SEARCH · PubMed Health

Results for “TOXOPLASMA”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 55 records · Page 3Linked to original sources

PubMed1981

Toxoplasma gondii infection of the central nervous system. Use of the peroxidase-antiperoxidase method to demonstrate toxoplasma in formalin fixed, paraffin embedded tissue sections.

The peroxidase-antiperoxidase immunohistochemical technique was employed to stain formalin fixed, paraffin embedded tissue sections from three cases of encephalitis caused by Toxoplasma gondii. We studied two cases of congenital infection and one case of acquired toxoplasmosis occurring in an immunocompromised host. The peroxidase-antiperoxidase method was exquisitely sensitive and highly specific and stained both the encysted and tachyzoite forms of the organism, as well as allowing for easy identification of infected cells. In two cases of necrotizing encephalitis--one congenital, the other acquired--widespread dissemination of the Toxoplasma organism throughout the neural parenchyma was visualized using the peroxidase-antiperoxidase stain. Brain biopsy material that had been obtained eight days prior to death in the case of adult acquired toxoplasmosis did not contain any of the characteristic tissue cysts and was not diagnostic for toxoplasmosis by conventional staining techniques. However, peroxidase-antiperoxidase staining of tissue sections from this biopsy unequivocally demonstrated both free tachyzoites and multiple infected cells. Further application of the peroxidase-antiperoxidase method should increase our understanding of the pathology and pathogenesis of toxoplasmic encephalitis as well as allowing timely diagnosis in cases presenting with neurologic symptomatology.

Animals↗

PubMed1957

Staining toxoplasma gondii with fluorescein-labelled antibody. II. A new serologic test for antibodies to Toxoplasma based upon inhibition of specific staining.

A new serologic test for antibodies to Toxoplasma is described, which is based upon inhibition of specific staining with fluorescent antibody. In performing the test, a mixture of the test serum and known fluorescein-labelled antiserum is added to a dried smear of toxoplasms for 1 hour at 37 degrees C. The smear is then rinsed and examined with a fluorescence microscope. Reduction in the brightness of fluorescence, as compared to that of a negative control slide, indicates the presence of antibody in the test serum. A comparison of the results of this test with those of the methylene blue dye test showed a strong parallelism between the two sets of results. On the other hand, the complement-fixation test for toxoplasmosis did not yield nearly as many positives as the inhibition test. The specificity of the new test was studied by comparing it with dye test results and clinical histories in human patients, and by testing a group of animals immunized with a variety of non-Toxoplasma antigens. No evidence of cross-reactions was obtained in the latter series. Some advantages and disadvantages of the inhibition test are discussed.

Animals↗

PubMed1991

Sensitive and specific detection of toxoplasma DNA in an experimental murine model: use of Toxoplasma gondii-specific cDNA and the polymerase chain reaction.

Toxoplasma gondii, an apicomplexan parasite of mammals and birds, is well recognized as a cause of encephalitis in AIDS patients and as a cause of congenital infections. The polymerase chain reaction (PCR) and toxoplasma cDNA clones were used to diagnose T. gondii infection in an acute murine model of toxoplasmosis. Diagnosis of tissue infection by Southern blot hybridization with cDNA clones of T. gondii was possible within 5 days of infection. This technique could detect as few as 10,000 organisms. Specific T. gondii gene amplification by PCR using the primers 5'CACACGGTTGTATGTCGGTTTCGCT3' and 5'TCAAGGAGCTCAATGTTACAGCCT3' followed by oligonucleotide hybridization using 5'GCGGTCATTCTCACACCGACGGAGAACCACTTCACTCTCA3' allowed detection of T. gondii in the tissue of mice by day 2 after infection and in the blood of mice by day 5 after infection with RH strain T. gondii. This technique could detect as few as 10 organisms. Thus, these techniques may be useful in the diagnosis of toxoplasmosis.

Animals↗

PubMed1998

Detection of human Toxoplasma-specific immunoglobulins A, M, and G with a recombinant Toxoplasma gondii rop2 protein.

