PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “insertion sequence”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 541 records · Page 30Linked to original sources

Quantitation of insertion sequence IS10 transposase gene expression by a method generally applicable to any rarely expressed gene.

We have found that IS10 transposase is synthesized in tiny amounts, about 0.15 polypeptide chain per cell per generation on average, as judged from the beta-galactosidase activity of a single chromosomal copy of a suitable transposase-lacZ gene fusion. Enzymatic activity from the fusion gene is a factor of 10 lower in a permeabilized whole cell assay than in cell extracts. Probably, most cells contain fewer than four polypeptide chains, and these chains can assemble into active tetramers only after cell disruption. This interpretation permits formulation of two equations relating enzyme activities to transcription and translation rates, solution of which reveals that the fusion gene is expressed at the average rate of only 0.25 transcript per cell per generation, with an average of only 0.58 translation product per transcript. This methodology is generally applicable to analysis of any gene from which fewer than four polypeptide chains are synthesized per cell per generation.

Bacterial Proteins↗

Identification of base pairs in the outside end of insertion sequence IS50 that are needed for IS50 and Tn5 transposition.

Short DNA sequences at ends of transposable elements are needed as sites for transposition. Previous deletion mapping showed that, in Tn5 and its component IS50 elements, these essential sites are about 19 base pairs long. To determine which positions are important in transposition, we made one or more sequence changes at each position in the IS50 outside (O) end and assayed the effects of these changes on transposition. Our results indicate that the specific base pairs at 18 of the 19 positions are important in transposition. A 9-base-pair segment in the O end corresponds to a binding site for the Escherichia coli DnaA protein. Comparisons of effects of mutations at different positions in this site, and also measurements of Tn5 transposition in dnaA- cells, indicate that DnaA protein participates in O-end-mediated transposition.

Bacterial Proteins↗

Two frameshift products involved in the transposition of bacterial insertion sequence IS629.

IS629 is 1,310 bp in length with a pair of 25-bp imperfect inverted repeats at its termini. Two partially overlapping open reading frames, orfA and orfB, are present in IS629, and two putative translational frameshift signals, TTTTG (T4G) and AAAAT (A4T), are located near the 3'-end of orfA. With the lacZ gene as the reporter, both T4G and A4T motifs are determined to be a -1 frameshift signal. Two peptides representing the two transframe products designated OrfAB' and OrfAB, are identified by a liquid chromatography-tandem mass spectrometric approach. Results of transposition assays show that OrfAB' is the transposase and that OrfAB aids in the transposition of IS629. Pulse-chase experiments and Escherichia coli two-hybrid assays demonstrate that OrfAB binds to and stabilizes OrfAB', thus increasing the transposition activity of IS629. This is the first transposable element in the IS3 family shown to have two functional frameshifted products involved in transposition and to use a transframe product to regulate transposition.

Amino Acid Motifs↗

Adaptive evolution that requires multiple spontaneous mutations. I. Mutations involving an insertion sequence.

Escherichia coli K12 strain chi 342LD requires two mutations in the bgl (beta-glucosidase) operon, bglR0----bglR+ and excision of IS103 from within bglF, in order to utilize salicin. In growing cells the two mutations occur at rates of 4 x 10(-8) per cell division and less than 2 x 10(-12) per cell division, respectively. In 2-3-week-old colonies on MacConkey salicin plates the double mutants occur at frequencies of 10(-8) per cell, yet the rate of an unselected mutation, resistance to valine, is unaffected. The two mutations occur sequentially. Colonies that are 8-12 days old contain from 1% to about 10% IS103 excision mutants, from which the Sal+ secondary bglR0----bglR+ mutants arise. It is shown that the excision mutants are not advantageous within colonies; thus, they must result from a burst of independent excisions late in the life of the colony. Excision of IS103 occurs only on medium containing salicin, despite the fact that the excision itself confers no detectable selective advantage and serves only to create the potential for a secondary selectively advantageous mutation.

Adaptation, Physiological↗

Nature of an inserted sequence in the mitochondrial gene coding for the 15S ribosomal RNA of yeast.

