SEARCH · PubMed Health

Results for “Interspersed Repetitive Sequences”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 595 records · Page 33Linked to original sources

PubMed1986

The population biology of transposable elements.

A transposable element can be defined as a DNA sequence capable of moving to new sites in the genome. Such DNA sequences have been described in a wide range of organisms. The evolutionary processes affecting transposable elements can thus be divided into two categories: changes in sequence and changes in genomic location. As with other types of evolutionary change, the nature of the evolutionary process will be reflected in the extent and type of genetic variation existing in wild populations. Quantitative models of the evolution of transposable element sequences and positions will be outlined, and related to relevant data. The extent to which models designed to describe obvious transposable elements such as the mobile sequences of Drosophila are also applicable to interspersed repetitive DNAs from other species will be discussed.

Animals↗

PubMed1976

DNA sequence organization in the lepidopteran Antheraea pernyi.

A large fraction of the genome of the lepidopteran Antheraea pernyi consists of interspersed single-copy sequences and repetitive DNA sequences of 300 nucleotide average length. Most of the single-copy sequences are about 800 nucleotides long and a minority are considerably longer. Thus, the organization of the DNA sequences of this insect is similar to that of most higher organisms and different from that of Drosophila.

Animals↗

PubMed1981

Two small RNAs encoded by Epstein-Barr virus and complexed with protein are precipitated by antibodies from patients with systemic lupus erythematosus.

Primate cells harboring the Epstein-Barr virus (EBV) genome synthesize large amounts of two small RNAs:EBER 1 and EBER 2 (EBV-encoded RNA). These RNAs are approximately 180 nucleotides long, possess 5' pppA termini, and lack poly(A). They have different T1 and pancreatic RNase digestion fingerprints. They are not found in normal B lymphocytes, in transformed B lymphocytes that lack EBV DNA, in T lymphocytes transformed by Herpesvirus ateles, or in a variety of other nonlymphoid mammalian cells. Hybridization analyses indicate that EBER 1 and EBER 2 are encoded by the EcoRI-J fragment of EBV (B95-8) DNA. In vivo both RNAs are associated with protein(s), allowing their specific precipitation by the systemic lupus erythematosus-associated antibody anti-La. The La antigen in uninfected mammalian cells consists of a heterogeneous class of small ribonucleoprotein particles, some of whose RNA components exhibit sequence homology with a highly repetitive, interspersed class of human DNA designated the Alu family. Possible functions for EBER 1 and EBER 2 in infection and cell transformation by EBV and their potential relationship to the pathogenesis of systemic lupus erythematosus are discussed.

Antibodies↗

PubMed1996

An integrated map of the genome of the tubercle bacillus, Mycobacterium tuberculosis H37Rv, and comparison with Mycobacterium leprae.

An integrated map of the genome of the tubercle bacillus, Mycobacterium tuberculosis, was constructed by using a twin-pronged approach. Pulsed-field gel electrophoretic analysis enabled cleavage sites for Asn I and Dra I to be positioned on the 4.4-Mb circular chromosome, while, in parallel, clones from two cosmid libraries were ordered into contigs by means of fingerprinting and hybridization mapping. The resultant contig map was readily correlated with the physical map of the genome via the landmarked restriction sites. Over 165 genes and markers were localized on the integrated map, thus enabling comparisons with the leprosy bacillus, Mycobacterium leprae, to be undertaken. Mycobacterial genomes appear to have evolved as mosaic structures since extended segments with conserved gene order and organization are interspersed with different flanking regions. Repetitive sequences and insertion elements are highly abundant in M. tuberculosis, but the distribution of IS6110 is apparently nonrandom.

Chromosome Mapping↗

PubMed1984

Localization of the L1Md family of repeated sequences in the mouse albumin-alpha-fetoprotein gene complex.

Studies on the beta-globin gene complex in the mouse have demonstrated the existence of repeated DNA sequences interspersed throughout the intergenic regions (1,2). These sequences are members of families of middle repetitive sequences and have been mapped to specific intergenic sites in the 60 kbp beta-globin complex. In this study we present evidence that members of this middle repetitive family of DNA sequences, the L1Md family, are interspersed throughout the mouse albumin and alpha-fetoprotein gene complex. Unlike those of the beta-globin complex, all of which are found in the intergenic regions, these sequences are localized within intron 12 of the albumin gene and intron 3 of the AFP gene as well as twice in the 13.5 kbp intergenic region that links the albumin gene to the AFP gene.

Animals↗

PubMed1984

Interspersed poly(A) RNAs of amphibian oocytes are not translatable.

