SEARCH · PubMed Health

Results for “ASCOMYCETES”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 541 records · Page 30Linked to original sources

PubMed2000

Nutrition and phylogeny of predacious yeasts.

Yeast predation was studied with respect to the range of its distribution among ascomycetous yeasts, the range of yeast species that can be affected, and nutritional aspects of the phenomenon. The yeasts identified as predators belong to the Saccharomycopsis clade as defined on the basis of rDNA sequence relatedness. The 11 recognized species in the clade, plus three undescribed but related Candida species, were shown to be incapable of utilizing sulfate as sole source of sulfur, and all but two (Saccharomycopsis capsularis and Saccharomycopsis vini) were observed to penetrate and kill other yeasts under some conditions. Other unrelated sulfate transport-deficient yeasts (strains in the genera Pichia and Candida and the two known species of Starmera) are not predacious. The predacious species vary considerably as to the optimal environmental conditions that favour predation. Some are inhibited by the presence of rich nitrogenous nutrients, organic sulfur compounds, or higher concentrations of ammonium nitrogen, whereas other species may be stimulated under the same conditions. An attempt was made to correlate prey susceptibility to the excretion of substances that stimulate the growth of predators, but no correlation was detected between the two phenomena. The range of susceptible prey covers both ascomycetes and basidiomycetes, and includes Schizosaccharomyces pombe, which was previously thought to be immune. The achlorophyllous alga Prototheca zopfii is not killed by predacious yeasts, but the initial steps of penetration have been observed in some cases. Predacious species attack other predacious species, and in some cases, young cultures may penetrate older cultures of the same strain.

Culture Media↗

PubMed2001

Endophytic fungi from Amomum siamense.

Endophytic fungi were isolated from apparently healthy organs of the wild ginger Amomum siamense Criab.. including leaves, pseudostems, and rhizomes, collected from two sites in Doi Suthep-Pui National Park, Thailand. Endophytes were relatively common with an isolate prevalence of 70%-83% at the two sites sampled in the wet and dry seasons. The endophyte assemblages from the two sites were diverse and comprised 7 Ascomycetes and 26 mitosporic fungi. Colletotrichum "gloeosporioides" (Penz.) Penz. & Sacc. in Penz., Glomerella spp., xylariaceous fungi, and Phomopsis spp. were consistently dominant as endophytes on Amomum siamense, but many rare species and mycelia sterilia were also recorded. There was no significant difference between the number of isolates recovered from leaves containing vein tissues and those containing intervein tissues, independent of leaf age. Most taxa showed a preference for either leaf tissue or pseudostems. Two new Ascomycetes species. Gaeumannomyces amomi and Leiosphaerella amomi, were discovered from leaves and rhizomes, respectively, and four species of Pyricularia, including three new species, were isolated from leaves.

Fungi↗

PubMed1998

Application of mating type gene technology to problems in fungal biology.

In ascomycetes, the single mating type locus (MAT) controls sexual development. This locus is structurally unusual because the two alternate forms ("alleles") are completely dissimilar sequences, encoding different transcription factors, yet they occupy the same chromosomal position. Recently developed procedures allow efficient cloning of MAT genes from a wide array of filamentous ascomycetes, thereby providing MAT-based technology for application to several ongoing issues in fungal biology. This article first outlines the basic nature of MAT genes, then addresses the following topics: efficient cloning of MAT genes; the unusual molecular characteristics of these genes; phylogenetics using MAT; the issues of why some fungi are self-sterile, others self-fertile, and yet others asexual; the long-standing mystery of possible mating type switching in filamentous fungi; and finally the evolutionary origins of pathogenic capability.

Journal Article↗

PubMed2006

Multiple, non-allelic, intein-coding sequences in eukaryotic RNA polymerase genes.

