in vivo. Therefore, we conclude that the interaction between the AP-1 and the E box dyad motifs is responsible for cell-specific TH expression.

Adrenal Gland Neoplasms

Genomic diversity, antimicrobial resistance, and virulence-associated characteristics of Escherichia coli recovered from poultry hatchery-box material.

Hatcheries are early points of exposure of newly hatched chicks to Escherichia coli from eggshell debris, dust, meconium, and the hatchery environment. This study used descriptive genomic surveillance to characterize population structure, antimicrobial resistance, virulence-associated genes, plasmid replicons, and genetic relatedness in a purposively selected collection of E. coli recovered from hatchery-box material in a Czech commercial poultry hatchery. From 83 samples collected between 2019 and 2023, 409 isolates were recovered. Following within-sample reduction based on antimicrobial susceptibility profiles and PCR screening for selected APEC-associated virulence genes, 91 isolates enriched for cefotaxime-medium recovery or APEC-associated gene profiles were selected for Illumina whole-genome sequencing. The sequenced collection comprised 35 sequence types across nine phylogenetic groups or clades; phylogroup B1 (59/91) and ST162 (28/91) predominated. ColV-associated markers were detected in 88 isolates, acquired resistance genes in 61, and a multidrug-resistant phenotype in 31. Seventeen isolates were resistant to ceftazidime; eight carried ESBL or plasmid-mediated AmpC determinants, while eight additional isolates had the chromosomal ampC promoter substitution C-42T as the only identified determinant associated with this phenotype. Closely related isolates, including ST131, ST162, and ST675, were recovered from different samples or parent-farm groups within restricted sampling periods. These findings document genomically diverse, resistance- and virulence-associated E. coli in hatchery-box material and identify genetically related isolates that warrant investigation through structured longitudinal sampling. Because sampling was unequal and isolates were purposively selected, the findings do not provide prevalence estimates or demonstrate source, transmission, persistence, or pathogenicity.

APEC-associated virulence genes

Insulin-producing cells contain a cell-specific repressor activity that functions through multiple E-box sequences.

The cis-acting DNA element known as the E box (consensus sequence CAxxTG) plays an important role in the transcription of a number of cell-specifically expressed genes. The rat insulin I gene, for example, contains two such sequences (IEB1 and IEB2) that are recognized specifically by a characteristic beta cell nuclear factor insulin enhancer factor 1 (IEF1). To define the role of these elements better, we tested for cooperative interactions between the IEB sequences. Transfection experiments were performed with a series of plasmids containing the elements separated by different distances. Transcriptional activity in vivo is only modestly affected (less than two-fold) when the distances between the IEB elements are changed by a half-integral number of double-helical turns. Surprisingly, plasmids bearing four and six copies of the IEB motif showed sharply reduced activity as compared to those with two copies. In vitro DNA-binding studies revealed that this effect was not due to inability of IEF1 to bind to multiple copies of IEB. Moreover, multiple copies of the IEB sequence were able to inhibit activity of a cis-linked Moloney sarcoma virus (MSV) or insulin enhancer upon transfection to beta cells but not to other cell types. The above data are consistent with the view that beta cells contain a cell-specific repressor molecule capable of binding to multiple copies of IEB and thereby inhibiting transcription. This interpretation was further strengthened by in vivo competition and trans-activation experiments. The beta-cell-specific repressor activity identified by these studies may play an important role in mediating gene expression in insulin-producing cells, perhaps by regulating the access of helix-loop-helix transcription factors to E-box sequence elements.

3T3 Cells

The LIM domain-containing homeo box gene Xlim-1 is expressed specifically in the organizer region of Xenopus gastrula embryos.

A novel cysteine-rich motif, named LIM, has been identified in the homeo box genes lin-11, Isl-1, and mec-3; the mec-3 and lin-11 genes determine cell lineages in Caenorhabditis elegans. We isolated LIM class homeo box genes from Xenopus laevis that are closely related to lin-11 and mec-3 in the LIM and homeo domains. This paper deals with one of these genes, Xlim-1. Xlim-1 mRNA is found at low abundance in the unfertilized egg, has a major expression phase at the gastrula stage, decreases, and rises again during the tadpole stage. In adult tissues the brain shows the highest abundance, by far, of Xlim-1 mRNA. The maternal and late expression phases of the Xlim-1 gene suggest that it has multiple functions at different stages of the Xenopus life cycle. In the gastrula embryo, Xlim-1 mRNA is localized in the dorsal lip and the dorsal mesoderm, that is, in the region of Spemann's organizer. Explant experiments showed that Xlim-1 mRNA is induced by the mesoderm-inducer activin A and by retinoic acid, which is not a mesoderm inducer but affects patterning during Xenopus embryogenesis; application of activin A and retinoic acid together results in synergistic induction. The structure, inducibility, and localized expression in the organizer of the Xlim-1 gene suggest that it has a role in establishing body pattern during gastrulation.

Activins

Subtype determination of Drosophila embryonic external sensory organs by redundant homeo box genes BarH1 and BarH2.

