PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “INSECTICIDES”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 559 records · Page 31Linked to original sources

Cholinergic and noncholinergic brain biomarkers of insecticide exposure and effects.

The objective of this investigation was to determine the distribution of cholinergic and noncholinergic biomarkers in discrete brain regions (cortex, stem, striatum, hippocampus, and cerebellum) of rats treated with dimethyl sulfoxide (DMSO, controls), and insecticides such as carbofuran (CARB, 1.5 mg/kg, sc), or methyl parathion (MPTH, 5 mg/kg, ip). Both insecticides produced characteristic signs of anticholinesterase nature within 5-7 min after injection. In controls, analyses of the brain regions revealed a wide variability in the values of cholinergic (acetylcholinesterase, AChE) and noncholinergic (creatine kinase, CK; and lactic dehydrogenase, LDH, and their isoenzymes) biomarkers. The highest activities of AChE and LDH were found in the striatum (1661+/-23 micromol/g/h and 57,720+/-478 IU/l, respectively) and lowest in the cerebellum (118+/-6 micromol/g/h) and 39,480+/-918 IU/l, respectively). However, the activity of CK was found highest in the cerebellum (742,560+/-798 IU/l) and lowest in the hippocampus (353,400+/-11,696 IU/l). Each brain region showed a characteristic profile of CK and LDH isoenzymes. Among the CK isoenzymes, activity of CK-BB was highest (77.5-89.3%), followed by CK-MM (6.7-15.6%), and least CK-MB (0-6.9%). The cerebellum had no CK-MB activity. In all brain regions, CK-MM isoenzyme had only the CK-MM3 subform. Among the LDH isoenzymes, activity of LDH-4 was highest in all brain regions (23-40%), except the cerebellum in which LDH-1 was highest (29%). Compared to the brain, control serum contained very little CK and LDH activity, but serum had three distinct CK and five distinct LDH isoenzymes. Unlike brain regions, serum had three CK-MM subforms. Each insecticide induced characteristic alterations in brain biomarkers. AChE activity was maximally inactivated in cortex (90. 6%) with CARB, and in cerebellum (95.3%) with MPTH. With either insecticide, the least inhibition of AChE occurred in the striatum. Unlike AChE, carboxylesterase (CarbE) did not show brain regional variability in controls, and its activity was uniformly inhibited in all brain regions by CARB and comparatively greater by MPTH. CARB- or MPTH-induced characteristic alterations in CK, LDH, and their isoenzymes in the brain, which were also reflected in serum, as a result of their leakage from the brain by increased permeability due to depletion of ATP (38-57% and 33-47%, respectively) and phosphocreatine (PCr, 23-42% and 56-65%, respectively).

Acetylcholinesterase↗

The insecticide pymetrozine selectively affects chordotonal mechanoreceptors.

Pymetrozine is a neuroactive insecticide but its site of action in the nervous system is unknown. Based on previous studies of symptoms in the locust, the feedback loop controlling the femur-tibia joint of the middle leg was chosen to examine possible targets of the insecticide. The femoral chordotonal organ, which monitors joint position and movement, turned out to be the primary site of pymetrozine action, while interneurons, motoneurons and central motor control circuitry in general did not noticeably respond to the insecticide. The chordotonal organs associated with the wing hinge stretch receptor and the tegula were influenced by pymetrozine in the same way as the femoral chordotonal organ, indicating that the insecticide affects chordotonal sensillae in general. Pymetrozine at concentrations down to 10(-8) mol l(-1) resulted in the loss of stimulus-related responses and either elicited (temporary) tonic discharges or eliminated spike activity altogether. Remarkably, pymetrozine affected the chordotonal organs in an all-or-none fashion, in agreement with previous independent studies. Other examined sense organs did not respond to pymetrozine, namely campaniform sensillae on the tibia and the subcosta vein, hair sensillae of the tegula (type I sensillae), and the wing hinge stretch receptor (type II sensillae).

Action Potentials↗

Antifungal activity of Hinokitiol-related compounds on wood-rotting fungi and their insecticidal activities.

