PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Genetic Variation”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 541 records · Page 30Linked to original sources
PubMed2006

Genetic variation in the zebrafish.

Although zebrafish was introduced as a laboratory model organism several decades ago and now serves as a primary model for developmental biology, there is only limited data on its genetic variation. An establishment of a dense polymorphism map becomes a requirement for effective linkage analysis and cloning approaches in zebrafish. By comparing ESTs to whole-genome shotgun data, we predicted >50,000 high-quality candidate SNPs covering the zebrafish genome with average resolution of 41 kbp. We experimentally validated approximately 65% of a randomly sampled subset by genotyping 16 samples from seven commonly used zebrafish strains. The analysis reveals very high nucleotide diversity between zebrafish isolates. Even with the limited number of samples that we genotyped, zebrafish isolates revealed considerable interstrain variation, ranging from 7% (inbred) to 37% (wild-derived) of polymorphic sites being heterozygous. The increased proportion of polymorphic over monomorphic sites results in five times more frequent observation of a three allelic variant compared with human or mouse. Phylogenetic analysis shows that comparisons between even the least divergent strains used in our analysis may provide one informative marker approximately every 500 nucleotides. Furthermore, the number of haplotypes per locus is relatively large, reflecting independent establishment of the different lines from wild isolates. Finally, our results suggest the presence of prominent C-to-U and A-to-I RNA editing events in zebrafish. Overall, the levels and organization of genetic variation between and within commonly used zebrafish strains are markedly different from other laboratory model organisms, which may affect experimental design and interpretation.

Animals↗
PubMed2001

Genetic variations in the cholesteryl ester transfer protein gene and high density lipoprotein cholesterol levels in Taiwanese Chinese.

This study analyzed the association of the I14A mutation, the D442G mutation, and the TaqIB polymorphism of the cholesteryl ester transfer protein (CETP) gene in 718 Chinese individuals with high-density lipoprotein cholesterol levels (HDL-C) living in Taiwan. The analysis revealed that the I14A mutation was not present in any of the 110 subjects with HDL-C levels above 60 mg/dl. By contrast, the D442G mutation was present in 48 of the 718 (6.7%) subjects tested. Significantly higher HDL-C levels were noted for bearers of the D442G mutation compared with non-bearers; however, this association was weaker for males and for subjects carrying the TaqIB1 allele. The TaqIB2 allele was also associated with higher HDL-C levels. From multivariate analysis, independent associations were demonstrated for the TaqIB2 polymorphism and the D442G mutation, and elevated HDL-C levels. For obese subjects, however, the presence of the TaqIB2 or D442G allele was not associated with increased HDL-C levels. For subjects with triglycerides at a concentration greater than 150 mg/dl, the association of both alleles with HDL-C levels was also diminished. Thus, genetic variation at the CETP gene locus may account for a significant proportion of the difference in HDL-C levels; however, it seems reasonable to suggest that the effects of the allele interact with genetic variations expressed within the sample population, and with sex, obesity, and plasma triglyceride levels.

Alleles↗
PubMed2006

Zinc Finger Protein 202, genetic variation, and HDL cholesterol in the general population.

Zinc Finger Protein 202 (ZNF202) is a transcriptional repressor that binds elements found predominantly in genes involved in HDL metabolism. We tested the following hypotheses: 1) frequencies of single-nucleotide polymorphisms (SNPs) and haplotypes in ZNF202 differ between individuals with low and high HDL cholesterol; and 2) SNPs in ZNF202 affect HDL cholesterol levels in the general population. We screened the promoter and protein-coding exons of ZNF202 in individuals with the highest 1% (n = 95) and lowest 1% (n = 95) HDL cholesterol among 9,259 Danish adults. None of the 10 SNPs identified differed in frequency as single sites or as haplotypes between low and high HDL cholesterol groups. In accordance with this, seven mutations were equally frequent (4-5%) in individuals with low or high HDL cholesterol. Finally, for all five SNPs identified in the coding region, we determined the association of genotype with HDL cholesterol in 9,259 individuals from the general population. Four SNPs were not associated with variation in HDL cholesterol, although c.*2T>G homozygosity was associated with a discrete effect on HDL cholesterol in men. We show that genetic variation in ZNF202 is common in the general population. However, SNPs in the protein-coding region of ZNF202 do not make a major contribution to HDL cholesterol levels.

