SEARCH · PubMed Health

Results for “Genes, Reporter”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3Linked to original sources

PubMed1992

Mechanism of entry of a xenotropic MMuLV-derived recombinant retrovirus into porcine cells using the expression of the reporter nlslacZ gene.

A xenotropic Moloney murine leukemia virus-derived recombinant retrovirus (MMuLVSVnlslacZ) has been utilized to study the mechanism of virus entry into endothelial and epithelial porcine cells. In the genome of this recombinant retrovirus, the nlslacZ reporter gene is under the transcriptional control of both LTR and SV40 early promoter. The entry of the retrovirus has been determined from the expression of this transduced reporter gene after its integration into the infected cells. This allows the detection of a very low level of viral infection and hence entry of the virus. Exposure of the virus-cell mixture to acidic pH (less than 6) during the early phase of interaction reduces the level of internalization. Cellular infection in presence of weak bases, ammonium chloride and amantadine and an ionophore monensin at concentrations sufficient to neutralize the endosomal pH does not modify the extent of viral entry into the cells. The results indicate that the entry of the recombinant retrovirus into porcine cells takes place by a pH-independent viral membrane-cell plasma membrane fusion mechanism.

Amantadine↗

PubMed1992

Regulation of smooth muscle alpha-actin promoter in ras-transformed cells: usefulness for setting up reporter gene-based assay system for drug screening.

Oncogenic activation of ras results in changes in the transcription of several genes leading to uncontrolled cell growth. In this paper, we demonstrate that transformation of fibroblast cells by the ras oncogene leads to transcriptional repression of the smooth muscle alpha-actin promoter. Transient transfection analysis of plasmids containing the 5' upstream region of the human alpha-actin gene fused to human growth hormone or bacterial chloramphenicol acetyltransferase coding sequences into Rat-2 and ras-transformed Rat-2 (HO6) cells indicates that alpha-actin promoter is repressed in ras-transformed cells. In addition, stable rat fibroblast cell lines expressing human growth hormone or beta-galactosidase under the control of alpha-actin promoter exhibit repressed reporter gene activity following transformation by the ras oncogene. alpha-Actin promoter-driven beta-galactosidase activity is derepressed in revertants of ras-transformed stable cell lines. This revertant cell line expresses elevated levels of ras p21 protein and is resistant to retransformation by Ki and Ha-ras oncogenes. The revertant may have either a defective target protein whose activity is essential for the transforming activity of ras or an activated tumor suppressor gene which can suppress the activity of ras. These results indicate that smooth muscle alpha-actin promoter activity is a sensitive marker to follow phenotypic changes following transformation by ras and subsequent reversion. The advantages of this alpha-actin promoter-reporter gene assay system to screen for drugs that inhibit the transforming activity of ras, either directly or indirectly, are discussed.

Actins↗

PubMed1992

Translation enhancing properties of the 5'-leader of potato virus X genomic RNA.

The double-stranded DNA copy corresponding to the 5'-nontranslated alpha beta-leader of potato virus X (PVX) genomic RNA (positions -3 to-85 according to AUG initiator) was chemically synthesized and fused to the transcription plasmids containing three different reporter genes: neomycinphosphotransferase type II (NPT II) gene, Bacillus thuringiensis coleopteran-specific toxic protein gene and beta-glucuronidase (GUS) gene. Expression of the reporter genes in vitro and in plant protoplasts (in the case of GUS gene) reveals that the alpha beta-leader of PVX RNA acts as a translation enhancer despite the presence of the upstream vector-derived sequence and irrespective of the length of the spacer sequence preceding the reporter genes.

Animals↗

PubMed1991

Promoter traps in embryonic stem cells: a genetic screen to identify and mutate developmental genes in mice.

A general strategy for selecting insertion mutations in mice has been devised. Constructs lacking a promoter and including a beta-galactosidase gene, or a reporter gene encoding a protein with both beta-galactosidase and neomycin phosphotransferase activity, were designed so that activation of the reporter gene depends on its insertion within an active transcription unit. Such insertion events create a mutation in the tagged gene and allow its expression to be followed by beta-galactosidase activity. Introduction of promoter trap constructs into embryonic stem (ES) cells by electroporation or retroviral infection has led to the derivation of transgenic lines that show a variety of beta-galactosidase expression patterns. Intercrossing of heterozygotes from 24 strains that express beta-galactosidase identified 9 strains in which homozygosity leads to an embryonic lethality. Because no overt phenotype was detected in the remaining strains, these results suggest that a substantial proportion of mammalian genes identified by this approach are not essential for development.