BACKGROUND: Inteins are self-splicing protein elements. They are translated as inserts within host proteins that excise themselves and ligate the flanking portions of the host protein (exteins) with a peptide bond. They are encoded as in-frame insertions within the genes for the host proteins. Inteins are found in all three domains of life and in viruses, but have a very sporadic distribution. Only a small number of intein coding sequences have been identified in eukaryotic nuclear genes, and all of these are from ascomycete or basidiomycete fungi. RESULTS: We identified seven intein coding sequences within nuclear genes coding for the second largest subunits of RNA polymerase. These sequences were found in diverse eukaryotes: one is in the second largest subunit of RNA polymerase I (RPA2) from the ascomycete fungus Phaeosphaeria nodorum, one is in the RNA polymerase III (RPC2) of the slime mould Dictyostelium discoideum and four intein coding sequences are in RNA polymerase II genes (RPB2), one each from the green alga Chlamydomonas reinhardtii, the zygomycete fungus Spiromyces aspiralis and the chytrid fungi Batrachochytrium dendrobatidis and Coelomomyces stegomyiae. The remaining intein coding sequence is in a viral relic embedded within the genome of the oomycete Phytophthora ramorum. The Chlamydomonas and Dictyostelium inteins are the first nuclear-encoded inteins found outside of the fungi. These new inteins represent a unique dataset: they are found in homologous proteins that form a paralogous group. Although these paralogues diverged early in eukaryotic evolution, their sequences can be aligned over most of their length. The inteins are inserted at multiple distinct sites, each of which corresponds to a highly conserved region of RNA polymerase. This dataset supports earlier work suggesting that inteins preferentially occur in highly conserved regions of their host proteins. CONCLUSION: The identification of these new inteins increases the known host range of intein sequences in eukaryotes, and provides fresh insights into their origins and evolution. We conclude that inteins are ancient eukaryote elements once found widely among microbial eukaryotes. They persist as rarities in the genomes of a sporadic array of microorganisms, occupying highly conserved sites in diverse proteins.

Alleles↗

PubMed2026

A subcomplex comprising TRAPPC11, TRAPPC12, TRAPPC13 and the fungal TRAPPC2L homolog, Tca17, directs TRAPPIII to autophagy.

Transport protein particle complexes (TRAPPs) are master regulators of membrane trafficking. TRAPPs are targeted to different locales by pathway-specific subunits decorating a core hetero-heptamer to build TRAPPII (Golgi exit) and TRAPPIII (autophagosomes and ER-Golgi trafficking). Metazoan and Arabidopsis TRAPPIII have three components, TRAPPC11, TRAPPC12 and TRAPPC13 (hereafter denoted TRAPPC11/12/13), that are absent from budding yeast. We studied TRAPPC11/12/13 in the related ascomycete Aspergillus nidulans, where TRAPPC11 and TRAPPC12 localize to pre-autophagosomes and their ablation impairs autophagy. We found that two stable subcomplexes containing Tca17, the homolog of metazoan TRAPPC2L, coexist - one includes the TRAPPII-specific subunits Trs120, Trs130 and Trs65 whereas the other contains the TRAPPIII-specific subunits TRAPPC11/12/13. Both are recruited to core TRAPP by Tca17, which therefore plays a crucial role by determining the physiological role of TRAPP. TRAPPIII also exists in two versions, TRAPPIIIa and TRAPPIIIb, both of which contain Trs85, the homolog of metazoan TRAPPC8, but with only TRAPPIIIb containing TRAPPC11/12/13, which target TRAPPIII to autophagy. This study might help characterize potentially pathogenic mutations affecting human TRAPPC11/12/13, facilitating assessment of their functional consequences in a genetically amenable ascomycete.

Autophagy↗

PubMed2006

Hybrid E. coli--Mitochondrial ribonuclease P RNAs are catalytically active.

RNase P is a ribonucleoprotein that cleaves tRNA precursors at their 5'-end. Mitochondrion-encoded RNA subunits of mitochondrial RNase P (mtP-RNA) have been identified in jakobid flagellates such as Reclinomonas americana, in the prasinophyte alga Nephroselmis olivacea, and in several ascomycete and zygomycete fungi. While the structures of ascomycete mtP-RNAs are highly reduced, those of jakobids, prasinophytes, and zygomycetes retain most conserved features of their bacterial counterparts. Therefore, these mtP-RNAs might be active in vitro in the absence of a protein subunit, as are bacterial P-RNAs. Here we present a comparative structural analysis including seven newly characterized jakobid mtP-RNAs. We investigate ribozyme activities of mtP-RNAs and find that even the most bacteria-like molecules of jakobids are inactive in vitro. However, when certain domains of jakobid and N. olivacea mtP-RNAs are replaced with those from Escherichia coli, these hybrid RNAs show catalytic activity. In vitro mutagenesis of these hybrid mtP-RNAs shows that various structural elements play a critical role in ribozyme catalysis and provide further support for the presence of these elements in mtP-RNAs. These include GNRA tetraloops in helix P14 and P18 of Jakoba libera, and a remnant P3 pairing in Seculamonas ecuadoriensis. Finally, we will discuss reasons for the failure of mtP-RNAs to show catalytic activity in the absence of P-proteins based on our mutagenesis analysis.