The Toxoplasma gondii rhoptry protein Rop2 was expressed in Escherichia coli as a fusion protein containing 44 kDa of the 55-kDa mature Rop2, supplied with six histidyl residues at the N-terminal end (Rop2196-561). Humoral response during Toxoplasma infection of humans was analyzed by immunoglobulin G (IgG), IgA, and IgM enzyme-linked immunosorbent assay with Rop2196-561 as the antigen substrate. The analyzed sera were divided according to T. gondii-specific serological tests (IgG, IgA, or IgM indirect immunofluorescence and IgA or IgM immunosorbent agglutination assay) as group A (IgG+ IgA- IgM-; n = 35), group B (IgG+ IgA+ IgM+; n = 21), group C (IgG+ IgA+ IgM-; n = 5), and group D (IgG+ IgA- IgM+; n = 16). Twenty-six T. gondii-seronegative sera from individuals with other infections were also included (group E). Anti-Rop2 IgG antibodies were detected in 82.8% of group A sera and in 97.6% of the sera with acute-phase marker immunoglobulins (groups B, C, and D). The percentage of IgA antibody reactivity against Rop2196-561 was 17.1% in group A, 50% in group D, and 80.8% in groups B and C. The percentage of IgM antibody reactivity was 0% in groups A and C and 62% in groups B and D. Sera from group E failed to show IgA, IgM, or IgG antibody reactivity. Since T. gondii Rop2 elicits a strong humoral response from an early stage of infection, it is suggested that recombinant Rop2196-561 would be suitable for use in diagnostic systems, in combination with other T. gondii antigens, to detect specific IgG, IgA, and IgM antibodies.

Animals↗

PubMed1968

Lysosomes of Toxoplasma gondii and their possible relation to the host-cell penetration of toxoplasma parasites.

Lysosome-like structures of Toxoplasma gondii were observed by means of vital staining with acridine orange and by the Gomori technique. These structures were found scattered over the cytoplasm but were often located at one end of the parasite. In comparison with parasites of the inoculum used for infecting HeLa cell cultures, the toxoplasma which had penetrated the HeLa cells revealed a markedly lower percentage of parasites showing lysosomal staining. After the penetration, the number of parasites with demonstrable lysosomes increased successively and, at the time for release of newly formed parasites (at 24 hr), the majority of the parasites demonstrated lysosome-like bodies in the cytoplasm. The observations are discussed with special reference to the mechanism of host-cell penetration.

Acridines↗

PubMedDate not supplied

Fine needle aspiration cytologic diagnosis of toxoplasma lymphadenitis. A case report with detection of a Toxoplasma bradycyst in a Papanicolaou-stained smear.

BACKGROUND: Fine needle aspiration (FNA) cytologic diagnosis of toxoplasmic lymphadenitis with demonstration of a tissue cyst containing bradyzoites has been very rarely reported. CASE: A 17-year-old female presented with a mobile, painless, 2-cm-diameter swelling over the right suprascapular area. Clinical diagnosis was lipoma. FNA smears showed features of reactive lymphoid hyperplasia, including tingible body macrophages and groups of epithelioid histiocytes. A Toxoplasma cyst with bradyzoites was also demonstrated in a Papanicolaou-stained smear. Following FNA cytodiagnosis, serologic tests revealed a high titer of IgG and the presence of IgM-specific antibodies to Toxoplasma gondii, indicating active/recent disease. CONCLUSION: FNA cytology is a valuable tool for the diagnosis of toxoplasmic lymphadenitis. Papanicolaou stain is appropriate for demonstration of the parasite. Serology is an excellent adjunct in clinching the diagnosis.

Adolescent↗

PubMed2000

Toxoplasma gondii catalase: are there peroxisomes in toxoplasma?

The intracellular protozoan parasite Toxoplasma gondii, like all members of the phylum Apicomplexa, is known to possess many organelles: in addition to mitochondria and the compartments of the secretory pathway, there is a reduced chloroplast (the apicoplast) and the phylum-specific components of the apical complex: dense granules, micronemes and rhoptries. Conspicuously missing so far are microbodies, organelles that can be found in nearly all eukaryotic organisms. Microbodies show a large variation with regard to their size, number and contents, depending on the organism and cell type. One marker enzyme of this single membrane-bound organelle is catalase, which is responsible for the degradation of hydrogen peroxide to water and oxygen. The EST project in T. gondii revealed the existence of two overlapping clones which showed similarity with catalase, and these were used to clone the corresponding gene. The predicted sequence of T. gondii catalase has -AKM at the C terminus, which falls within the consensus of the PTS1 peroxisomal targeting signal. Southern blot analysis confirmed the presence of a single copy gene. Northern and western blot analyses showed that the catalase gene is transcribed and translated. Immunofluorescence assays using an antibody raised against a catalase peptide identified a distinct structure towards the apical end, but other catalase-specific antibodies failed to confirm this localisation. Cell fractionations indicated that the majority of the enzyme was in the cytosol. The fusion of the C-terminal twelve amino acids, including AKM, or the canonical peroxisomal targeting signal, -SKL, to GFP resulted in predominantly cytosolic localization in T. gondii. There was therefore no evidence for membrane-bound peroxisomes in Toxoplasma.