Animals↗

PubMed1991

Identification of posttranscriptionally active inhibitory sequences in human immunodeficiency virus type 1 RNA: novel level of gene regulation.

cis-acting inhibitory region (IR) sequences were identified within the gag/pol gene of the human immunodeficiency virus type 1 (HIV-1) by using a novel feedback-stimulated, rev-independent tat reporter gene to screen HIV-1 sequences in transient expression assays. Two regions, a 1,295-nucleotide segment in the gag gene (IR-1) and a 1,932-nucleotide segment of the pol gene (IR-2), each inhibited reporter gene expression 10- to 20-fold. IR-1 and IR-2 both contained subsequences which inhibited reporter gene expression. Introduction of IR sequences into a heterologous reporter plasmid, pCMV-CAT, resulted in decreased chloramphenicol acetyltransferase expression, suggesting that the inhibitory effect was not restricted to a reporter gene under the control of the HIV-1 promoter. The presence of HIV IR sequences in cis did not alter relative levels of reporter gene RNA; however, fractionation studies revealed IR-containing RNA accumulated in the nucleus. These findings demonstrate that IR sequences within the gag/pol region affect gene expression by altering the cellular distribution of viral RNA.

Base Sequence↗

PubMed2026

Emerging genes implicated in human congenital heart disease: a 2023-2025 scoping review.

BACKGROUND: Congenital heart disease (CHD) is the most common major congenital anomaly and a leading cause of infant morbidity and mortality. The rapid expansion of genomic technologies has accelerated the discovery of rare genetic variants implicated in CHD pathogenesis. However, most individuals with CHD still lack an identifiable molecular etiology. The purpose of this scoping review is to systematically characterize genes reported in the recent literature as candidate CHD-associated genes and contextualize these findings within the stages of cardiac morphogenesis. METHODS: PubMed was searched using predefined terms related to CHD and genetic variants, supplemented by a prospectively maintained internal database. We included human studies published between January 2023 and December 2025 that identified pathogenic, likely pathogenic, or uncertain monogenic variants in at least one patient with CHD. Animal-only studies, chromosomal abnormalities, copy number variants, multigenic associations, transcriptomic/proteomic analyses, reviews, and maternal-only genetic studies were excluded. Gene-disease validity classifications were assigned using the Clinical Genome Resource (ClinGen) CHD Gene Curation Expert Panel framework. RESULTS: Of 2,834 screened articles, 391 studies met inclusion criteria, identifying 912 unique genes reported as candidate CHD-associated genes. Frequently reported genes included PTPN11, NOTCH1, GATA4, JAG1, MYH6, GATA6, and LZTR1. Identified genes spanned all major stages of cardiogenesis, including developmental priming, cardiac progenitor specification, left-right axis formation, neural crest migration, outflow tract development, septation, and postnatal structural remodeling. Studies increasingly implicated ciliary dysfunction, transcriptional regulation, ribosomal biology, and multigenic inheritance in CHD pathogenesis. Emerging methodologies included stem cell-derived cardiac models, machine learning-based gene prioritization, and epigenetic analyses. CONCLUSIONS: Recent literature substantially expands the catalog of candidate genes that may be associated with CHD and highlights the biologic complexity underlying cardiac morphogenesis. Integration of genomic, developmental, and functional approaches will be essential to improve mechanistic understanding, refine genetic counseling, and support future precision medicine strategies for CHD.

Cardiac development↗

PubMed1992

HIV-1 LTR activation model: evaluation of various agents in skin of transgenic mice.