Chimera↗

PubMed2006

Cellobiose dehydrogenase--a flavocytochrome from wood-degrading, phytopathogenic and saprotropic fungi.

Cellobiose dehydrogenase, the only currently known extracellular flavocytochrome, is formed not only by a number of wood-degrading but also by various phytopathogenic fungi. This inducible enzyme participates in early events of lignocellulose degradation, as investigated in several basidiomycete fungi at the transcriptional and translational level. However, its role in the ascomycete fungi is not yet obvious. Comprehensive sequence analysis of CDH-encoding genes and their translational products reveals significant sequence similarities along the entire sequences and also a common domain architecture. All known cellobiose dehydrogenases fall into two related subgroups. Class-I members are represented by sequences from basidiomycetes whereas class-II comprises longer, more complex sequences from ascomycete fungi. Cellobiose dehydrogenase is typically a monomeric protein consisting of two domains joined by a protease-sensitive linker region. Each larger (dehydrogenase) domain is flavin-associated while the smaller (cytochrome) domains are haem-binding. The latter shorter domains are unique sequence motifs for all currently known flavocytochromes. Each cytochrome domain of CDH can bind a single haem b as prosthetic group. The larger dehydrogenase domain belongs to the glucose-methanol-choline (GMC) oxidoreductase superfamily - a widespread flavoprotein evolutionary line. The larger domains can be further divided into a flavin-binding subdomain and a substrate-binding subdomain. In addition, the class-II (but not class-I) proteins can possess a short cellulose-binding module of type 1 at their C-termini. All the cellobiose dehydrogenases oxidise cellobiose, cellodextrins, and lactose to the corresponding lactones using a wide spectrum of different electron acceptors. Their flexible specificity serves as a base for the development of possible biotechnological applications.

Amino Acid Sequence↗

PubMed1999

A phylogenetic study on galactose-containing Candida species based on 18S ribosomal DNA sequences.

Phylogenetic relationships of 33 Candida species containing galactose in the cells were investigated by using 18S ribosomal DNA sequence analysis. Galactose-containing Candida species and galactose-containing species from nine ascomycetous genera were a heterogeneous assemblage. They were divided into three clusters (II, III, and IV) which were phylogenetically distant from cluster I, comprising 9 galactose-lacking Candida species, C. glabrata, C. holmii, C. krusei, C. tropicalis (the type species of Candida), C. albicans, C. viswanathii, C. maltosa, C. parapsilosis, C. guilliermondii, and C. lusitaniae, and 17 related ascomycetous yeasts. These three clusters were also phylogenetically distant from Schizosaccharomyces pombe, which contains galactomannan in its cell wall. Cluster II comprised C. magnoliae, C. vaccinii, C. apis, C. gropengiesseri, C. etchellsii, C. floricola, C. lactiscondensi, Wickerhamiella domercqiae, C. versatilis, C. azyma, C. vanderwaltii, C. pararugosa, C. sorbophila, C. spandovensis, C. galacta, C. ingens, C. incommunis, Yarrowia lipolytica, Galactomyces geotrichum, and Dipodascus albidus. Cluster III comprised C. tepae, C. antillancae and its synonym C. bondarzewiae, C. ancudensis, C. petrohuensis, C. santjacobensis, C. ciferrii (anamorph of Stephanoascus ciferrii), Arxula terrestris, C. castrensis, C. valdiviana, C. paludigena, C. blankii, C. salmanticensis, C. auringiensis, C. bertae, and its synonym C. bertae var. chiloensis, C. edax (anamorph of Stephanoascus smithiae), Arxula adeninivorans, and C. steatolytica (synonym of Zygoascus hellenicus). Cluster IV comprised C. cantarellii, C. vinaria, Dipodascopsis uninucleata, and Lipomyces lipofer. Two galactose-lacking and Q-8-forming species, C. stellata and Pichia pastoris, and 5 galactose-lacking and Q-9-forming species, C. apicola, C. bombi, C. bombicola, C. geochares, and C. insectalens, were included in Cluster II. Two galactose-lacking and Q-9-forming species, C. drimydis and C. chiropterorum, were included in Cluster III.