Hinokitiol (beta-thujaplicin), beta-dolabrin and gamma-thujaplicin isolated from Thujopsis dolabrata SIEB. et ZUCC var hondai MAKINO showed antifungal activities against all of the wood-rotting fungi examined. The antifungal activity of three compounds on Daedalea dickinsii IFO-4979 was especially strong, their minimum inhibitory concentration (MIC) values being 0.2 microg/ml. Their antifungal activities on D. dickinsii IFO-4979 were as high as that of amphotericin B used as a positive control. Three compounds had strong insecticidal activities on Tyrophagus putrescentiae [50%-lethal concentration (LC50 : g/m2) 0.25 in hinokitiol, 0.02 in beta-dolabrin and gamma-thujaplicin. Their insecticidal activities were higher than that of N,N-diethyl-m-toluamide (DEET, LC50 : 1.46 g/m2) used as a positive control. Three compounds also showed strong insecticidal activity on Coptotermes formosanus [LC50 (g/m2) 0.07 in hinokitiol, 0.05 in beta-dolabrin and gamma-thujaplicin], although their insecticidal activities were much lower than that of commercial chloropyrifos (LC50 : 0.00016 g/m2).

Antifungal Agents↗

Naturally occurring insecticides.

Naturally occurring insecticides are abundant and varied in their effects, though but a few are articles of commerce. Even for these, pyrethrum, nicotine, rotenone, hellebore, ryania, and sabadilla, there is a paucity of information on mammalian toxicology and environmental effects. In general, these materials are characterized favorably by low acute toxicity and ready dissipation in nature. Unfavorable aspects of natural insecticides are the contained mixture of active and inactive components and the low active ingredient content on a crop yield basis pointing to a high unit cost. Natural insecticides can serve additionally as leads to unnatural mimics, of which the commercially successful synthetic pyrethroids are prime examples. The chemical nature, relationship of insecticidal activity to chemical structure, occurrence, production, and utilization, registered uses, metabolism, and insect and mammalian toxicity are reviewed.

Animals↗

Interaction of organophosphorus insecticide methylparathion with calf thymus DNA and a synthetic DNA duplex.

The interaction of an organophosphorus insecticide methylparathion (O,O-dimethyl O-4-nitrophenyl phosphorothioate) with double-stranded DNA was characterized by UV and circular dichroism (CD) spectroscopy. Two kinds of DNA were employed: calf thymus DNA (CT DNA) and a synthetic two-stranded oligomer of sequence 5'-d(TTGGATCCGAATTCAAGCTT)-3'. Melting curves and CD spectra were taken for the DNAs in the presence of the insecticide at methylparathion/DNA base pair molar ratio of 0.5. The insecticide evoked a decrease of the melting temperature and a broadening of the transition range for CT DNA. Similar effects were observed for the synthetic oligomer but they were less pronounced than in the case of CT DNA. Methylparathion evoked a slight shift and an increase in the amplitude of the negative band in the CD spectra of both DNAs. Obtained results indicate that methylparathion may perturb the thermal stability and conformation of DNA, which is an evidence that the insecticide has an ability to interact directly with DNA.

Animals↗

Comparative evaluation of pyrethroid insecticide formulations against Triatoma infestans (Klug): residual efficacy on four substrates.

We investigated the residual efficacy of four insecticide formulations used in Chagas disease vector control campaigns: cyfluthrin 12.5% suspension concentrace (SC), lambda-cyhalothrin 10% wettable powder (WP), deltamethrin 2.5% SC, and 2.5% WP on four types of circular blocks of wood, straw with mud, straw with mud painted with lime, and mud containing 5% of cement. Three concentrations of these insecticides were tested: the LC90 (previously determined on filter paper), the double of the LC90, and the recommended operational dose. For each bioassay test, 15 third-stage nymphs of Triatoma infestans (Klug) (Hemiptera: Reduviidae) were exposed for 120 h to each treatment at 24 h, 30, 60, 90, and 180 days post-spraying. Mortality rates, moulting history and behaviour were recorded at 24, 48, 72, and 120 h of exposure. Mortality rates were highest during the first 30 days post-spraying. Highest mortality rates (above 50%) were observed for deltamethrin 2.5% SC and lambda-cyhalothrin 10% WP on wood blocks up to three months post-spraying. Mud was the substrate on which treatments showed lowest persistence, with the other two substrates showing intermediate residual efficacy of all treatments. During the first 30 days WP formulations were not as effective as SC flowable formulations but, overall in the longer term, WP gave grater mortality rates of T. infestans nymphs exposed at up to six months post-spraying. Porous surfaces, especially mud, showed most variability presumably due to absorption of the insecticide. In contrast the less porous surfaces (i.e. wood and lime-coated mud) kept mortality rates high for longer post-treatment, irrespective of the insecticide concentration used.