Mice containing the HIV-1 long terminal repeat (LTR) regulating the expression of firefly luciferase reporter gene were investigated for their use as a model for activation of the LTR. As a limited test of this model, a number of different factors were screened for their ability to affect reporter gene activities in the skin. Reporter gene levels were increased in the skin by topical treatment of dimethylsulfoxide, retinoic acid, phorbol ester, ultraviolet light, and hydrogen peroxide, all of which have previously been shown to cause increased HIV production in cultured human cells. Topically applied arachidonic acid, histamine, ethanol, acetone, and methanol did not increase reporter gene activities. A lack of published reports on activation of HIV-1 in human cells by these agents suggests that they do not activate viral expression in human cells, which corroborates with the findings of this report. Minor forms of skin wounding and intraperitoneally administered psoralen plus ultraviolet light also increased reporter gene activities in skin. Control and test treatments could be performed on the same mouse and repetitive samples could be obtained from each treatment area. These transgenic mice might be useful as predictive models for regulation of the LTR in epidermal or dendritic cells.

Administration, Topical↗

PubMed1992

Altered morphology in transgenic tobacco plants that overproduce cytokinins in specific tissues and organs.

An auxin-inducible bidirectional promoter from the soybean SAUR gene locus was fused to a reporter gene in one direction and a cytokinin biosynthetic gene in the opposite direction and the expression of these fused genes was examined in transgenic tobacco. The Escherichia coli uidA gene, which encodes the enzyme beta-glucuronidase (GUS), was used as the reporter gene and the Agrobacterium tumefaciens ipt gene, which encodes the enzyme isopentenyl transferase, was used as the cytokinin biosynthetic gene. These constructs allowed the overproduction of cytokinins in tobacco in a tissue- and organ-specific manner. Localized overproduction of cytokinins was monitored using the GUS reporter gene and measured by an ELISA assay. The tissue- and organ-specific overproduction of cytokinins produced a number of morphological and physiological changes, including stunting, loss of apical dominance, reduction in root initiation and growth, either acceleration or prolonged delayed senescence in leaves depending on the growth conditions, adventitious shoot formation from unwounded leaf veins and petioles, altered nutrient distribution, and abnormal tissue development in stems. While some of these morphological changes result directly from the localized overproduction of cytokinins, other changes probably result from the mobilization of plant nutrients to tissues rich in cytokinins.

Amino Acids↗

PubMed1992

Behavior of genes directly injected into the rat heart in vivo.

Gene transfer can be achieved in the adult rat heart in vivo by direct injection of plasmid DNA. In this report we define the spatial and temporal limits of reporter gene expression after a single intracardiac injection. pRSVCAT (100 micrograms), in which the Rous sarcoma virus long terminal repeat is fused to the chloramphenicol acetyltransferase reporter gene, and p alpha MHCluc (100 micrograms), in which the alpha-cardiac myosin heavy chain promoter is fused to the firefly luciferase gene, were injected into hearts, and reporter gene activities were assayed at various times. Both chloramphenicol acetyltransferase and luciferase were detectable in 100% of the rats from 1 to 7 days, in 60% of the rats from 17 to 23 days, and in 30% of the rats from 38 to 60 days after injection. Reporter gene activity was largely limited to a 1-2-mm region of the ventricle surrounding the injection site. Closed circular DNA was far more effective than linear DNA in transfecting cells in vivo. The relative strengths of three different promoters, Rous sarcoma virus long terminal repeat, alpha-myosin heavy chain, and alpha 1-antitrypsin, all fused to the luciferase reporter gene were determined. The constitutive viral promoter was approximately 20-fold more active than the cardiac-specific cellular promoter, and the liver-specific cellular promoter was not active at all in the cardiac environment. Thus, direct injection of genes into the heart offers a simple and powerful tool with which to assess the behavior of genes in vivo.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗

PubMed2025

A Dual-Selection System for Enhanced Efficiency and Fidelity of Circular RNA Overexpression.

Circular RNAs (circRNAs) are essential regulators of cellular processes, but are challenging to study using traditional methods. Overexpression approaches, such as the use of linearized plasmids and viral vectors, often result in high rates of false-positive clones, where cells retain selection markers without expressing the target circRNA. This study addresses this limitation by developing a dual-selection circRNA system designed to enhance the accuracy and reliability of circRNA overexpression. Our system integrates a fluorescent reporter gene upstream of the circRNA expression cassette, under a shared promoter, and a downstream antibiotic resistance marker, allowing for both antibiotic selection and flow cytometric cell-sorting to identify and enrich cells with genuine circRNA expression. We successfully incorporated this system into an inducible lentiviral vector for controlled overexpression in various cell types. The dual-selection circRNA system offers a significant advance for circRNA research and studies of other RNA species where accurate and reliable overexpression is essential.