Journal Article↗

PubMed1999

A phylogenetic study of ubiquinone Q-8 species of the genera Candida, Pichia, and Citeromyces based on 18S ribosomal DNA sequence divergence.

To clarify phylogenetic relationships among species of the anamorphic ascomycetous genus Candida with ubiquinone Q-8, we determined complete sequences of 18S ribosomal RNA genes (18S rDNAs) from the type strains of 20 species of the genus Candida and 7 of the teleomorphic ascomycetous genera Pichia and Citeromyces, which have Q-8 as the major ubiquinone. Q-8-forming Candida species were divided into six clusters and were phylogenetically distant from a group of Candida species that included the type species of the genus. One Q-8-forming species from each of the genera Pichia, Citeromyces, or Clavispora was included in five of six clusters. Cluster 1 comprised C. ishiwadae, C. ernobii, C. karawaiewii, C. anatomiae, C. populi, and Pichia holstii. Cluster 2 comprised C. globosa and its teleomorph, Citeromyces matritensis. Cluster 3 comprised C. molischiana and Pichia capsulata. Cluster 4 comprised C. silvanorum, C. sequanensis, C. fennica, C. entomophila, C. homilentoma, C. rhagii, C. gotoi, and Pichia burtonii. Cluster 5 comprised C. fructus, C. musae, and C. lusitaniae (anamorph of Clavispora lusitaniae). Cluster 6 comprised C. stellata, C. lactiscondensi, C. galacta, and C. incommunis and was a heterogeneous group with large interspecific divergence. Pichia pastoris was quite divergent and phylogenetically distant from other Pichia species examined. Pichia methanolica and its synonym, P. cellobiosa, which have both Q-7 and Q-8 as major ubiquinones, were closely associated with Q-7-forming Williopsis salicorniae. Based on this comparative analysis of 18S rDNA sequences, it is evident that Q-8 Candida species and Q-8 Pichia species are polyphyletic.

Journal Article↗

PubMedDate not supplied

Can rDNA analyses of diverse fungal communities in soil and roots detect effects of environmental manipulations--a case study from tallgrass prairie.

We tested whether fungal communities are impacted by nitrogen deposition or increased precipitation by PCR-amplifying partial fungal rRNA genes from 24 soil and 24 root samples from a nitrogen enrichment and irrigation experiment in a tallgrass prairie at Konza Prairie Biological Station in northeastern Kansas, U.S.A. Obtained fungal sequences represented great fungal diversity that was distributed mainly in ascomycetes and basiodiomycetes; only a few zygomycetes and glomeromycetes were detected. Conservative extrapolated estimates of the fungal species richness suggest that the true richness may be at least twice as high as observed. The effects of nitrogen enrichment or irrigation on fungal community composition, diversity or clone richness could not be unambiguously assessed because of the overwhelming diversity. However, soil communities differed from root communities in diversity, richness and composition. The compositional differences were largely attributable to an abundant, soil-inhabiting group placed as a well-supported sister group to other ascomycetes. This group likely represents a novel group of fungi. We conclude that the great fungal richness in this ecosystem precluded a reliable assessment of anthropogenic impacts on soil or rhizosphere communities using the applied sampling scheme, and that detection of novel fungi in soil may be more a rule than an exception.

Ascomycota↗

PubMedDate not supplied

Molecular characterization of airborne fungal spores in boreal forests of contrasting human disturbance.