Amino Acids↗

PubMed2003

Isolation of Toxoplasma gondii from goats with history of reproductive disorders and the prevalence of Toxoplasma and chlamydial antibodies.

The prevalence of antibodies to Toxoplasma gondii and Chlamydia psittaci was assessed in goats with a history of abortion, stillbirth and neonatal mortality. Antibodies were detected in 540 (30%) and 57 (3.2%) goats out of 1799 tested by indirect haemagglutination and complement fixation tests, respectively. Toxoplasma gondii was isolated for the first time in Botswana from 22 out of 81 sets (27.2%) of foetal tissues, maternal and foetal cotyledons and uterine tissues of goats which had previously aborted or given birth to stillborn or weak kids that died within two days of birth. These results implicate T. gondii and C. psittaci, but especially the former, to be associated with caprine reproductive problems and require appropriate control measures.

Abortion, Veterinary↗

PubMed1989

[Testing of a modified Toxoplasma immunosorbent-adsorption assay (IgM-ISAGA) for the detection of Toxoplasma-specific IgM antibodies in the routine laboratory].

Testing of a modified Toxoplasma immunosorbent adsorption assay (IgM-ISAGA) for proving of Toxoplasma specific IgM antibodies. The IgM-ISAGA was assessed for the possibility of its application as a routine method in the serodiagnosis of toxoplasmosis and was compared with the IgM-IFT. On examination for specific on 136 sera, no false-positive results were obtained in the IgM-ISAGA in contrast to 5 false-positives in the IgM-IFT, due to the presence of rheumatoid factor. Its sensitivity was tested on 162 sera. The IgM-ISAGA reacted positive in 89 cases, the IgM-IFT in only 51. It was concluded that the IgM-ISAGA is a simple, sensitive and highly specific test applicable in smaller laboratories as a confirmatory reaction in the control of toxoplasmosis during pregnancy and in confirmation of connatal toxoplasmosis.

Animals↗

PubMed1986

Attenuation of the virulent RH strain of Toxoplasma gondii by passages in mice immunized with Toxoplasma lysate antigens.

The virulent RH strain of Toxoplasma gondii was attenuated after a few passages or just one long passage in mice immunized twice with a four-week interval between immunizations with an emulsion of Toxoplasma lysate antigens and complete Freund's adjuvant. Three avirulent strains, RH-cyst III, IV and VIII were established from the RH strain. The RH-cyst III strain was effective for vaccination against challenge with the original, virulent RH strain. The attenuation of T. gondii is an expression of the innate attributes of this parasite necessary to maintain its parasitic life cycle in nature.

Animals↗

PubMed1981

Production and properties of Toxoplasma growth inhibitory factor (Toxo-GIF) and interferon (IFN) in the lymphokines and the circulation of Toxoplasma immune mice.

Assessment in vitro were carried out to study Toxo-GIF and IFN in lymphokines, LKs, produced by immune spleen cells with Toxoplasma lysate antigen (TLA). LKs were obtained from the cells after incubation for 24 to 48 h with TLA. They inhibited almost completely the intracellular multiplication of Toxoplasma (Tp) within homologous cells. Peak IFN activities were observed in the same LKs. The IFN was inactivated at pH 2, but did not lose its activity at 56 degrees C, suggesting that it might be type II or gamma IFN. Further evidence was presented of the coordinate production and properties of Toxo-GIF and IFN in the circulating blood of Tp-immune mice injected intraperitoneally with TLA or Poly I: C. The IFN was designated type II or gamma IFN. Its maximum activity appeared in Tp-immune mice 6 h after TLA or Poly I: C injection, while a maximum Toxo-GIF activity was observed in these mice 24 to 48 h after injection. Type I IFN activity was detected in the serum of normal mice injected with TLA or Poly I: C. Type I IFN differed markedly from type II IFN, because it was stable at pH 2 and unstable at 56 degrees C. Evidence was presented which emphasized the difference in activity in relation to the time of appearance between Toxo-GIF and IFN.