Animals↗

Pyrethroid insecticide evaluation on different house structures in a Chagas disease endemic area of the Paraguayan Chaco.

Insecticide effects of deltamethrin 2.5% SC (flowable solution) on different substrates and triatomine infestation rates in two indigenous villages (Estancia Salzar and Nueva Promesa) of the Paraguayan Chaco are reported. This field study was carried out to determine the extent to which variability in spray penetration may affect residual action of the insecticide. A total of 117 houses in the two villages were sprayed. Filter papers discs were placed on aluminium foil pinned to walls and roofs in selected houses and the applied insecticide concentration was determined by high pressure liquid chromatography (HPLC). The target dose rate was 25 mg a.i./m2. The mean actual applied dose in Estancia Salazar was 11.2 +/- 3.1 mg a.i./m2 in walls and 11.9 +/- 5.6 mg a.i./m2 in roofs while in Nueva Promesa, where duplicates were carried out, the mean values were 19.9 +/- 6.9 mg a.i./m2 and 34.7 +/- 10.4 mg a.i./m2 in walls and 28.8 +/- 19.2 mg a.i./m2 and 24.9 +/- 21.8 mg a.i./m2 in roofs. This shows the unevenness and variability of applied doses during spraying campaigns, and also the reduced coverage over roof surfaces. However, wall bioassays with Triatoma infestans nymphs in a 72 h exposure test showed that deposits of deltamethrin persisted in quantities sufficient to kill triatomines until three months post spraying. Knockdown by deltamethrin on both types of surfaces resulted in 100% final mortality. A lower insecticidal effect was observed on mud walls. However, three months after treatment, sprayed lime-coated mud surfaces displayed a twofold greater capacity (57.5%) to kill triatomines than mud sprayed surfaces (25%). Re-infestation was detected by manual capture only in one locality, six months after spraying.

Animals↗

Comparison of susceptibility of pest Euschistus servus and predator Podisus maculiventris (Heteroptera: Pentatomidae) to selected insecticides.

Susceptibility of the brown stink bug, Euschistus serous (Say), and the spined soldier bug, Podisus maculiventris (Say), to acetamiprid, cyfluthrin, dicrotophos, indoxacarb, oxamyl, and thiamethoxam, was compared in residual and oral toxicity tests. Generally, susceptibility of P. maculiventris to insecticides was significantly greater than or not significantly different from that of E. servus. Cyfluthrin and oxamyl were more toxic to the predator than to E. servus in residual and feeding tests, respectively. Dicrotophos is the only compound that exhibited both good residual and oral activity against E. servus, but even this toxicant was more toxic to the predator than to the pest in oral toxicity tests. Feeding on indoxacarb-treated food caused high mortality for both nymphs and adults of P. maculiventris. In contrast, E. servus was unaffected by feeding on food treated with this compound. Insecticide selectivity to P. maculiventris was detected only with acetamiprid for adults in residual toxicity tests and for nymphs in oral toxicity tests. Because insecticide selectivity to P. maculiventris was limited, it is extremely important to conserve P. maculiventris in cotton fields by applying these insecticides for control of brown stink bugs only when the pest reaches economic threshold.

Animals↗

Laboratory evaluation of the toxicity of systemic insecticides for Control of Anoplophora glabripennis and Plectrodera scalator (Coleoptera: Cerambycidae).