The small ribosomal RNA, or 15S RNA, or yeast mitochondria is coded by a mitochondrial gene. In the central part of the gene, there is a guanine-cytosine (GC) rich sequence of 40 base-pairs, flanked by adenine-thymine sequences. The GC-rich sequence is (5') TAGTTCCGGGGCCCGGCCACGGAGCCGAACCCGAAAGGAG (3'). We have found that this sequence is absent in the 15S rRNA gene of some strains of yeast. When present, it is transcribed into the mature 15S rRNA to produce a longer variant of the RNA. Sequences identical or closely related to this GC-rich sequence are present in many regions of the mitochondrial genome of Saccharomyces cerevisiae. The 5' and 3' terminal structures of all these sequences are highly constant.

Base Sequence↗

Distribution of insertion sequence IS200 among different clonal lines of the related Salmonella serotypes Livingstone and Eimsbuettel.

The copy number and genetic location of IS200 have provided evidence of strain relatedness in many serotypes of Salmonella. In this study, 100 isolates of the related serotypes Livingstone (6,7:d:l,w) and Eimsbuettel (6,7,14:d:l,w), representing 10 ribotype/biotype (RT/BT) groups isolated from human and non-human sources in seven countries over a 26-year period, were examined for their IS200 profiles. The distribution of IS200 in strains of these serotypes was limited, being present in all 53 isolates of ribotype 1 (RT1) and its variant type RT6, in one of five isolates of RT5 but in none of 42 isolates of RTs 2, 3 or 4. Although the seven IS200 profiles identified in RT1 isolates were of little value for further discrimination within different biotype groups, they were extremely valuable for confirming serotype: isolates of RT1/BT8/IS200 profile A (or its variants) and those of RT1/BT3/IS200 profile B (or its variants) were almost invariably associated with serotypes Livingstone and Eimsbuettel, respectively.

Animals↗

PROGINS Alu sequence insertion is associated with hyperprolactinaemia but not leiomyoma susceptibility.

OBJECTIVE: Leiomyoma and hyperprolactinaemia are both progesterone-dependent diseases. Hormone-related genes, such as the progesterone receptor (PGR), might be involved in their pathogenesis. DESIGN AND MEASUREMENTS: Subjects were divided into three groups: (i) leiomyoma (n = 120); (ii) hyperprolactinaemia (n = 101); (iii) normal controls (n = 140). We investigated the Alu (306-bp DNA) insertion in intron G of the PGR gene in all individuals. PGR gene polymorphisms [T1 (wild-type); T2 (PROGINS, with Alu insertion)] were determined by PCR and electrophoresis. Genotype and allele frequencies of the PROGINS in each group were detected and compared. RESULTS: We observed no significant difference of the PGR*T1/T2 genotypes and allele frequencies between leiomyoma and other two groups. The proportions of T1 homozygote/heterozygote/T2 homozygote in each group were (i) 90/8.3/1.7%; (ii) 84.2/9.9/5.9%; (iii) 92.9/6.4/0.7%. In contrast, a higher percentage of T2-related genotype and allele were noted in hyperprolactinaemic women compared to other two groups. The proportions of T1/T2 alleles in each group were: (i) 94.2/5.8%; (ii) 89.1/10.9%; (iii) 96.1/3.9%. CONCLUSIONS: The PROGIN*T2-related genotype and allele are related to a higher susceptibility to hyperprolactinaemia. The PROGINS polymorphism is not associated with leiomyoma development.

Adult↗

Differentiation of clinical isolates of Actinobacillus actinomycetemcomitans using an insertion sequence, ISAa1.

We previously identified an IS200-like sequence (ISAa1) in the genome of Actinobacillus actinomycetemcomitans FDC Y4. One or more hybridizing bands to the ISAa1 probe were detected in each of several reference strains, representing three of the serotypes (a through c) of A. actinomycetemcomitans. In this study, we examined whether a restriction fragment-length polymorphism (RFLP) with ISAa1 as a probe could differentiate clinical isolates. One or more hybridizing bands were detected in each of the 27 strains examined, which could be divided into seven groups according to restriction fragment-length polymorphism pattern. Several strains were observed with identical restriction fragment-length polymorphism types but with different serotypes. Conversely, strains were also observed with differing restriction fragment-length polymorphism types and identical serotypes.

Adolescent↗

Multicopy integration of heterologous genes, using the lactococcal group II intron targeted to bacterial insertion sequences.