Animals↗

PubMed1997

Combinations of three immunological assays for detecting anti-Toxoplasma IgG in the sera of patients infected with Toxoplasma gondii.

Enzyme-linked immunosorbent assay (ELISA), Dot-ELISA and Dot-immunogold silver staining (Dot-IGSS) were simultaneously used to detect the specific IgG against Toxoplasma gondii in 65 patients infected with the protozoa. The positive rates were 86.51%, 92.51% and 98.64%, respectively. When ELISA and Dot-ELISA results were put together, the positive rate increased to 95.38%. When Dot-IGSS results were combined with those of ELISA or Dot-ELISA, the positive rate was raised to 100%. The difference in positive rate between ELISA and Dot-IGSS was significant (x2 = 6.93, p < 0.01), but no statistically significant differences were found between ELISA and Dot-ELISA or between Dot-ELISA and Dot-IGSS. Paired comparison of the reacting intensities of the sera in the 3 assays showed the correlations were highly significant (p < 0.001), with r = 0.608 between Dot-IGSS and Dot-ELISA, r = 0.8194 between Dot-IGSS and ELISA and r = 0.517 between Dot-ELISA and ELISA. Hence combination of different serological assays may increase their sensitivity and specificity for detecting the anti-Toxoplasma antibodies.

Animals↗

PubMed1984

Immune response of mice to ingested Toxoplasma gondii: a model of toxoplasma infection acquired by ingestion.

SWR/J mice perorally infected with the Me49 strain of Toxoplasma gondii developed thymic cortical atrophy, clusters of epithelioid cells and plasma cells in lymphoid tissue, and hepatic inflammation during the first month after infection; the inflammation subsequently decreased. Antibody to T gondii was present in serum on day 14 after infection, reached a maximal titer by one month, and remained at this titer for five months. Splenic lymphocyte blastogenesis in response to concanavalin A was depressed for one month but returned to normal in most mice by two months. Splenic lymphocyte blastogenesis in response to toxoplasma antigens (stimulation index, greater than or equal to 1.6) developed in one-third of mice after two months of infection but did not develop in others even after five months of infection. Peritoneal macrophages had an enhanced microbicidal capacity against T gondii from 14 days until five months after infection. Peroral administration of the Me49 strain of T gondii was lethal for Beige-C57BL/6J and C57BL/6J mice; these strains of mice showed the most extensive changes, necrosis, thrombi, and many trophozoites in tissues.

Animals↗

PubMed2005

Prevalence of Toxoplasma gondii infection and incidence of toxoplasma encephalitis in non-haemophiliac HIV-1-infected adults in Taiwan.

We assessed the seroprevalence of Toxoplasma gondii infection and incidence of toxoplasma encephalitis (TE) in 844 non-haemophiliac HIV-infected patients in Taiwan between June 1994 and April 2003. Approximately 70% (69.3%) of them had a baseline CD4+ lymphocyte count of 200 x 10(6)/L or less, and more than 70% (73.9%) having initiated highly active antiretroviral therapy. The seroprevalence of T. gondii infection was 10.2%, which did not differ with sex,age,route of transmission, birth inside or outside of Taiwan, or CD4+ lymphocyte stratifications. After a median observation duration of 603 days (range, 1-3264 days), 10 (1.2%) patients developed 11 episodes of TE after a median interval of 30 days (range, 1-941 days) between enrolment and diagnosis of TE, with an incidence of 0.59 per 100 person-years (PY) (95% confidence interval, 0.56-0.63 per 100 PY). We concluded that the incidence of TE of HIV-infected patients in Taiwan was lower than that reported in western countries because of a lower seroprevalence of T. gondii infection and use of antimicrobial prophylaxis and antiretroviral therapy, although most of the patients were at the late stage of HIV infection.

Adolescent↗

PubMed2005

Transmission of Toxoplasma: clues from the study of sea otters as sentinels of Toxoplasma gondii flow into the marine environment.