Anoplophora glabripennis (Motschulsky) (Coleoptera: Cerambycidae) is one of the most serious nonnative invasive forest insects discovered in North America in recent years. A. glabripennis is regulated by federal quarantines in the United States and Canada and is the subject of eradication programs that involve locating, cutting, and chipping all infested trees. Other control methods are needed to aid in eradication and to form an integrated management program in the event eradication fails. We conducted laboratory bioassays to determine the toxicity of two systemic insecticides, azadirachtin and imidacloprid, for potential control of A. glabripennis and the cottonwood borer, Plectrodera scalator (F.) (Coleoptera: Cerambycidae), a closely related native cerambycid. Larvae of both cerambycid species were fed artificial diet with dilutions of azadirachtin or imidacloprid for 14 wk. Both insecticides exhibited strong antifeedant effects and some toxicity against A. glabripennis and P. scalator larvae. For A. glabripennis, the highest larval mortality at the end of the bioassay was 60% for larvae fed artificial diet treated with azadirachtin (50 ppm) or imidacloprid (1.6 ppm). For P. scalator, the highest larval mortality at the end of the bioassay was 100% for larvae fed artificial diet treated with azadirachtin (50 ppm) or imidacloprid (160 ppm). At 14 wk, the LC50 values for P. scalator were 1.58 and 1.78 ppm for azadirachtin and imidacloprid, respectively. Larvae of both species gained weight when fed diet treated with formulation blanks (inert ingredients) or the water control but lost weight when fed diet treated with increasing concentrations of either azadirachtin or imidacloprid. In a separate experiment, A. glabripennis adults were fed maple twigs treated with high and low concentrations of imidacloprid. A. glabripennis adult mortality reached 100% after 13 d on twigs treated with 150 ppm imidacloprid and after 20 d on twigs treated with 15 ppm imidacloprid. There was no visible feeding by A. glabripennis adults on twigs treated at the higher imidacloprid rate, and feeding was significantly reduced for adults placed on twigs treated at the low imidacloprid rate compared with adults on untreated twigs. In summary, imidacloprid and azadirachtin had both antifeedant and toxic effects against A. glabripennis and P. scalator and have potential for use in management programs. Based on our results, the delivery of high and sustained insecticide concentrations will be needed to overcome the antifeedant effects and lengthy lethal time for both larvae and adults exposed to these insecticides.

Acer↗

Comparison of pheromone-mediated mating disruption and conventional insecticides for management of tufted apple bud moth (Lepidoptera: Tortricidae).

Large-plot studies were used to compare pheromone-mediated mating disruption and conventional insecticide applications for management of tufted apple bud moth, Platynota idaeusalis (Walker), in North Carolina in 1993 and 1994. Pheromone trap catches were reduced in mating disruption blocks, and traps placed in the lower stratum of the canopy had a higher level of trap capture reduction compared with traps placed in the upper stratum. First-generation tufted apple bud moth exposure to either pheromones for mating disruption or insecticides affected second generation pheromone trap catches in the lower and upper canopy. More second generation male moths were caught in pheromone traps placed in the upper compared with the lower canopy in blocks treated with pheromones for mating disruption during the first generation, whereas the opposite was true in blocks treated with insecticides during the first generation. Despite reduced trap catches in pheromone-treated blocks, egg mass densities were not reduced in these blocks compared with insecticide-treated blocks. Furthermore, fruit damage was not significantly different between mating disruption blocks and conventionally treated blocks in orchards with relatively low populations of tufted apple bud moth, but damage was greater in mating disruption blocks in orchards with higher moth densities.

Animals↗

Effect of irrigation on the efficacy of insecticides for controlling two species of mole crickets (Orthoptera: Gryllotalpidae) on golf courses.