Adult↗
PubMed2004

Influence of genetic variations of ethanol-metabolizing enzymes on phenotypes of alcohol-related disorders.

Alcohol dehydrogenase (ADH) and aldehyde dehydrogenase-2 (ALDH2) play central roles in the metabolism of ethanol and its metabolite, acetaldehyde, in the liver. In ADH2, one nucleotide replacement causes either a super-active beta 2 subunit encoded by the ADH2*2 allele or a less active beta 1 subunit (ADH2*1 allele). In the same way, a G/A replacement at codon 487 of the ALDH2 gene produces an inactive form of the enzyme. Because the geno-types of these genes may explain individual differences in concentration and elimination of ethanol and acetaldehyde in the blood after drinking, they could be used as models to elucidate the contribution of these substances to the development of addiction and various types of organ damage. We have examined the influence of genetic variations of these enzymes on alcohol-related disorders in the Japanese. The results revealed that (1) the less active allele of the ADH2 gene (ADH2*1) is associated with an increased risk for alcohol dependence, alcohol-induced persistent amnestic disorder, alcohol withdrawal syndrome, and cancer of the upper GI tract; (2) the inactive allele of the ALDH2 gene (ALDH2*2) is associated with a decreased risk for alcohol dependence, and an increased risk for alcoholic polyneuropathy and cancer in the same region; and (3) these genetic variations modify clinical features of alcohol dependence. Possible mechanisms of altered risk for these disorders are discussed.

Alcohol Dehydrogenase↗
PubMed2006

[Analysis of genetic variation of abalone (Haliotis discus hannai) populations with microsatellite markers].

Microsatellite markers were used to access the genetic variation in three populations of abalone Haliotis discus hannai. Two wild populations were collected from the sea areas in Changdao, Shandong and Dalian, Liaoning respectively. A cultivated population originated from the sea area in Kongdongdao, Shangdong. Six microsatellite loci were screened for genetic polymorphism. Polymorphic information content (PIC) value per loci was greater than 0.5 and can be used to analysis of genetic structure of the three abalone populations. Fifty-seven alleles were amplified from the three populations in six microsatellite loci. The average number of alleles (A) was 9.50 and the effective number of alleles (Ne) was 5.8572. The mean observed heterozygosity (Ho) and the mean expected heterozygosity (He) were 0.6925 and 0.7966, respectively. The Ho and He of two wild abalone populations were higher than that of cultured population. All these results provide a basis for conservation and utilization of genetic diversity of Haliotis discus hannai.

Animals↗
PubMed1998

The molecular basis of quantitative genetic variation in central and secondary metabolism in Arabidopsis.

To find the genes controlling quantitative variation, we need model systems where functional information on physiology, development, and gene regulation can guide evolutionary inferences. We mapped quantitative trait loci (QTLs) influencing quantitative levels of enzyme activity in primary and secondary metabolism in Arabidopsis. All 10 enzymes showed highly significant quantitative genetic variation. Strong positive genetic correlations were found among activity levels of 5 glycolytic enzymes, PGI, PGM, GPD, FBP, and G6P, suggesting that enzymes with closely related metabolic functions are coregulated. Significant QTLs were found influencing activity of most enzymes. Some enzyme activity QTLs mapped very close to known enzyme-encoding loci (e.g., hexokinase, PGI, and PGM). A hexokinase QTL is attributable to cis-acting regulatory variation at the AtHXK1 locus or a closely linked regulatory locus, rather than polypeptide sequence differences. We also found a QTL on chromosome IV that may be a joint regulator of GPD, PGI, and G6P activity. In addition, a QTL affecting PGM activity maps within 700 kb of the PGM-encoding locus. This QTL is predicted to alter starch biosynthesis by 3.4%, corresponding with theoretical models, suggesting that QTLs reflect pleiotropic effects of mutant alleles.

Analysis of Variance↗
PubMedDate not supplied

Genetic variation observed at two tetrameric short tandem repeat loci on chromosome 12 (D12S66 and D12S67) among five distinct ethnic groups of India: detection of two new alleles.