Toxoplasma gondii affects a wide variety of hosts including threatened southern sea otters (Enhydra lutris nereis) which serve as sentinels for the detection of the parasite's transmission into marine ecosystems. Toxoplasmosis is a major cause of mortality and contributor to the slow rate of population recovery for southern sea otters in California. An updated seroprevalence analysis showed that 52% of 305 freshly dead, beachcast sea otters and 38% of 257 live sea otters sampled along the California coast from 1998 to 2004 were infected with T. gondii. Areas with high T. gondii exposure were predominantly sandy bays near urban centres with freshwater runoff. Genotypic characterisation of 15 new T. gondii isolates obtained from otters in 2004 identified only X alleles at B1 and SAG1. A total of 38/50 or 72% of all otter isolates so far examined have been infected with a Type X strain. Type X isolates were also obtained from a Pacific harbor seal (Phoca vitulina) and California sea lion (Zalophus californianus). Molecular analysis using the C8 RAPD marker showed that the X isolates were more genetically heterogeneous than archetypal Type I, II and III genotypes of T. gondii. The origin and transmission of the Type X T. gondii genotype are not yet clear. Sea otters do not prey on known intermediate hosts for T. gondii and vertical transmission appears to play a minor role in maintaining infection in the populations. Therefore, the most likely source of infection is by infectious, environmentally resistant oocysts that are shed in the feces of felids and transported via freshwater runoff into the marine ecosystem. As nearshore predators, otters serve as sentinels of protozoal pathogen flow into the marine environment since they share the same environment and consume some of the same foods as humans. Investigation into the processes promoting T. gondii infections in sea otters will provide a better understanding of terrestrial parasite flow and the emergence of disease at the interface between wildlife, domestic animals and humans.

Animals↗

PubMed1989

Comparison of different serotests for specific Toxoplasma IgM-antibodies (ISAGA, SPIHA, IFAT) and detection of circulating antigen in two cases of laboratory acquired Toxoplasma infection.

Two symptomatic Toxoplasma infections of laboratory personnel have been serologically followed up for 5.5 and 10 months, respectively. Results obtained by commonly used test systems (indirect fluorescent antibody tests for IgG and IgM antibodies, complement fixation test) were compared with those of two recently developed and improved tests for IgM detection (immunosorbent agglutination assay [ISAGA] and solid-phase indirect haemadsorption assay [SPIHA] as well as with those of a test designed for the detection of circulating antigen (cag-ELISA).

Adult↗

PubMed2004

Early detection of Toxoplasma infection by molecular monitoring of Toxoplasma gondii in peripheral blood samples after allogeneic stem cell transplantation.

BACKGROUND: Isolated case reports have shown that recipients of allogeneic hematopoietic stem cell transplants (HSCTs) who develop toxoplasmosis may have circulating Toxoplasma gondii DNA in peripheral blood before the onset of clinical symptoms. METHODS: We prospectively studied 106 T. gondii-seropositive adult recipients of HSCTs for the incidence of reactivation of toxoplasmosis in the first 6 months after transplantation. Toxoplasmosis infection (TI) was defined by a positive result of polymerase chain reaction (PCR) of peripheral blood specimens, whereas toxoplasmosis disease (TD) was defined as an invasive infection. RESULTS: The incidence of TI was 16% (95% confidence interval [CI], 8%-21%), whereas the incidence of TD was 6% (95% CI, 1%-10%). In the 16 patients with TI, the incidence of disease was 38%, whereas it was 0% in patients without TI (P<.0001). In most patients, the onset of TD or treatment for TI was preceded by an increase in the parasite load in peripheral blood samples, as determined by quantitative PCR. CONCLUSIONS: Toxoplasmosis occurs more commonly after HSCT than has previously been suggested, and routine PCR testing of peripheral blood specimens may be an appropriate tool for guiding preemptive therapy in patients at very high risk of developing invasive disease.

Adult↗

PubMed1996

Recombinant Toxoplasma gondii surface antigen 1 (P30) expressed in Escherichia coli is recognized by human Toxoplasma-specific immunoglobulin M (IgM) and IgG antibodies.

The immunodominant surface antigen of Toxoplasma gondii, surface antigen 1 (SAG1), was expressed in Escherichia coli as a fusion protein containing a majority of the SAG1 protein supplied with six histidyl residues in the N-terminal end. The recombinant protein was purified on a Ni-chelate column and then on a fast-performance liquid chromatography column and was in a nonreduced condition. It was recognized by T. gondii-specific human immunoglobulin G (IgG) and IgM antibodies as well as by a mouse monoclonal antibody (S13) recognizing only nonreduced native SAG1. Antibodies induced in mice by the recombinant SAG1 recognized native SAG1 from the T. gondii RH isolate in culture. Recombinant SAG1 is suitable for use in diagnostic systems for detecting anti-SAG1-specific IgG and IgM antibodies.

Animals↗