Effects of irrigation regimen, quantity, and timing on the efficacy of three insecticides for controlling nymphs of the southern mole cricket, Scapteriscus borellii Giglio-Tos, and the tawny mole cricket, Scapteriscus vicinus Scudder, were studied on golf courses in 1997, 1998, and 1999. Two irrigation regimen tests using two rates of bifenthrin and lambda-cyhalothrin produced inconclusive results. Mole cricket damage ratings after the applications of bifenthrin (60 g [AI]/ha) and lambda-cyhalothrin (76 g [AI]/ha) were not significantly different among the four irrigation regimens (non-irrigation, irrigation before treatment, irrigation after treatment, and irrigation before and after treatment). Mole cricket damage rating after the application of bifenthrin (120 g [AI]/ha) under irrigation before and after irrigation was significantly better than those under other irrigation regimens at 14 and 21 d after treatment (DAT). Different irrigation quantity and irrigation timing (after insecticide treatment) did not significantly affect the performance of imidacloprid (434 g [AI]/ha) in the 1998 tests. However, the results from the 1999 test indicated that mole cricket damage ratings from the imidacloprid-treated plots were significantly different between 2 and 0.5 cm irrigation water after treatment at 21 and 28 DAT. Application of bifenthrin at a rate of 120 g (AI)/ha with 0.5 cm of irrigation water after treatment resulted in significantly lower mole cricket damage ratings than those of 1.0 and 2.0 cm of irrigation water after treatment at 30 DAT only in the 1998 test. Bifenthrin with irrigation at 1 h after insecticide treatment provided better mole cricket control than that of irrigation at 5 min after treatment at 30 DAT only in the 1998 test. Mole cricket damage ratings after application of bifenthrin were not significantly different between either irrigation quantity treatment or irrigation timing treatment in the 1999 tests. Possible effects of application timing, environmental conditions, irrigation practice, and insecticide physical properties on the results are discussed.

Agriculture↗

Insecticide resistance and dominance levels.

Dominance has been assessed in different ways in insecticide resistance studies, based on three phenotypic traits: the insecticide concentration required to give a particular mortality (DLC), mortality at a particular insecticide dose (DML), and fitness in treated areas (DWT). We propose a general formula for estimating dominance on a scale of 0 to 1 (0 = complete recessivity and 1 = complete dominance). DLC, DML, and DWT are not directly related and their values depend on genetic background and environmental conditions. We also show that pest management strategies can have the consequence to increase DWT via the selection of dominance modifiers. Studies on resistance to Bacillus thuringiensis toxins provide the ultimate example of the complexity of the definition of the concept of dominance. Almost all studies have focused on calculation of DLC, which provides little information about the efficiency of pest management programs. For instance, one assumption of the high dose/refuge strategy is that Bacillus thuringiensis resistance must be effectively recessive (i.e., DML must be close to zero). However, DWT, rather than DML, is relevant to the resistance management strategy. Therefore, we strongly suggest that the time has come to focus on fitness dominance levels in the presence and absence of insecticide.

Animals↗

Efficacy of insecticides of different chemistries against Helicoverpa zea (Lepidoptera: Noctuidae) in transgenic Bacillus thuringiensis and conventional cotton.

Six insecticides of different chemistries were evaluated against the cotton bollworm, Helicoverpa zea (Boddie), in non-B.t. (Deltapine 'DP 5415', Deltapine 'DP 5415RR') and transgenic Bacillus thuringiensis (Berliner) (B.t.) (Deltapine 'NuCOTN 33B', Deltapine 'DP 458 B/RR') cotton. In 1998, treatments consisted of three rates each of a pyrethroid (lambda-cyhalothrin), spinosyn (spinosad), carbamate (thiodicarb), pyrrole (chlorfenapyr), oxadiazine (indoxacarb), and avermectin (emamectin benzoate) in a nonirrigated field. In 1999, treatments consisted of three rates each of lambda-cyhalothrin, spinosad, thiodicarb, and indoxacarb in an irrigated and a nonirrigated (dryland) field. The highest rate of each insecticide corresponded to normal grower-use rates. Spinosad and thiodicarb controlled H. zea in non-B.t. cotton, whereas other materials were less effective. Even though H. zea is becoming increasingly resistant to pyrethroid insecticides, lambda-cyhalothrin was highly effective in dryland B. thuringiensis cotton. Spinosad and thiodicarb were equally effective. Data indicated that reduced rates of lambda-cyhalothrin, spinosad, and thiodicarb could be used for control of H. zea in dryland B.t. cotton systems. However, reduced rates of these insecticides in a heavily irrigated B.t. cotton system did not provide adequate control.