OBJECTIVE: The present investigation reports the genetic variation observed at two tetrameric short tandem repeat (STR) loci on chromosome 12 (D12S66 and D12S67) among five anthropologically distinct population groups of India. SUBJECTS AND METHODS: A total of 277 random, normal and healthy volunteers were investigated for the D12S66 locus, and 236 for the locus D12S67, from five ethnic groups of India. Two of these belong to the state of Maharashtra in western India (Konkanastha Brahmins and Marathas) and three from the state of Kerala in South India (Nairs, Ezhavas and Muslims). DNA was extracted from peripheral blood samples, amplified by duplex polymerase chain reaction (PCR) and electrophoresed on 6% denaturing urea (7 M) gel electrophoresis. The analysis was performed on ALF Express DNA sequencer (Amersham Pharmacia Biotech) using Fragment Manager software. Statistical analysis was done by using Arlequin ver. 1.1. RESULTS: At D12S66 locus, a total of nine alleles (8-17 repeats) and 27 genotypes were detected with an observed heterozygosity ranging from 0.55 to 0.91. At the D12S67 locus, nine alleles (36-44 repeats) and 33 genotypes were observed with a heterozygosity ranging from 0.74 to 0.89. Both the loci displayed high Power of Discrimination (PD) which ranged from 0.81 to 0.91 and Polymorphic Information Content (PIC) ranging from 0.68 to 0.84. At D12S66, two alleles were detected for the first time in these population groups which were not reported earlier. The level of gene differentiation (G(ST) value, 0.02) was moderate at these two loci, indicating a close relationship among the population groups. CONCLUSIONS: From this investigation, it is concluded that both the tetrameric loci are highly polymorphic and informative, and can be used for the characterization of the Indian population groups in addition to other well-studied STR loci.

Alleles↗
PubMed2003

Genetic variation and differentiation in the Japanese five-lined skink, Eumeces latiscutatus (Reptilia: Squamata).

The genetic variation in Eumeces latiscutatus from the main islands of Japan and the northern Ryukyus was investigated and compared with that of its close relatives (E. okadae and E. marginatus) using allozyme data. All three samples from the northern Tokara Island Group, currently identified as E. latiscutatus, were shown to belong to E. marginatus and not to E. latiscutatus. The non-monophyly of the northern Tokara samples and the great genetic differences within these samples may have resulted from colonization from more than one source population by northeastward overseas dispersal. The samples from the Izu Peninsula were genetically much closer to E. okadae than the other conspecific ones. This indicates that the samples from the Izu Peninsula and the other samples of E. latiscutatus should be treated as distinct species, and that E. latiscutatus from the Izu Peninsula and E. okadae from the Izu Island Group may be treated as conspecific. Samples from western Japan were genetically well differentiated from those of eastern Japan. Within the western group, the samples from the Osumi Island Group was genetically distinct from those from the other regions, by possessing unique alleles. Our phenograms also reveal a distant affinity between samples from the Danjo Island Group and the main islands of Japan. This may be the result of long geographic isolation of the Osumi and Danjo Island Groups from Kyushu. By contrast, samples from Sapporo and Aomori were poorly differentiated genetically in spite of the long separation of these two localities by the Tsugaru Strait. This suggests that overseas dispersal of E. latiscutatus occurred across this strait after its formation.

Animals↗
PubMed2002

Pathogen resistance and genetic variation at MHC loci.

Balancing selection in the form of heterozygote advantage, frequency-dependent selection, or selection that varies in time and/or space, has been proposed to explain the high variation at major histocompatibility complex (MHC) genes. Here the effect of variation of the presence and absence of pathogens over time on genetic variation at multiallelic loci is examined. In the basic model, resistance to each pathogen is conferred by a given allele, and this allele is assumed to be dominant. Given that s is the selective disadvantage for homozygotes (and heterozygotes) without the resistance allele and the proportion of generations, which a pathogen is present, is e, fitnesses for homozygotes become (1 - s)((n - 1)e) and the fitnesses for heterozygotes become (1 - s)((n - 2)e), where n is the number of alleles. In this situation, the conditions for a stable, multiallelic polymorphism are met even though there is no intrinsic heterozygote advantage. The distribution of allele frequencies and consequently heterozygosity are a function of the autocorrelation of the presence of the pathogen in subsequent generations. When there is a positive autocorrelation over generations, the observed heterozygosity is reduced. In addition, the effects of lower levels of selection and dominance and the influence of genetic drift were examined. These effects were compared to the observed heterozygosity for two MHC genes in several South American Indian samples. Overall, resistance conferred by specific alleles to temporally variable pathogens may contribute to the observed polymorphism at MHC genes and other similar host defense loci.

