SEARCH · PubMed Health

Results for “Assay development”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 577 records · Page 32Linked to original sources

PubMed2002

Sensitive detection of genetic variants of HIV-1 and HCV with an HIV-1/HCV assay based on transcription-mediated amplification.

This paper describes a comprehensive study of hepatitis C virus (HCV) and human immunodeficiency virus type 1 (HIV-1) genotype sensitivity of the transcription-mediated amplification (TMA)-based HIV-1/HCV assay, developed and manufactured by Gen-Probe Incorporated (San Diego, CA) for screening human plasma specimens in blood bank settings. The TMA HIV-1/HCV assay is a qualitative, in vitro nucleic acid testing system used for initial screening. HIV-1 and HCV discriminatory assays are used to distinguish between HIV-1 and HCV infection or co-infection. In this study, multiple unique specimens representing HCV genotypes 1-6 were tested at various dilutions. The results show that the TMA HIV-1/HCV assay and the TMA HCV discriminatory assay have similar HCV genotype sensitivity, as both assays detected all six genotypes at 100 copies/ml and nearly all replicates tested at 30 copies/ml. Similarly, numerous unique specimens representing HIV-1 group M subtypes (A-G), HIV-1 group N, and group O specimens were tested at various dilutions. The TMA HIV-1/HCV assay and the TMA HIV-1 discriminatory assay were found to have similar HIV-1 subtype sensitivity; all variants at 100 copies/ml and nearly all at 30 copies/ml were detected. These results indicate that the TMA assays meet the sensitivity requirements for blood screening in blood banks worldwide.

Genetic Variation↗

PubMed2001

Allergenic materials in the house dust of allergy clinic patients.

INTRODUCTION: Environmental agents including animal, fungal, tree, and weed antigens are known to cause allergic rhinitis and asthma. The following study was performed to measure the antigen concentration of several of these in house dust of children seen in an allergy clinic. Comparisons are made between household allergen levels of children seen for asthma and children seen for other reasons. METHODS: Dust samples were solicited from patients in a pediatric allergy specialty clinic and other individuals associated with the clinic. Persons submitting dust were asked to complete a questionnaire describing their house. Samples were extracted, centrifuged, and filtered for sterility. Samples were stored in 50% glycerol at -20 degrees C. Specific antigens for Alternaria, Cladosporium, Aspergillus, Candida, Dermatophagoides farinae, cat, dog, oak, fescue, ragweed, plantain, and cockroach were measured using inhibition assays developed with whole antigen extract. Allergens Der p1, Der f 1, Alt a 1, and Alt a 70 kD were measured using double monoclonal antibody assays. RESULTS: Significant concentrations of whole antigen from cat, dog, oak, Alternaria, and Cladosporium were detected. Between 0.1 and 18 microg of Der f1 and Der p1 per gram of dust were also measured. Alt a 1 and Alt a 70 kD levels varied between 3.0 and 1000 U/g of dust. Significant positive correlations were observed in levels of dust mite and Alternaria allergen for patients with an evaluation of asthma. CONCLUSIONS: We found measurable levels of fungal antigens (Alternaria, Cladosporium), mite antigens, and animal antigens (dog and cat) in the majority of dust samples in this self-selected set of allergy clinic patients. Specific allergens Alt a 1, Alt a 70kD, and Der p 1 were significantly higher in the homes of asthmatic patients when compared with patients seen for reasons other than asthma. These studies support the hypothesis that fungal allergen exposure is an important component in the pathogenesis of the clinical condition known as asthma.

Air Pollution, Indoor↗

PubMedDate not supplied

Rapid optimization of antibotulinum toxin antibody fragment production by an integral approach utilizing RC-SELDI mass spectrometry and statistical design.

A process for the rapid development and optimization of the fermentation process for an antibotulinum neurotoxin antibody fragment (bt-Fab) production expressed in Escherichia coli was achieved via a high-throughput process proteomics and statistical experimental design. This process, using retentate chromatography-surface enhanced laser desorption/ionization mass spectrometry (RC-SELDI MS), was employed for identifying and quantifying bt-Fab antibody in complex biological samples for the optimization of microbial fermentation conditions. Five variables (type of culture media, glycerol concentration, post-induction temperature, IPTG concentration, and incubation time after induction) were statistically combined using an experimental 2(5)(-1) fractional factorial design and tested for their effects on maximal bt-Fab antibody production. When the effects of individual variables and their interactions were assessed, type of media and post-induction temperature showed statistically significant increase in yield of the fermentation process for the maximal bt-Fab antibody production. This study establishes an integral approach as a valuable tool for the rapid development of manufacturing processes for producing various biological materials. To verify the RC-SELDI MS method, a Fab-specific immuno-affinity HPLC assay developed here was also employed for the quantification of the bt-Fab antibody in crude lysate samples obtained during the fermentation optimization process. Similar results were obtained.