Animals↗

Susceptibility of adult hymenopteran parasitoids of the Nantucket pine tip moth (Lepidoptera: Tortricidae) to broad-spectrum and biorational insecticides in a laboratory study.

Currently, there is an elevated interest in reducing feeding damage caused by the Nantucket pine tip moth, Rhyacionia frustrana (Comstock), a common regeneration pest of loblolly pine, Pinus taeda L. The toxicity of several insecticides was tested in a laboratory against four common R. frustrana parasitoids. There were no differences in parasitoid mortality between the control and indoxacarb treatments. However, the pyrethroids, permethrin and lambda-cyhalothrin, caused significantly more mortality initially (up to 240 min exposure time) than other insecticides. Spinosad was less toxic than the pyrethroids initially, but the spinosad related mortality increased with time until it reached a level similar to the pyrethroids. For the most part, spinosad and the pyrethroids caused more mortality than the control and indoxacarb treatmtents within the 1-d sample period. These results may have important implications for decisions concerning which insecticides are best suited for reducing pest damage while conserving natural enemies in timber and agricultural systems. Large-scale field trials are required to further define the impacts of these insecticides on natural enemies.

Animals↗

Transfer of ingested insecticides among cockroaches: effects of active ingredient, bait formulation, and assay procedures.

Foraging cockroaches ingest insecticide baits, translocate them, and can cause mortality in untreated cockroaches that contact the foragers or ingest their excretions. Translocation of eight ingested baits by adult male Blattella germanica (L.) was examined in relation to the type of the active ingredient, formulation, and foraging area. Ingested boric acid, chlorpyrifos, fipronil, and hydramethylnon that were excreted by adults in small dishes killed 100% of first instars within 10 d and >50% of second instars within 14 d. Residues from these ingested baits were also highly effective on nymphs in larger arenas and killed 16-100% of the adults. However, when the baits and dead cockroaches were removed from the large arenas and replaced with new cockroaches, only residues of the slow-acting hydramethylnon killed most of the nymphs and adults, whereas residues of fast acting insecticides (chlorpyrifos and fipronil) killed fewer nymphs and adults. Excretions from cockroaches that ingested abamectin baits failed to cause significant mortality in cockroaches that contacted the residues. These results suggest that hydramethylnon is highly effective in these assays because cockroaches that feed on the bait have ample time to return to their shelter and defecate insecticide-laden feces. The relatively high concentration of hydramethylnon in the bait (2.15%) and its apparent stability in the digestive tract and feces probably contribute to the efficacy of hydramethylnon. To control for differences among baits in inert ingredients and the amount of active ingredient, we compared 1% chlorpyrifos with 1% hydramethylnon in identical baits. Again, hydramethylnon residues provided greater secondary kill, but the results highlighted the importance of the inert ingredients. We conclude that, in the absence of cannibalism and necrophagy, translocation of baits and secondary kill are most effective with slow acting insecticides in palatable baits that can traverse the digestive tract and be deposited within and around the cockroach aggregation.

Animals↗

Effect of insecticides used in corn, sorghum, and alfalfa on the predator Orius insidiosus (Hemiptera: Anthocoridae).

Orius insidoisus (Say) is an important predator in corn, sorghum, and alfalfa. Foliar insecticides commonly used on corn (permethrin, bifenthrin, and fipronil); sorghum (chlorpyrifos, carbofuran, dimethoate, and cyfluthrin); and both crops (A-cyhalothrin and ethyl parathion) were evaluated in 1998 and 1999 for their residual effects on O. insidiosus by caging adults on treated plants at several time intervals: at application (day 0) and 2, 3, and 6 d after application. In addition, imidacloprid, fipronil, and thiamethoxam used as seed treatments on corn and sorghum were tested for their effects on O. insidiosus by caging adults on plants in the presence and absence of greenbugs, Schizaphis graminum (Rondani). Finally, six of the same insecticides that also are used on alfalfa were evaluated in the field for their effects on O. insidiosus and other insects. On day 0, ethyl parathion. bifenthrin, and [lambda]-cyhalothrin on corn caused significantly higher mortality to O. insidiosus than permethrin and fipronil. Ethyl parathion and carbofuran on sorghum caused significantly higher mortality than chlorpyrifos, dimethoate, and A-cyhalothrin, which differed significantly from the control. Mortality with cyfluthrin did not differ significantly from that in the control. Insecticides had no significant effects on O. insidiosus 3 and 6 d after application in 1998 with the exception of permethrin on day 3. Similar patterns of mortality were observed in 1999 experiments. No significant differences in mortality of adults occurred with fipronil and thiamethoxam in the presence and absence of greenbugs. Imidachloprid caused significantly higher mortality to O. insidiosus adults than thiamethoxam or fipronil in some instances when greenbugs were not supplied as food. In alfalfa, the insecticides caused significant mortality to most of the insects evaluated. Ethyl parathion, permethrin, chlorpyrifos, and cyfluthrin caused significantly higher mortality to O. insidiosus than carbofuran and A-cyhalothrin, which differed significantly from the control in 1998. In 1999, all treatments significantly reduced O. insidiosus numbers and did not differ significantly from each other.