RNA, Circular↗

PubMed1992

Role of CAAT-enhancer binding protein isoforms in the cytokine regulation of acute-phase plasma protein genes.

Rat hepatic cells respond to interleukin (IL) -1, IL-6, and dexamethasone treatment by increasing the transcription rate of acute-phase plasma protein genes. The same conditions lead to changes in the expression of CAAT-enhancer binding protein (C/EBP) isoforms which are specific to the hepatic cell line. To identify the relationship between C/EBP isoforms and acute-phase protein gene activation, the hormone-specific expression of C/EBP alpha, beta, and delta was determined in H-35 and HTC cells and was compared to acute-phase liver. C/EBP beta was found to be the principal isoform in hepatoma cells and to be strongly stimulated by cytokines and dexamethasone in H-35 cells. Transactivating functions were observed for all three C/EBP isoforms by cotransfection of CAT gene reporter constructs containing cytokine and glucocorticoid response elements of acute-phase protein genes and expression plasmids for mouse C/EBP alpha, beta, and delta into rat and human hepatoma cells. The degree of C/EBP-mediated transactivation was, however, extremely variable among the different regulatory elements. Transcription run-on reactions with nuclei from transiently transfected H-35 cells indicated that cotransfected C/EBP beta increases basal expression of reporter gene constructs as well as the dexamethasone-mediated stimulation of constructs containing the glucocorticoid response elements of the rat alpha 1-acid glycoprotein gene, but did not accelerate or enhance hormone-dependent transcription activation of reporter gene plasmids containing the IL-6 regulatory element of the beta-fibrinogen gene. Activation of the reporter gene constructs appeared to be temporally and quantitatively correlated with the amount of nuclear C/EBP as determined by two-dimensional Western and Southwestern blot analyses.

Acute-Phase Proteins↗

PubMed1992

Identification of a cis-regulatory element mediating somatostatin inhibition of epidermal growth factor-stimulated gastrin gene transcription.

Antral gastrin secretion and gene expression is inhibited by the paracrine release of somatostatin from antral D cells. Transforming growth factor-alpha and epidermal growth factor (EGF) stimulate gastrin reporter gene constructs when transfected into pituitary GH4 cells. Somatostatin inhibits EGF stimulation of gastrin gene expression, which is in part mediated at the level of transcriptional regulation as somatostatin inhibits EGF stimulation of gastrin reporter gene constructs. Somatostatin inhibition was abolished by pertussis toxin, indicating somatostatin inhibits transcription through the inhibitory G protein Gi. Somatostatin inhibition was unaffected by vanadate and okadaic acid, implying this inhibitory pathway is mediated neither through phosphotyrosine phosphatases nor serine/threonine phosphatases, respectively. Gastrin reporter genes containing 82 base pairs of the 5'-flanking DNA were sufficient to confer both EGF responsiveness and inhibition by somatostatin in GH4 cells. However, transcription of a gastrin reporter gene construct containing only the EGF response element (GGGGCGGGGTGGGGGG), located at -68 to -53, was stimulated by EGF but was not inhibited by somatostatin. Thus, somatostatin inhibits EGF-stimulated gastrin gene transcription by a mechanism other than by interfering with cell signals elicited by the EGF receptor. Since the 82 GASCAT is inhibited by somatostatin, this result also implies that sequences adjacent to the EGF response element contain a cis-regulatory element mediating transcriptional inhibition by somatostatin. This cis-element was located using gastrin reporter genes comprising sequential segments of the human gastrin promoter sequence from the transcriptional start site to -82 in the 5'-flanking DNA. Gastrin oligonucleotide constructs lacking the D oligonucleotide (gatcCATATGGCAGGGTA), located at -82 to -69 in the 5'-flanking DNA, were not inhibited by somatostatin, indicating that a somatostatin inhibitory cis-element is located between -82 and -69 in the 5'-flanking DNA of the human gastrin promoter.