Alleles↗
PubMed2000

DNA imaging. Getting a feel for genetic variations.

A team of researchers has come up with a novel atomic imaging microscope that may dramatically speed the task of linking genetic variants to diseases. The microscope is a modification of the popular atomic force microscope (AFM), which uses an ultrasharp tip to map surfaces of everything from computer chips to DNA at the atomic level. By using this molecule-sized tip, the researchers were able get their AFM to march down a strand of DNA and identify uniquely shaped reporter molecules engineered to tag the genetic variations.

DNA↗
PubMed1992

Genetic variation among Malaysian isolates of Salmonella typhi as detected by ribosomal RNA gene restriction patterns.

Genetic variation among Malaysian isolates of Salmonella typhi was determined by analysis of ribosomal RNA gene restriction patterns. Of the 20 isolates analyzed, eight different pattern combinations were detected. The amount of variation observed was also dependent upon the restriction endonuclease used; PstI produced more different patterns than did SmaI. The results suggested that disease activity was due to a number of different clones circulating simultaneously rather than a single strain. Further implications of the data are discussed.

DNA, Ribosomal↗
PubMed1993

Heritabilities of growth curve parameters and age-specific expression of genetic variation under two different feeding regimes in Japanese quail (Coturnix coturnix japonica).

This study investigated genetic variation in growth and final size in relationship to differences in heritabilities under good and poor feeding conditions. Heritabilities of growth and final size were estimated for several traits under ad libitum and restricted feeding conditions. A 30% feed restriction from hatching to 44 days of age in Japanese quail chicks decreased body weight and tarsus length at 44 days of age and the length of the third primary convert feather at 24 days of age relative to controls fed ad libitum. Wing length at 44 days of age was not significantly different for ad libitum fed and restricted quail. Genetic variances for body weight and tarsus length were very large throughout growth which resulted in heritability estimates close to one for these traits. The genetic correlations among feeding treatments were low, indicating that different genes were affecting growth under the two treatments. Growth was described by the components: asymptote, growth period, and shape of the growth curve following the modified Richards growth curve model (Brisbin et al. 1986). Tarsus length, which had high heritability of the parameter 'growth period' of the model, tended to display a higher heritability under the restriction than under ad libitum feeding. Body weight and feather length, which had either no heritable or low heritable 'growth periods' estimates, tended to be more heritable under ad libitum feeding. The shape parameter of the growth curve was not heritable for any trait, except tarsus length under restricted feeding.

Age Factors↗
PubMed2003

Genetic variation and founder effects in the parasitoid wasp, Diaeretiella rapae (M'intosh) (Hymenoptera: Braconidae: Aphidiidae), affecting its potential as a biological control agent.

The effects of recent colonization on the aphid parasitoid, Diaeretiella rapae (M'Intosh) (Hymenoptera: Braconidae: Aphidiidae), in Western Australia were investigated. When compared with populations from the Old World, the results of a microsatellite analysis show that the insects have low allelic length and low allele frequency variation, revealing that these individuals experienced a significant founder effect. Marked genetic differentiation between populations was also revealed, which has potentially important implications for host utilization in this species when introduced to a new geographical area(s). Low genetic variation and gene flow in a founder population could limit evolutionary potential in Australia, including the ability of a population to mount a response to newly introduced hosts, such as the Russian wheat aphid, Diuraphis noxia (Mordvilko). Although the actual importance of genetic diversity in the success of biological control agents is unclear, current theory concerning the potential impact of genetic bottlenecks on additive genetic variance is discussed.

Animals↗
PubMed2006

Thirty novel genetic variations in the SLC29A1 gene encoding human equilibrative nucleoside transporter 1 (hENT1).