Animals↗

Bt sweet corn and selective insecticides: impacts on pests and predators.

Sweet corn, Zea mays L., is attacked by a variety of insect pests that can cause severe losses to the producer. Current control practices are largely limited to the application of broad-spectrum insecticides that can have a substantial and deleterious impact on the natural enemy complex. Predators have been shown to provide partial control of sweet corn pests when not killed by broad-spectrum insecticides. New products that specifically target the pest species, while being relatively benign to other insects, could provide more integrated control. In field trials we found that transgenic Bt sweet corn, and the foliar insecticides indoxacarb and spinosad are all less toxic to the most abundant predators in sweet corn (Coleomegilla maculate [DeGeer], Harmonia axyridis [Pallas], and Orius insidiosus [Sav]) than the pyrethroid lambda cyhalothrin. Indoxacarb, however, was moderately toxic to coccinellids and spinosad and indoxacarb were somewhat toxic to O. insidiosus nymphs at field rates. Bt sweet corn and spinosad were able to provide control of the lepidopteran pests better than or equal to lambda cyhalothrin. The choice of insecticide material made a significant impact on survival of the pests and predators, while the frequency of application mainly affected the pests and the rate applied had little effect on either pests or predators. These results demonstrate that some of the new products available in sweet corn allow a truly integrated biological and chemical pest control program in sweet corn, making future advances in conservation, augmentation and classical biological control more feasible.

Animals↗

Effect of temperature on efficacy of insecticides to differential grasshopper (Orthoptera: Acrididae).

The effect of temperature on activity of insecticides for controlling grasshoppers in leafy green vegetables was evaluated. Insecticides evaluated had differing modes of action and included diflubenzuron, azadirachtin, Beauveria bassiana, spinosad, endosulfan, esfenvalerate, and naled. We evaluated these insecticides for efficacy to third instars of differential grasshopper, Melanoplus differentialis (Thomas), at temperatures ranging from 10 to 35 degrees C. In the laboratory, treatment with esfenvalerate resulted in 100% mortality at temperatures of 10 to 35 degrees C, and efficacy was not temperature dependent. Treatment with spinosad resulted in similar mortality as with esfenvalerate at all temperatures except 10 degrees C. The activity of B. bassiana was greatest at 25 degrees C and was adversely affected by high and low temperatures. Treatment with diflubenzuron resulted in increased mortality at high temperatures, and at 35 degrees C its activity was similar to that of esfenvalerate and spinosad. The activity of azadirachtin ranged from 19 to 31% and was not influenced by temperature. In field studies, spinosad, diflubenzuron, and esfenvalerate provided differing levels of mortality both at application and when nymphs were exposed to 1-h-old residues. However, only spinosad and diflubenzuron provided similar levels of mortality when nymphs were exposed to 24-h-old residues. The residual activity of endosulfan, naled, esfenvalerate, and spinosad decreased with increasing time (0-24 h) after exposure to sunlight and high summer temperatures. Compared with other insecticides, naled had a short residual activity period and activity was dependent upon immediate contact with the nymphs or their substrate. B. bassiana was inactive under high temperatures and intense sunlight as occurs in summer.

Animals↗