In this study we present a new approach to characterize fungal diversity with DNA sequencing of mycelium grown from trapped airborne spores. Fungal spores were extracted systematically from air in three boreal forest sites (clear-cut, young and old-growth forests) using an air sampling device. Internal transcribed spacer (ITS) sequences from the nuclear ribosomal DNA (nrDNA) were generated, and the sequences most likely taxon affinities were established through DNA homology searches. Phylogenetic analyses were used to classify similar sequences into operational taxonomic units (OTUs). The analyses indicated that a total of 84 different OTUs had been sampled, 24 basidiomycetes and 60 ascomycetes. OTUs belonging to the ascomycete orders Helotiales and Pleosporales were most frequent (31 and 18 respectively). A total of 54, 29 and 33 OTUs were sampled, respectively, in the old-growth, young and clear-cut forest sites. Although heavy generalization should be avoided due to few replicates, the results could indicate that old-growth boreal forests have significantly higher airborne fungal species richness than recently managed forests. The study shows that the spore-trapping approach has a great potential for targeting and studying anonymous fungi.

Air Microbiology↗

PubMedDate not supplied

Fungal decomposition of Abies needle and Betula leaf litter.

The effect of litter type and incubation temperature on the ability of fungi to decompose leaf litter of subalpine trees was examined by a pure-culture test. Mass loss of Abies needle and Betula leaf litter and utilization patterns of lignin and carbohydrates were investigated under two temperature conditions (20 C and 10 C) and compared for 29 species in basidiomycetes, ascomycetes and zygomycetes. The decomposing ability was generally higher in basidiomycetes than in ascomycetes and zygomycetes. Mass loss (% original mass) of litter was higher in Betula than in Abies and higher at 20 C than at 10 C. The 29 fungi were divided into lignocellulose decomposers, cellulose decomposers and sugar fungi based on their substrate utilization in Abies and Betula litter. Mass loss of lignin and carbohydrates by lignocellulose and cellulose decomposers was higher in Betula than in Abies. Mass loss of carbohydrates was higher at 20 C than at 10 C, but the temperature did not influence mass loss of lignin, indicating lignin decomposition by fungi was less sensitive to temperature than carbohydrate decomposition. Lignin/carbohydrate loss ratio (L/C) of Collybia spp. that caused selective delignification was lower at 20 C than at 10 C. These results indicate that the decomposability of litter, lignin and carbohydrate was different between Abies and Betula and that temperature affected not only the rate at which fungi decompose litter but also the ability of fungi to use lignin and carbohydrates.

Abies↗

PubMedDate not supplied

[On the problem og higher fungi origin: Florideae hypothesis].

The history and current state of the hypothesis of the origin of higher fungi (Ascomycetes and Basidiomycetes) and red algae from the common ancestor (Florideae) were analysed. Initially the hypothesis was based on similarity of their vegetative and generative structures (Sachs, 1874; Dodge, 1914; Chadefaund, 1953, 1972, etc.), but later it was confirmed by ultrastructural data (Demoulin, 1974; Kohlmeyer, 1975). It appears to be very useful for the study of the development of terrestrial flora (Church, 1921; Kohlemeyer, Kohlmeyer, 1979; Atsatt, 1988) and regularities in morphological evolution of higher fungi (Corner, 1964, 1970; Chadefaud, 1960, 1982, 1984). Description of the order Spathulosporales (Kohlmeyer, 1973), combining the characters of Ascomycetes and parasitic Florideae, was one of the most important fact leading to the wide recognition of the hypothesis in 1970-80s (Cavalier-Smith, 1978; Taylor, 1978; Dodge, 1980; Hawksworth, 1982; Goff, 1983; Coff, Coleman, 1985). Today, however, Florideae hypothesis is not confirmed by molecular data and replaced by alternative hypothesis of Eumycota origin. Summarizing data on molecular systematic of fungi, one could affirm with confidence: 1). Chitincontaining fungi are closer to multicellular animals and green plants than to Rhodophyta; 2). Rhodophyta and Chlorophyta are monophyletic group; 3). There is no single-valued molecular data on taxonomic distance between higher fungi, Chytridiomycetes; Rhodophyta, Chlorophyta and Metazoa. Thus, the current data could not testify against Florideae hypothesis. It is possible to adjust them with the idea of B.M. Kozo-Polyansky (1927) about existence of "Chloroflorodeae" group that is original for terrestrial flora; the hypothesis about closeness of Chlorophyta and Rhodophyta, as well as Chlorophyta and Eumycota, does not contradict molecular data (Stiller, Hall, 1997). The author believes that we need molecular study of the whole "stem" of chlorobionta, especially groups that are close to its basis. It will will help to understand the relationships between Rhodophyta, giant conglomeration of "green algae", chitin-containing fungi, Prasinophyceae and different groups of zoomastigot with maximal resolution--the level of orders or groups of orders. Only such investigation could provide the material for molecular support of phylogenetic constructions. Up to moment Florideae hypothesis is able to exist together with the other ideas.