Botulinum Toxins↗

PubMed2002

The transfer between instruments of a reflectance near-infrared assay for paracetamol in intact tablets.

This study compares several correction methods to facilitate the transfer of a validated near-infrared (NIR) assay for paracetamol in intact tablets between two reflectance NIR instruments of the same type. Transfer was defined as the ability to accurately predict the true assay value of a sample measured on a NIR system using an assay developed on a different system, and was assessed using a comprehensive set of statistical tests. Direct electronic transfer of the calibration models, representing the NIR assay, was not possible as a result of a definite residual spectrum between instruments. The use of a correction method based on the standardisation of the material used to record the reference spectrum also proved ineffective. Two methods investigated did succeed, the first employed a response surface calculated between the reflectance values of a set of six certified photometric standards measured on both instruments, with all full range partial least square (PLS) regression models subsequently transferred. The next was correction of the spectra from the second instrument utilising the residual spectrum between the mean sample of the validation set measured on both instruments. Through this approach all PLS regression models and also a single multiple linear regression (MLR) model were transferred. As an outcome of this study guidelines are suggested for the transfer of NIR assays along with the criteria deemed necessary to conclusively prove transfer and justify any correction method utilised. The significant criteria were determined to be the paired t-test with both the UV reference assay data and the original NIR assay data, and comparison of the coefficient of multiple determinations.

Acetaminophen↗

PubMed2004

[Inhibitory effect of zinc on beta-hexosaminidase release from RBL-2H3 cells by synthetic chemicals].

The effects of foods and chemicals related to food hygiene on degranulation were evaluated using a method for assaying the enzyme activity of beta-hexosaminidase as an index of chemical mediator release from RBL-2H3 cells in vitro. Using a previously developed assay system, we had found a large number of inhibitors and promoters of degranulation of RBL-2H3 cells. In the present study, we examined the inhibitory effect of zinc chloride on the degranulation (beta-hexosaminidase release) from RBL-2H3 cells with or without antigen in the presence of the degranulation-promotive chemicals, namely, 4 food additives, 7 pesticides and 2 veterinary drugs. These promotive chemicals were classified into two types on the basis of inhibitory profile by zinc chloride: 1) those which showed marked degranulation-inhibitory action when the cells were stimulated with antigen, such as butylhydroxyanisole, dibutylhydroxytoluene, EPN, cis- and trans-permethrin, prothiofos, pyridaben, terbufos, 2) those which showed marked degranulation-inhibitory action whether the cells were stimulated with antigen or not, such as butyl p-hydroxybenzoate, o-phenylphenol, bitertanol, salinomycin. In conclusion, zinc had a dramatic inhibitory effect on enhanced degranulation induced by synthetic chemicals in vitro.

Animals↗

PubMed1987

Anti-lipopolysaccharide antibodies measured by enzyme-immunoassay in Danish blood donors.

To explore whether the intravenous administration of naturally occurring high-titer human anti-lipopolysaccharide IgG (anti-LPS) is beneficial in the treatment of human septic shock, it is necessary to select blood donors according to anti-LPS concentrations. The present paper describes an enzyme-linked immuno-adsorbent assay (ELISA) for the screening of blood donors to obtain such antibodies. Human specific IgG antibodies directed against smooth LPS from eleven different bacterial strains and species were quantitated. The ELISA is simple and uses only commercially available reagents. By optimizing assay conditions, a low unspecific background activity (OD below 0.010) was obtained, together with a large specific reading interval. 2021 human plasma samples from volunteer blood donors at six different blood-banks in Denmark were screened by the ELISA. The median anti-LPS antibody concentration was 9 mg/l. Five per cent of the donors had anti-LPS concentrations above 40 mg/l (expected to be therapeutically useful). The age- and sex-related distributions indicated that the highest prevalence of high anti-LPS concentration was in males aged 40-49 years. It is concluded that specific anti-LPS gammaglobulin based on naturally occurring anti-LPS antibodies can be obtained in Denmark following the screening of blood-donors, using the assay developed.

Adult↗

PubMed1997

Establishment of an efficient enzyme-linked immunosorbent assay for the determination of human choline acetyltransferase.