Animals↗

PubMed1992

A novel transgenic mouse model for the in vivo evaluation of anti-human immunodeficiency virus type 1 drugs.

We have developed a binary transgenic mouse system that allows easy in vivo evaluation of new anti-human immunodeficiency virus type 1 (HIV-1) drugs or therapies specifically designed to target the viral transactivator protein (TAT) or long terminal repeat (LTR) functions. This approach consists of a simple genetic cross between an "activator" transgenic mouse expressing the HIV-1-tat gene exclusively to T lymphocytes and a "target" transgenic mouse bearing a silent reporter gene whose expression is under the control of the HIV-1-LTR. As expected, most of the target transgenic animals did not express the reporter gene; on the contrary, all the double-transgenic mice bearing both the activator and target transgenes strongly expressed the TAT-induced reporter gene. The choice of a secreted human alpha 1-antitrypsin variant (alpha 1-AT) as reporter gene readily permits in a single animal the quantitative determination of the plasma level of alpha 1-AT protein before and after anti-LTR or anti-TAT treatments. Such mice may be valuable as new laboratory models for the in vivo evaluation of agents with potential anti-HIV-1 activity.

Animals↗

PubMed2005

Transcriptional switch of the dia1 and impA promoter during the growth/differentiation transition.

When growth stops due to the depletion of nutrients, Dictyostelium cells rapidly turn off vegetative genes and start to express developmental genes. One of the early developmental genes, dia1, is adjacent to a vegetative gene, impA, on chromosome 4. An intergenic region of 654 bp separates the coding regions of these divergently transcribed genes. Constructs carrying the intergenic region expressed a reporter gene (green fluorescent protein gene) that replaced impA in growing cells and a reporter gene that replaced dia1 (DsRed) during development. Deletion of a 112-bp region proximal to the transcriptional start site of impA resulted in complete lack of expression of both reporter genes during growth or development. At the other end of the intergenic region there are two copies of a motif that is also found in the carA regulatory region. Removing one copy of this repeat reduced impA expression twofold. Removing the second copy had no further consequences. Removing the central portion of the intergenic region resulted in high levels of expression of dia1 in growing cells, indicating that this region contains a sequence involved in repression during the vegetative stage. Gel shift experiments showed that a nuclear protein present in growing cells recognizes the sequence GAAGTTCTAATTGATTGAAG found in this region. This DNA binding activity is lost within the first 4 h of development. Different nuclear proteins were found to recognize the repeated sequence proximal to dia1. One of these became prevalent after 4 h of development. Together these regulatory components at least partially account for this aspect of the growth-to-differentiation transition.

Animals↗

PubMed1992

Analysis of the human tyrosine hydroxylase promoter-chloramphenicol acetyltransferase chimeric gene expression in transgenic mice.

To investigate cis-elements responsible for catecholaminergic (CAnergic) neuron-specific expression of the tyrosine hydroxylase (TH) gene, we produced lines of transgenic mice carrying 5.0-kb, 2.5-kb and 0.2-kb fragments from the 5'-flanking region of the human TH gene fused to a reporter gene, chloramphenicol acetyltransferase (CAT), and designated them as TC 50, TC 25, and TC 02, respectively, and reporter gene expression in transgenic mice was analyzed by CAT assay by immunocytochemistry with anti-CAT antibody. High-level CAT expression was observed in the brain and adrenal gland using the 5.0-kb promoter of the TC 50 mice, but ectopic expression was consistently observed in several somatic tissues, e.g. thymus, colon, and testis. In brain, expression was achieved in CAnergic neurons with the largest construct (5.0 kb), but not with 2.5 kb or 0.2 kb of 5' flanking sequence. However, TC 50 mice also expressed CAT immunoreactivity in non-CAnergic neurons. In the TC 25 line CAT immunoreactivity was detected only in some non-CAnergic neurons. In the TC 02 line no CAT immunoreactivity was detected in any of the tissues examined. These results indicate that the 5.0-kb DNA fragment of the TH gene upstream region contains activity to express CAT in CAnergic neurons and surprisingly, lacks some regulatory elements attenuating ectopic expression, and that the 2.5-kb and 0.2-kb fragment are not sufficient for the proper expression. We discuss the presence of the tissue-specific regulatory elements in the structure portion of the TH gene and/or 3'-flanking region.