Ascomycota↗

PubMedDate not supplied

[Yeast biodiversity in hydromorphic soils with reference to grass-Sphagnum swamp in Western Siberia and the hammocky tundra region( Barrow, Alaska)].

The microbiological analysis of 78 samples taken from a boreal bog in Western Siberia and from a tundra wetland soil in Alaska showed the presence of 23 yeast species belonging to the genera Bullera, Candida, Cryptococcus, Debaryomyces, Hanseniaspora, Metschnikowia, Mrakia, Pichia, Rhodotorula, Saccharomyces, Sporobolomyces, Torulaspora, and Trichosporon. Peat samples from the boreal bog were dominated by eurytopic anamorphic basidiomycetous species, such as Rhodotorula mucilaginosa and Sporobolomyces roseus, and by the ascomycetous yeasts Candida spp. and Debaryomyces hansenii. These samples also contained two rare ascomycetous species (Candida paludigena and Schizoblastosporion starkeyi-henricii), which so far have been found only in taiga wetland soils. The wetland Alaskan soil was dominated by one yeast species (Cryptococcus gilvescens), which is a typical inhabitant of tundra soils. Therefore, geographic factors may serve for a more reliable prediction of yeast diversity in soils than the physicochemical or ecotopic parameters of these soils.

Alaska↗

PubMedDate not supplied

[Selenium tolerance of yeasts].

Selenium tolerance of yeasts widely varies: the growth of some yeasts can be inhibited by a selenium concentration as low as 10(-4) M, whereas others can grow in the presence of 10(-1) M selenium. Homogeneous yeast taxa are characterized by a certain level of selenium tolerance, and heterogeneous taxa show a variable level of tolerance to selenium. In general, ascomycetous yeasts are more tolerant to selenium than basidiomycetous yeasts. Among the ascomycetous yeasts, the genera Dekkera and Schizosaccharomyces exhibited the lowest and the species Candida maltosa, Hanseniaspora valbyensis, Kluyveromyces marxianus, and Yarrowia lipolytica the highest tolerance to selenium. Among the basidiomycetous yeasts, the genera Bullera, Cryptococcus, and Holtermannia showed the lowest and the species Cryptococcus curvatus, Cr. humicola, and Trichosporon spp. the highest tolerance to selenium. The selenium tolerance of yeasts depends on the composition of the growth medium, in particular, on the presence of sulfate, sulfur-containing amino acids, and glutamine in the medium.

Adaptation, Physiological↗

PubMed2004

New, rare or remarkable microfungi in the Italian Alps (Carnic Alps)--part I--ascomycotina.

During our observations in the SE part of the Carnic Alps in the year 2003 we were able to collect and identify 35 ascomycetes on trees and dead wood. Among these one can find numerous ascomycetes of different orders e.g. Pyrenomycetes, Loculoascomycetes and Discomycetes. Some species like Botryosphaeria ribis GROSENLUCHER & DUGGAR on Ribes alpinum L., Dothiora pyrenophora (FR.) FR. on Sorbus aucuparia L., Gemmamyces piceae (BORTH.) CASAGO. on Picea excelsa (LAM.) LINK, Glomerella montana (SACC.) v. ARX & E. MULLER on Sesleria caerulea (L.) ARD, Hymenoscyphus immutabilis (Fuck.) Dennis on Alnus incana (L.) Moench, Hysterographium fraxini (PERS. Ex. FR.) de Not. on Fraxinus ornus L., Lachnellula willkommii (Hartig) DENNIS [= Trichascyphella willkommii (Hartig) NANNF.] on Larix decidua MILL.,Leptosphaeria lycopodina (Mont.) SACC. on Lycopodium annotinum L., Mollisia adenostylidis REHM. on Adenostyles glabra (MILL.) DC., Pezicula cinnamomea (DC.)SACC. [ana: Cryptosporiopsis quercina PETRAK] on Quercus robur L., Pyrenopeziza petiolaris (A. & S. Ex FR.) NANNF. on Acer pseudoplatanus L., Tapesia rosae (PERS.) FUCKEL on Rosa canina L., are new for this area. All specimen are deposited in the Herbarium ESS Mycotheca Parva, Collection G.B. Feige/N. Ale-Agha.