Thirty-nine genetic variations, including thirty novel ones, were found in the human SLC29A1 gene, which encodes equilibrative nucleoside transporter 1, from 256 Japanese cancer patients administered gemcitabine. The found novel variations included -8,166G>A, -81,10A>G, -7,947G>A, -7,789T>C, -5,595G>A, -3,803_-3,783delTCGGGGAGGTGGCAGTGGGCG, -3,548G>C, -3,414G>A, -1355T>C, -34C>G, IVS1+141G>A, IVS1+260C>T, IVS1-82C>T, 177C>G, IVS3-6C>T, 564C>T, IVS8+44T>C, IVS8+90T>C, IVS8+97T>C, IVS8+131C>T, IVS8+169G>A, 933T>C, 954C>T, IVS11-52G>C, IVS11-46G>A, 1,288G>A, 1,641C>G, 1,703_1,704delGT, 1812C>T, and 1861C>T. The frequencies were 0.051 for IVS8+169G>A, 0.012 for -7,947G>A, 0.006 for IVS1+141G>A and 1,703_1,704delGT, 0.004 for -8,166G>A, -8,110A>G, -3,548G>C, -1,355T>C, -34C>G, IVS8+44T>C, and 1,812C>T, and 0.002 for the other 19 variations. Among them, 177C>G and 1,288G>A resulted in amino acid substitutions Asp59Glu and Ala430Thr, respectively. Using the detected polymorphisms, linkage disequilibrium analysis was performed, and 28 haplotypes were identified or inferred. Our findings would provide fundamental and useful information for genotyping SLC29A1 in the Japanese and probably other Asian populations.

5' Flanking Region↗
PubMed1995

Comparison of the genetic variation in type 1 dengue virus isolates in Taiwan, 1987-1992.

In this study, the genetic variation of eight dengue-1 strains isolated in Taiwan from 1987 to 1992 (including two imported strains) were studied. A fragment of 490 nucleotides from the E/NS1 junction was amplified and studied by reverse transcription-polymerase chain reaction (RT-PCR) and vector cloning. By comparing the nucleotide sequences of these strains, it was found that local strains in Taiwan shared geographic similarity. The nucleotide differences among local strains were less (0.61% to 2.24%) than the differences between imported strains and other strains (2.04% to 4.29%). The differences of nucleotide sequences between local strains and the prototype remain constant (5.10%-5.29%). However, the differences in nucleotide sequences between imported strains and the prototype ranged from 3.89% to 7.14%. Since the point mutations occurred in the wobble position of the codon, only conserved changes resulted in the amino acid among the isolates.

Amino Acids↗
PubMed1999

Genetic variation and susceptibilities to protease inhibitors among subtype B and F isolates in Brazil.

The genetic variation of the human immunodeficiency virus type 1 (HIV-1) protease gene (prt) permits the classification of HIV-1 strains into five distinct protease subtypes, which follow the gag subtyping patterns. The susceptibilities of non-B-subtype strains to protease inhibitors (PIs) and other antiretroviral drugs remain largely unknown. Subtype F is the main non-B strain contributing to the Brazilian epidemic, accounting for 15 to 20% of these infections. In this work, we report the findings on 81 isolates from PI-naive Brazilian patients collected between 1993 and 1997. In addition, the relevant PI resistance mutations and their phenotypes were determined in vitro for 15 of these patients (B = 9 and F = 6). Among these, the subtype F samples evidenced high sensitivities in vitro to ritonavir and indinavir, with MICs at which 50 and 90% of the isolates are inhibited similar to those of both the Brazilian and the U.S. subtype B isolates. Analysis of the 81 Brazilian prt sequences demonstrated that the subtype F consensus sequence differs from the U.S. and Brazilian subtype B consensus in eight positions (I15V, E35D, M36I, R41K, R57K, Q61N, L63P, and L89M). The frequency of critical PI resistance substitutions (amino acid changes D30N, V82A/F/T, I84V, N88D, and L90M) among Brazilian isolates is very low (mean, 2.5%), and the associated secondary substitutions (amino acid positions 10L, 20K, 36M, 46M, 48G, 54I, 63P, 71A, and 77A) are infrequent. These observations document the relative rarity of resistance to PIs in the treatment of patients infected with HIV-1 subtype F in South America.

Amino Acid Sequence↗