A specific and sensitive two-side enzyme-linked immunosorbent assay (sandwich-ELISA) was established for the reliable quantification of human brain and placental choline acetyltransferase (ChAT). In contrast to the radiometric assay developed by Fonnum, which is widely used for the measurement of enzyme activity, the sandwich-ELISA particularly recognized inactivated forms of the antigen. In the assay, affinity-purified polyclonal synthetic peptide antibodies adsorbed to the polystyrene surface of the microtiter plate were employed as capture reagent. Based on standard peroxidase protocols, immobilized ChAT was detected using monoclonal antibodies raised against human placental ChAT. By use of this ELISA, ChAT was determined at various purification stages of the enzyme, in body fluids, during recovery experiments and in sera of patients with severe brain damage.

Adolescent↗

PubMed1998

Strategies and techniques for identification of novel bioactive compounds--CHI's second annual conference. 7-9 October 1998, Zurich, Switzerland.

This conference on recent developments in the discovery of novel therapeutic candidates was organized by Amy Dasch (Cambridge Healthtech Institute, Newton Upper Falls, MA, USA; http://www.xensei.com/conferences). The conference provided an overview of all relevant aspects of the rapidly changing paradigms in drug research. Gene technology creates a vast number of new biological targets. The progress in combinatorial chemistry and high-throughput screening (HTS) is accompanied by the development of virtual libraries, large screening programs, and the generation of enormous sets of data. Correspondingly, the lectures covered such different topics as target identification and assay development, HTS technology, combinatorial library design and synthesis, chemoinformatics, and the integration of these components into the discovery of novel pharmaceutical compounds, the development of agricultural chemicals, and other applications. A most valuable addition was reports on case histories in drug development from pharmaceutical companies utilizing these technologies. About 100 scientists, many of them from European countries, attended the meeting. In total, 25 lectures were presented in four sessions: molecular diversity and library design; combinatorial synthesis; HTS; computational methodologies and chemoinformatics. Like other commercially organized conferences, this meeting was well-planned. The balance of speakers from small venture capital companies, large pharmaceutical and agricultural firms gave a broad overview of recent progress in the rational design, combinatorial synthesis, and HTS of new bioactive compounds, as well as on different approaches to handling large data sets and deriving structure-activity relationships from such data.

Journal Article↗

PubMed1980

125I-labeled protein A as a general tracer in immunoassay: suitability of goat and sheep antibodies.

The immunoassay method in which 125I-labeled staphylococcal Protein A ([125I]PA) serves as a general tracer has been extended to include goat and sheep IgG antibodies. Goat and sheep IgG normally do not react significantly with PA. However, once IgG antibody is bound to immobilized antigen or hapten, binding of [125I]PA is enhanced markedly. Binding efficiencies of [125I]PA to immune complexed goat anti-human IgM, human IgE, methotrexate and sheep anti-IgE were determined and compared quantitatively to rabbit IgG with the corresponding specificity. Immunoassays were developed based on the inhibition of [125I]PA binding as a measure of antibody inhibition by fluid-phase homologous ligand. In terms of sensitivity and specificity, assays using goat and sheep antibodies were comparable to assays developed using rabbit IgG. Goat antibody to the monovalent hapten methotrexate behaved anomalously: for each concentration of IgG tested, there was an optimal amount of methotrexate beads that gave maximum binding of [125I]PA. In the other immune systems, for each antibody concentration maximum binding of tracer was a function only of the amount of immobilized antigen added. In contrast to the results obtained with solid-phase antigen, solutions containing antibody and amounts of antigen ranging from large antigen excess to antibody excess to antibody excess failed to react significantly with PA or [125I]PA.

Animals↗

PubMed2005

Synergism of rotenone by piperonyl butoxide in Haemonchus contortus and Trichostrongylus colubriformis in vitro: potential for drug-synergism through inhibition of nematode oxidative detoxification pathways.

The anthelmintic properties of rotenone and its activity in combination with the cytochrome P450 inhibitor piperonyl butoxide, were examined in in vitro assays with adults and larvae of Haemonchus contortus and larvae of Trichostrongylus colubriformis. Rotenone was toxic to larvae of both species, with LC(50) values in larval development assays of 0.54 and 0.64 microg/ml for H. contortus and T. colubriformis, respectively. The compound also caused complete cessation of movement in adult H. contortus after 72 h at a concentration of 20 microg/ml. Toxicity of rotenone towards the larvae of both species was increased in the presence of piperonyl butoxide (synergism ratios of 3-4-fold at the LC(50)) and the activity against adult H. contortus was also significantly enhanced following pre-treatment with piperonyl butoxide. This significant synergism suggests that these nematode species are able to utilize a cytochrome P450 enzyme system to detoxify rotenone and indicates that a role may exist for cytochrome P450 inhibitors to act as synergists for other anthelmintics which are susceptible to oxidative metabolism within the nematode.