Altitude↗

PubMed1989

Comparative spectral analysis of mammalian, fungal, and bacterial catalases. Resonance Raman evidence for iron-tyrosinate coordination.

Resonance Raman spectra are reported for catalases from bovine liver, the ascomycete fungus Aspergillus niger, and the bacterium Micrococcus luteus. The vibrational frequencies of the oxidation-, spin-, and coordination number-sensitive spectral bands are indicative of high spin pentacoordinate hemes in the resting ferric enzymes of each of these organisms. This result is in accord with the crystal structure of bovine catalase (Fita, I., and Rossmann, M.G. (1985) J. Mol. Biol. 185, 21-37). In contrast, the crystallographic study of catalase from the ascomycete Penicillium vitale (Vainshtein, B. K., Melik-Adamyan, W. R., Barynin, V. V., Vagin, A.A., Grebenko, A. I., Borisov, V. V., Bartels, K. S., Fita, I., and Rossmann, M. G. (1986) J. Mol. Biol. 188, 49-61) showed electron density on the distal side of the heme which could imply the presence of a sixth ligand, possibly a water molecule. However, both of these crystallographic studies showed the proximal ligand in catalase to be a tyrosine. The present study confirms tyrosinate coordination in each of the three catalases from the appearance of selected resonance-enhanced tyrosine vibrational modes. The most characteristic band is the tyrosinate ring mode at approximately 1612 cm-1 which is maximally enhanced with 488.0 nm excitation. The appearance of tyrosinate modes at 1607 and 1245 cm-1 in the resonance Raman spectra of M. luteus cyano catalase serves to identify tyrosine as an axial ligand in bacterial as well as eukaryotic catalases. Unlike non-heme iron tyrosinate proteins, whose resonance Raman spectra are dominated by several intense bands diagnostic of tyrosine ligation, the heme-linked tyrosine modes are not easily distinguished from the large number of porphyrin vibrations.

Animals↗

PubMed1982

On the phylogeny of Phycomyces blakesleeanus. Nucleotide sequence of 5 S ribosomal RNA.

The nucleotide sequence of the major 5 S ribosomal RNA from the lower fungus Phycomyces blakesleeanus has been determined. The sequence is 5' AAUCUACGGCCAUACAGAUAGUAACACACCGGAUCCCGUCUGAUCUCCGCAGUUAAGUCUCUCCUGGUAGCGUCAGUAC UAUGGUGGGGGACCACAUGGGAAUACGCUAUGUCGUAGGUU3'OH. The Phycomyces 5 S RNA sequence has invariant nucleotide positions characteristic of other eukaryotic 5 S RNAs and fits currently proposed secondary structural models. The Phycomyces of 5 S RNA shows relatively low overall sequence homology to the higher fungal (Ascomycetes) 5 S RNAs (56-60%) but shows higher sequence homology to those 5 S RNAs from Tetrahymena thermophila (68%), human KB cells (67%), and Spinacia oleracea (62%). A comparison of individual segments of the RNA also shows that the structure of Phycomyces 5 S RNA has several major differences from structures common to the higher fungi. Positions 2-14 are homologous with those of metazoan and some protozoan 5 S RNAs. At positions 30-45, the RNA sequence is closer to metazoan 5 S RNAs than to the Neurospora of Aspergillus 5 S RNAs. The Phycomyces 5 S RNA shares similar sequences with both Aspergillus and Tetrahymena 5 S RNAs at positions 79-99. Several other important homologies in primary and proposed secondary structures also have been observed in comparing Phycomyces 5 S RNA with animal and plant 5 S RNAs. We conclude that Phycomyces may not be as closely related phylogenetically to the Ascomycetes as previously thought.

Base Sequence↗