Animals↗

PubMed1992

Regulated transcription of the maize Bronze-2 promoter in electroporated protoplasts requires the C1 and R gene products.

The putative maize transcription factor genes R and C1 are required for expression of reporter genes with promoters from the Bz1 and A1 genes, which encode enzymes required for anthocyanin biosynthesis in maize. Bz2 is another anthocyanin biosynthetic gene; we show that expression of a reporter gene from the Bz2 promoter also requires R and C1 when the fusion construct is introduced into maize kernels by particle gun bombardment. When electroporated into maize protoplasts from a suspension cell line not synthesizing anthocyanins, reporter genes with Bz2, Bz1, and A1 promoters are expressed only when both R and C1 expression plasmids are co-electroporated. Electroporation of R and C1 expression plasmids also induces the endogenous genes required for anthocyanin synthesis, resulting in pink protoplasts within 24 h. RNase protection analysis demonstrates that accumulation of mRNA from the endogenous Bz1 and Bz2 genes absolutely requires introduced R and C1. In time-course experiments there is a delay of 3-6 h before the Bz2 promoter is activated, supporting the proposed role for R- and C1-encoded proteins in transcriptional control. An excess of R relative to C1 suppresses expression of A1, Bz1, and Bz2 promoters, suggesting an interaction between the R and C1 proteins.

Anthocyanins↗

PubMed1992

beta-Galactosidase of Kluyveromyces lactis (Lac4p) as reporter of gene expression in Candida albicans and C. tropicalis.

Vectors containing fusions of the Candida albicans ACT promoter to heterologous genes were constructed and transformed into a C. albicans host strain. beta-Galactosidase (Lac4p) activity was detected in transformants carrying an ACT fusion to the Kluyveromyces lactis LAC4 gene, while fusions to the Escherichia coli lacZ gene and to other heterologous genes were not expressed. Lac4p was also produced by C. tropicalis transformants carrying the ACT/LAC4 fusion. Plasmids in transformed C. albicans strains were present either as free multimers in high copy number or, more frequently, integrated into the genome in low copy number yielding high and low LAC4 mRNA and Lac4p expression levels, respectively. Lac4p-expressing transformants of C. tropicalis, but not of C. albicans, were able to utilize lactose as sole carbon source. An ACT/LAC4 fusion was not differentially expressed during the yeast and hyphal growth phases of C. albicans, indicating that the ACT promoter is not regulated during morphogenesis. These results define the first reporter gene system for convenient monitoring of gene expression in Candida species.

Base Sequence↗

PubMed1992

Cloning of a mu-class glutathione S-transferase gene and identification of the glucocorticoid regulatory domains in its 5' flanking sequence.

The expression of a mu-class glutathione S-transferase gene (hGSTYBX) isolated from hamster smooth muscle tumor cells (DDT1 MF-2) is transcriptionally up-regulated by glucocorticoids, and this hormonal regulation is dependent upon protein synthesis. To study the mechanism of regulation, we have cloned and sequenced hGSTYBX genomic DNA including its 5' flanking region. The hGSTYBX gene contains nine exons dispersed over a 6.3-kilobase region. When linked to a chloramphenicol acetyltransferase (CAT) reporter gene, the 5' flanking region was able to direct transcription of the reporter gene. With 5' deletion studies, we have localized the major glucocorticoid-inducible regulatory element between nucleotides -353 and -239. Within this region no classic glucocorticoid response element (TGTTCT) was identified, but four potential helix-loop-helix binding domains are embedded in two 16-base-pair repeats. Another glucocorticoid regulatory domain has been localized between nucleotides -239 and -136. Cycloheximide blocks glucocorticoid-induced transcription of both the -353CAT and -239CAT reporter genes (nucleotides -447 to -12 and nucleotides -239 to -12 of hGSTYBX, respectively, ligated to a CAT reporter gene); therefore, our observations support previous results suggesting that hGSTYBX induction by glucocorticoids is a secondary response.

Amino Acid Sequence↗