Animals↗

PubMed2005

Recombinant nucleoprotein-based serological diagnosis of Crimean-Congo hemorrhagic fever virus infections.

An enzyme-linked immunosorbent assay (ELISA) using recombinant nucleoprotein (rNP) was reported for the detection of immunoglobulin G (IgG) antibodies to Crimean-Congo hemorrhagic fever (CCHF) virus (CCHFV). The immunoglobulin M (IgM)-capture ELISA was developed for the diagnosis of CCHFV infections, using CCHFV rNP as an antigen. These newly developed assays were applied to a study of a CCHF-outbreak and evaluated with sera collected from patients diagnosed as having CCHF by positive reverse transcription-polymerase chain reaction (RT-PCR) and by detection of IgG response. IgM antibodies to CCHFV were detected in 10 of the 13 patients. IgM antibodies to the rNP of CCHFV were detected by the CCHFV rNP-based IgM-capture ELISA in all 6 patients in whom IgG responses were demonstrated, while it was not detected in the 10 patients in whom IgG responses were not demonstrated. Furthermore, the IgM antibodies were detected in 6 of the 61 residents living a CCHF endemic area during the endemic season, while it was not detected in any of the 48 Japanese residents that had never visited the CCHF endemic area. It is concluded that this newly developed CCHFV rNP-based IgM-capture ELISA is a useful method for the diagnosis of CCHFV infections.

Adolescent↗

PubMed2005

Quantitative measurement of IgE antibodies to purified allergens using streptavidin linked to a high-capacity solid phase.

BACKGROUND: Commercially available assays for IgE antibody provide results in international units per milliliter for many allergen extracts, but this is not easily achieved with purified or novel allergens. OBJECTIVE: To develop assays for IgE antibody suitable for purified or novel allergens by using a commercially available immunosorbent. METHODS: Streptavidin coupled to a high-capacity immunosorbent (CAP) was used to bind biotinylated purified allergens from mite (Der p 1 and Der p 2), cat (Fel d 1), and dog (Can f 1). Assays for IgE antibody to these allergens were performed on sera from children (asthma and control) as well as adults with atopic dermatitis. RESULTS: The results were validated by serial dilution of sera with high and low levels of IgE antibody and were quantitated in international units per milliliter by using a standard curve. Values for IgE antibody to Der p 1, Der p 2, and Fel d 1 correlated with values obtained with the allergen extracts (r2 = 0.80, 0.84, and 0.95, respectively; P < .001 in each case). Furthermore, the values for IgE antibody in sera from children with high exposure to mite and cat allergens demonstrated 10-fold higher levels of IgE antibody to Der p 1 and Der p 2 than to Fel d 1 (P < .001). CONCLUSION: The streptavidin immunosorbent technique provides a new method for quantifying IgE antibody to purified proteins. The results provide evidence about the high quantities of IgE antibody to purified inhalant allergens in patients with atopic dermatitis. In addition, the results demonstrate major differences in IgE antibodies specific for mite and cat allergens among children with high exposure to both allergens.

Adult↗

PubMed2006

Targeting pain-suppressed behaviors in preclinical assays of pain and analgesia: effects of morphine on acetic acid-suppressed feeding in C57BL/6J mice.

UNLABELLED: Pain increases the rate, frequency, or intensity of some behaviors (eg, withdrawal responses) and suppresses other behaviors (eg, feeding). Our laboratories are developing assays to test analgesic drug candidates using measurements of pain-suppressed rather than pain-elicited behaviors. Such assays may model important aspects of clinical pain and provide a means for distinguishing true analgesics from drugs that produce motor impairment. The present study compared effects of the mu opioid analgesic morphine and the nonanalgesic neuroleptic haloperidol on intraperitoneal acetic acid-induced writhing (a pain-elicited behavior) and suppression of feeding behavior (a pain-suppressed behavior). In feeding studies, C57BL/6J mice were given access to a dish containing 8 mL Ensure(trade mark) liquid food (0-100% in water) during daily sessions (7.5-120 min). Levels of consumption were dependent on both Ensure concentration and session duration. Intraperitoneal injection of acetic acid (0.10-0.56%) produced a time- and concentration-dependent decrease in Ensure consumption. Morphine (1 mg/kg) prevented both acid-induced writhing and acid-induced suppression of feeding, whereas the dopamine antagonist haloperidol inhibited writhing without preventing acid-induced suppression of feeding. The effects of morphine were time-dependent, selective for acid-suppressed feeding, and naltrexone-reversible. These results suggest that assays of pain-suppressed behaviors may complement assays of pain-elicited behaviors in preclinical studies of candidate analgesics. PERSPECTIVE: This paper presents a new preclinical strategy for assessing pain and analgesia in mice that is congruent with current methods of pain assessment in the clinic. This strategy may therefore be a useful complement to more traditional procedures for assessing pain and analgesia.