Group II introns are mobile genetic elements that can be redirected to invade specific genes. Here we describe the use of the lactococcal group II intron, Ll.ltrB, to achieve multicopy delivery of heterologous genes into the genome of Lactococcus lactis IL1403-UCD without the need for selectable markers. Ll.ltrB was retargeted to invade three transposase genes, the tra gene found in IS904 (tra904), tra981, and tra983, of which 9, 10, and 14 copies, respectively, were present in IL1403-UCD. Intron invasion of tra904, tra981, and tra983 allele groups occurred at high frequencies, and individual segregants possessed anywhere from one to nine copies of intron in the respective tra alleles. To achieve multicopy delivery of a heterologous gene, a green fluorescent protein (GFP) marker was cloned into the tra904-targeted Ll.ltrB, and the resultant intron (Ll.ltrB::GFP) was induced to invade the L. lactis tra904 alleles. Segregants possessing Ll.ltrB::GFP in three, four, five, six, seven, and eight copies in different tra904 alleles were obtained. In general, increasing the chromosomal copy number of Ll.ltrB::GFP resulted in strains expressing successively higher levels of GFP. However, strains possessing the same number of Ll.ltrB::GFP copies within different sets of tra904 alleles exhibited differential GFP expression, and segregants possessing seven or eight copies of Ll.ltrB::GFP grew poorly upon induction, suggesting that GFP expression from certain combinations of alleles was detrimental. The highest level of GFP expression was observed from a specific six-copy variant that produced GFP at a level analogous to that obtained with a multicopy plasmid. In addition, the high level of GFP expression was stable for over 120 generations. This work demonstrates that stable multicopy integration of heterologous genes can be readily achieved in bacterial genomes with group II intron delivery by targeting repeated elements.

Alleles↗

Insertion sequence IS900 revisited.

Many studies investigating Mycobacterium avium subsp. paratuberculosis in Crohn's disease have used molecular detection of IS900 in clinical samples, but some have described polymorphisms in IS900 as variants of this organism. Analysis of 23 M. avium subsp. paratuberculosis isolates revealed that IS900 is highly conserved, with only two sequevars distinguishing sheep and cattle lineages. Amplification of IS900-like sequences is not sufficient as a proxy for M. avium subsp. paratuberculosis.

Animals↗

Genome plasticity: insertion sequence elements, transposons and integrons, and DNA rearrangement.

Living organisms are defined by the genes they possess. Control of expression of this gene set, both temporally and in response to the environment, determines whether an organism can survive changing conditions and can compete for the resources it needs to reproduce. Bacteria are no exception; changes to the genome will, in general, threaten the ability of the microbe to survive, but acquisition of new genes may enhance its chances of survival by allowing growth in a previously hostile environment. For example, acquisition of an antibiotic resistance gene by a bacterial pathogen can permit it to thrive in the presence of an antibiotic that would otherwise kill it; this may compromise clinical treatments. Many forces, chemical and genetic, can alter the genetic content of DNA by locally changing its nucleotide sequence. Notable for genetic change in bacteria are transposable elements and site-specific recombination systems such as integrons. Many of the former can mobilize genes from one replicon to another, including chromosome-plasmid translocation, thus establishing conditions for interspecies gene transfer. Balancing this, transposition activity can result in loss or rearrangement of DNA sequences. This chapter discusses bacterial DNA transfer systems, transposable elements and integrons, and the contributions each makes towards the evolution of bacterial genomes, particularly in relation to bacterial pathogenesis. It highlights the variety of phylogenetically distinct transposable elements, the variety of transposition mechanisms, and some of the implications of rearranging DNA, and addresses the effects of genetic change on the fitness of the microbe.

Base Sequence↗

[Dissemination of insertion sequences IS605, IS606 among clinical isolates of Helicobacter pylori in China].

OBJECTIVE: To study the distribution of IS605, IS606 among clinical isolates of Helicobacter pylori in China. METHODS: A total of 104 H.pylori strains isolated from 5 different geographic regions in China were analyzed by PCR and dot-blot. RESULTS: Forty-two strains out of the 104 isolates from 5 regions in China were found containing IS605 with 19 containing IS606. The frequency (66%) of IS605 positive strains from Yunnan province was higher than that from other areas. The different distribution of IS606 was neither associated with geographical regions nor with the presence of IS605 but IS606 were associated with the different clinical outcomes. However, the two reading frames ORFA and ORFB of IS605 were constantly coexisting. CONCLUSION: In China, IS605 and IS606 of H. pylori were widely existing but the presence of IS605 in H. pylori might be associated with geographic origin.

DNA Transposable Elements↗