BarH1 and BarH2 are two closely related homeo box genes that form a small complex at the Bar locus on the X chromosome of Drosophila. By immunostaining, we showed that BarH1 and BarH2 proteins are coexpressed in cells belonging to the central and peripheral nervous systems in embryos. In external sensory (es) organs, their expression was particularly apparent in thecogens (glial cells) and neurons at late development. Although deletion of BarH2 caused no appreciable morphological change in es organs, the simultaneous deletion of BarH1 and BarH2 led to a homeotic change in these organs with consequent conversion from campaniform-like sensilla to trichoid sensilla. In contrast, the overexpression of either BarH1 or BarH2 resulted in opposite morphological change. It would thus follow that BarH1 and BarH2 are a pair of redundant homeo box genes required for the subtype specification of es organs.

Animals

A maize protein associated with the G-box binding complex has homology to brain regulatory proteins.

The G-box element is a moderately conserved component of the promoter of many inducible genes, including the alcohol dehydrogenase genes of Arabidopsis and maize. We used monoclonal antibodies generated against partially purified G-box binding factor (GBF) activity to characterize maize proteins that are part of the DNA binding complex. Antibodies interacted with partially purified maize GBF complexes to produce a slower migrating complex in the gel retardation assay. Immunoprecipitation experiments suggested that the protein recognized by the antibody is not a DNA binding protein in and of itself, but rather is associated with the DNA binding complex. These monoclonal antibodies were used to isolate cDNA clones encoding a protein that we have designated GF14. Maize GF14 contains a region resembling a leucine zipper and acidic carboxy and amino termini, of which the latter can form an amphipathic alpha-helix similar to known transcriptional activators such as VP16 and GAL4. Protein gel blot analysis of cell culture extract showed that a single, major protein of approximately 30 kD is recognized by anti-GF14; the protein is also present predominantly in the kernel and root. The deduced amino acid sequence of maize GF14 is more than 80% identical to Arabidopsis GF14 and Oenothera PHP-O, and is more than 60% identical to a class of mammalian brain proteins described as both protein kinase C inhibitors and activators of tyrosine and tryptophan hydroxylases. GF14 is found in a variety of monocotyledons and dicotyledons, gymnosperms, and yeast. This suggests a deep evolutionary conservation of a potential regulatory protein associated with a core sequence found in the promoter region of many genes.

14-3-3 Proteins

A tobacco DNA binding protein that interacts with a light-responsive box II element.

Ribulose-1,5-bisphosphate carboxylase/oxygenase plays a key role in photosynthetic carbon fixation in higher plants. The small subunit of this chloroplast enzyme (rbcS), encoded by a family of nuclear genes, is regulated at the transcriptional level by light. Promoter analyses have previously identified the box II sequence as a cis element critical for the light-regulated expression of rbcS genes. Nuclear factor GT-1 binds specifically to this element and is one of the plant nuclear factors that has been detected and studied in great detail. Here we describe the cloning and characterization of a tobacco cDNA encoding a protein, designated B2F (Box II Factor), with similar binding specificity and mobility in gel retardation assays as nuclear GT-1. Steady state levels of mRNA encoding B2F do not appear to be regulated by light; this is consistent with the previous observation that nuclear GT-1 activity is present in extracts from both light-grown and dark-adapted plants. Sequence comparison with another plant trans-acting factor, GT-2, which binds to a GT-like element in the rice phytochrome promoter, shows striking homology in three putative alpha-helices that may be involved in DNA binding.

Amino Acid Sequence

An innovative course in undergraduate neuroscience. Experiment in problem-based learning with 'problem boxes'.

A novel course in undergraduate neurosciences is described in this paper. The course features a 'problem-box' and use of an educational prescription, each designed to foster the continual development of problem solving and self-directed study skills. The use of a wide range of evaluation tools, stimulated patients, questionnaires, tutorial evaluations, and interviews indicated that it was successful in its attempt. The philosophy of the design of problem-boxes and the problem-solving approach are discussed.

Curriculum

Management of a major box jellyfish (Chironex fleckeri) sting. Lessons from the first minutes and hours.

OBJECTIVE: To report the management of a serious box jellyfish (Chironex fleckeri) envenomation from the first minutes of bystander first aid and treatment by ambulance personnel to subsequent treatment in hospital. CLINICAL FEATURES: A 14-year-old girl sustained a serious Chironex fleckeri sting. There was no loss of consciousness, but the patient suffered severe pain, myocardial irritability, acute pulmonary oedema and mild systemic hypotension, due to the direct toxic effects of the venom. Thirst was a dominant symptom. INTERVENTION AND OUTCOME: Management involved rapid bystander action and call for ambulance assistance; and early intervention with oxygen/nitrous oxide administration, compression bandaging, antivenom administration and electrocardiographic monitoring at the site by ambulance personnel. Echocardiography in hospital three hours after the sting showed a normal myocardium. In hospital management resulted in recovery. Nocturnal itching of the sting persisted for six weeks. CONCLUSIONS: (i) Vinegar dousing may irritate freshly stung skin, but as a nematocyst inhibitor vinegar remains an essential part of the first aid treatment for cubozoan jellyfish stings. (ii) Compression/immobilisation bandaging was not associated with long-term harm to the sting area. (iii) The pain of an intramuscular antivenom injection may not be felt by a chirodropid sting victim, so safe injection protocols must be strictly observed. (iv) Ambulance services in other States whereas there is a risk of box jellyfish (Chironex fleckeri or Chiropsalmus quadrigatus) stings should be similarly trained and equipped to deal with serious jellyfish envenomations.