Acetic Acid↗

PubMedDate not supplied

Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR.

A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.

Amidohydrolases↗

PubMed2003

Immunoradiometric assay (IRMA) for human follicle stimulating hormone (FSH) and luteinizing hormone (LH) using common avidin solid phase.

This paper describes the use of avidin-biotin interaction as an affinity system, wherein avidin immobilized magnetizable particles (cellulose) are used as a common separation system in immunoradiometric assay (IRMA) for hormones of the human reproductive system, human follicle stimulating hormone (FSH), and luteinizing hormone (LH). Biotinylated probe was prepared by biotinylation of specific monoclonal antibody for respective antigen using the caproyl derivative of biotin N-hydroxysuccinimide. The detector antibody for the respective antigen was radiolabelled with 125I by a chloramine-T oxidation method and purified by gel filtration. In the IRMA procedure, standard/sample, respective biotinylated, and radiolabelled antibody as a single reagent, and avidin solid phase were added simultaneously to the assay tubes. After incubation for 3 h with shaking, the bound complex was quantitated for its radioactivity associated with the common avidin solid phase. Results showed that the developed assay protocol is applicable to IRMA of FSH and LH with good precision (intra and inter assay CV less than 8% and 11%, respectively), good assay range (0-200 mIU/mL) and analytical recovery (87-110%). The assay could detect 0.5 mIU/mL and 0.9 mIU/mL of FSH and LH, respectively, and showed good correlation with commercially available kits (FSH y = 0.98x + 0.21 and LH y = 0.99x + 0.18).

Antibodies↗

PubMedDate not supplied

Biogenetic effects of opiates.

Our laboratories have shown that opiate addicts have higher chromosome damage and sister chromatid exchange frequencies, and that these effects are more pronounced in the addicts when we employ enhanced culturing assays developed in our laboratory. We have also demonstrated that opiates diminish DNA repair capacity and reduce immunoresponsiveness as measured by T-cell E-rosetting and other assays. These interactions of opiates with T-lymphocytes may regulate cell metabolism and could thereby be responsible for the sensitivity of cells from opiate addicts to both genotoxic damage and immunological effects.

Abnormalities, Drug-Induced↗

PubMed1990

Recommendations for collection of laboratory specimens associated with outbreaks of gastroenteritis.

Recent discoveries have implicated a number of "new" (i.e., previously unrecognized) infectious agents as important causes of outbreaks of gastroenteritis. Unfortunately, the ability to detect these agents in an outbreak can be limited by two factors: 1) the lack of appropriate assays-many of which are still in developmental stages and are not readily available to clinical laboratories, and 2) inadequately or improperly collected specimens. At CDC, many newly developed assays are being used for research and for outbreak investigations. The information in this report is especially intended for public health agencies that collaborate with CDC in investigating outbreaks of gastroenteritis. The report provides an update on guidelines and recommendations for the proper collection of specimens to be sent to CDC, gives general background information concerning some recently discovered pathogens, lists some of the tests available at CDC, and provides a list of CDC contacts. The guidelines and the general information provided on causes of outbreaks of gastroenteritis can be also used by public health workers for investigations when specific testing is available and appropriate.

Adult↗

PubMed1975

[Radioimmunoassay of synthetic steroids].

The sensitivity of a radioimmunoassay depends on the intrinsic association constant of the interaction between ligand and antibody. Its specificity depends on the position of the chain which forms the link with the antigen. Thus, an antibody specific of estradiol has been obtained by coupling estradiol to albumin via a chain at position 7. For synthetic steroids the structure of which is sufficiency different from that of natural hormones, the requirements for a sensitive assay method not involving chromatography are simply maximum affinity and positioning of the couple at a site which does not undergo metabolic attack. These criteria were used to develop assays for R 2858 and R 2453 which obviate the need to administer radioactive product in clinical pharmacology. Cross-reaction with structural analogs may be used to assay competitors. Thus, R 2323 antibody, highly specific for endogenous steroids, may be used to assay other trienes such as R 1697 (trenbolone) and R 2010 (norgestrienone).

Antibody Specificity↗