Acetates

Electrical stimulation of the hippocampus and acquisition of the conditioned avoidance response in shuttle-box in cats.

The effects of electrical stimulation and electrolytic lesions of the posterior part of the hippocampus on acquisition of the active avoidance response (AAR) in shuttle-box were studied in 35 cats. Both weak or strong hippocampal stimulation applied simultaneously with conditioned stimulus (CS) facilitated the acquisition of AAR. After discontinuation of stimulation the level of AAR performance in response to CS alone decreased in cats trained with the use of strong stimulation. However, if the stimulation was applied before each experimental session the level of AAR performance did not differ from that observed during the final phase of training. These changes of AAR were not observed in cats trained with the use of weak stimulation. The application of hippocampal stimulation alone did not evoke AAR in shuttle-box after training independently of stimulation parameters. There were no differences in the speed of AAR acquisition between unoperated cats, implanted controls and cats with lesions in the posterior part of the hippocampus.

Animals

Differential trans-activation of muscle-specific regulatory elements including the mysosin light chain box by chicken MyoD, myogenin, and MRF4.

We have isolated cDNAs encoding a chicken homologue of MRF4 (cMRF4) in addition to chicken MyoD (CMD1) and myogenin (c-myogenin) described previously. In an attempt to understand the roles that cMRF4, CMD1, and c-myogenin play in chicken myogenesis, the effects of these factors on muscle-specific cis-elements identified in regulatory regions of myosin alkali light chain (MLC) genes were examined. The promoter analysis of some of MLC genes has revealed two sorts of muscle-specific positive regulatory elements to date, an enhancer located upstream of the adult type LC1 gene and a cis-element, termed an MLC box, conserved among promoters of various MLC genes. The LC1 enhancer was exclusively trans-activated by CMD1. Although c-myogenin also activated transcription driven by the LC1 promoter, it was suggested that c-myogenin requires a cis-element(s) other than the CMD1-responsive enhancer. Chicken MRF4 could not trans-activate any of the constructs containing the LC1 promoter. In contrast, the promoter of the embryonic L23 gene was trans-activated by all of the three factors. From deletion and mutation analysis, the MLC box was shown to be involved in their positive regulation. These results extend previous observations that individual myogenic regulatory factors exhibit different capabilities in transcriptional activation of muscle-specific genes by acting distinctively upon their regulatory elements.

Amino Acid Sequence

[Effect of hippocampal injection of oxytocin on shuttle-box avoidance behavior of rats].

Bilateral dorsal hippocampal injection of oxytocin (Oxy, 50 pg, on each side) in rats impaired the acquisition of conditioned avoidance behavior and accelerated the extinction of conditioned avoidance behavior in shuttle-box. The data suggested that the effect of Oxy on shuttle-box conditioned avoidance behavior of rats was at least partly accomplished via the hippocampus; Oxy affected short-term memory as well as long-term memory.

Animals

A cold box for the transport and storage of vaccines.

A cold box capable of maintaining a temperature below +4 degrees C for 1 week was constructed and tested in the laboratory and under field conditions. Cooling is produced by commercial cold packs precooled in a deep-freeze or the freezing compartment of a refrigerator. The box can take approximately 3000 doses of vaccine and is simple, cheap and strong. It is primarily intended for storage of vaccines during field trips by vaccination teams, as an alternative to the refrigerator in regional and peripheral stores in the case of an electrical power failure, and for the delivery of vaccines from regional store to the district.

Cold Temperature

Continuous airway pressure breathing with the head-box in the newborn lamb: effects of regional blood flows.

Continuous airway pressure delivered by a head-box is an accepted means of treating clinical hyaline membrane disease. To investigate hemodynamic alterations resulting from its use, eight newborn lambs, 1 to 6 days of age, were studied at 6 and 11 mm Hg of positive pressure, while spontaneoulsy breathing room air. Organ blood flows and cardiac output were measured with 25 micron-diameter radioactive microspheres. Heart rate, left ventricular pressure, and arterial blood gases did not change during the study. Jugular venous pressures increased from 6.4 mm Hg to 18.6 and 24.2 mm Hg at 6 and 11 mm Hg, respectively (P less than .005). Cardiac output decreased approximately 20% at either intrachamber pressure setting. Renal blood flow fell 21% at 11 mm Hg. No significant changes in blood flow were found in the brain, gastrointestinal tract, spleen, heart, or liver when compared to control flows. Of particular interest was the finding of a 28% reduction in ocular blood flow at 6 mm Hg and 52% at 11 mm Hg. From these results, we conclude that substantial cardiovascular alterations may occur during the application of head-box continuous airway pressure breathing, including a significant reduction in ocular blood flow.

Animals