The poly(A) RNA of the Xenopus oocytes has been shown to include both single copy and interspersed transcripts. Interspersed maternal poly(A) RNAs contain repetitive sequence elements distributed within regions transcribed from single copy sequences. When renatured these RNAs form partially double-stranded RNA networks, and as shown earlier this can be utilized for preparative separation of interspersed maternal transcripts from maternal transcripts that remain single-stranded after renaturation (Anderson et al., 1982). The translational activity of these RNA fractions was tested in vitro, in wheat germ and reticulocyte systems. While the single-stranded fractions supported protein synthesis, the interspersed oocyte RNAs displayed little translational activity. Translational activity was measured in vivo by injection into the Xenopus oocyte. Oocytes previously injected with globin mRNA were injected with increasing amounts of single-stranded, double-stranded, or denatured double-stranded RNA fractions, and the amount of globin synthesis was determined. It was found that single-stranded RNA competes with globin mRNA for the limited translational apparatus of the oocyte, as manifested by a quantitative reduction of globin synthesis. However, globin synthesis was not affected when double-stranded RNA, either in renatured or denatured form, was injected. We conclude that the interspersed RNAs are not translated within the oocyte. The amount of single and double-stranded RNAs loaded onto polysomes in the injected oocytes was also determined. Sixty seven per cent of radio-iodinated single-stranded RNA pelleted with polysomes in injected oocytes, whereas less than 20% of similarly labeled double-stranded RNA pelleted with polysomes. This value is similar to that obtained when partially hydrolyzed RNA is injected, suggesting again that essentially none of the interspersed RNA is translated in vivo. The significance of these findings in relation to translational regulation during oogenesis and early development is discussed.

Animals↗

PubMed2006

RNA editing level in the mouse is determined by the genomic repeat repertoire.

A-to-I RNA editing is the conversion of adenosine to inosine in double-stranded cellular and viral RNAs. Recently, abundant editing of human transcripts affecting thousands of genes has been reported. Most editing sites are confined to the primate-specific Alu repeats. Notably, the editing level in mouse was shown to be much lower. In order to find the reason for this dramatic difference, here we identify editing sites within mouse repeats and analyze the sequence properties required for RNA editing. Our results show that the overall rate of RNA editing is determined by specific properties of different repeat families such as abundance, length, and divergence. We show that the striking difference in editing levels between human and mouse is mostly due to the higher divergence of the different mouse repeats.

Animals↗

PubMed2001

Selective Differential Display of RNAs containing interspersed repeats: analysis of changes in the transcription of HERV-K LTRs in germ cell tumors.

A technique for the Selective Differential Display of RNAs containing Interspersed Repeats (SDDIR) has been elaborated. SDDIR involves two main steps: (1) selective amplification by RT-PCR of a subset of the total cellular RNA containing a certain type of repetitive element, and (2) side-by-side display of the amplicons derived from the tissues under comparison by means of gel electrophoresis in parallel lanes. The technique was used to compare the expression of transcripts containing LTR (Long Terminal Repeat) sequences derived from human endogenous retrovirus K (HERV-K) in testicular germ cell tumors and in corresponding normal tissue. SDDIR enabled us to obtain an overview of LTRs represented in the total transcribed fraction and to reveal differences in transcription patterns of the LTRs in normal and tumor tissues. An unexpectedly large number of LTRs was found to be transcribed, and the levels of many of the transcripts differed between normal and tumor tissues.

Base Sequence↗

PubMed1986

Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element.

Animals↗

PubMed2004

Use of mycobacterial interspersed repetitive unit-variable-number tandem repeat typing to examine genetic diversity of Mycobacterium tuberculosis in Singapore.

Strain typing using variable-number tandem repeats of mycobacterial interspersed repetitive units (MIRU-VNTR) is a powerful tool for studying the epidemiology and genetic relationships of Mycobacterium tuberculosis isolates. For this study, isolates from 291 patients in Singapore were genotyped by this method. One hundred sixty-six distinct MIRU-VNTR patterns were detected. One hundred sixty-two strains were grouped into 1 of 35 different MIRU-VNTR clusters and 131 isolates were unique. In this sample collection, 9 of the 12 MIRU-VNTR loci were moderately or highly discriminative according to their allelic diversities. The Hunter-Gaston discriminatory index was 0.975, indicating the high power of discrimination of MIRU-VNTR typing. By direct comparisons with previously typed MIRU-VNTR patterns and by genetic relationship analyses, we could identify and clearly define four epidemic groups of M. tuberculosis in our sample, corresponding to the W/Beijing, East-Africa-Indian, Haarlem, and Delhi genotype families. Furthermore, MIRU-VNTR typing was able to clearly distinguish ancestral and modern M. tuberculosis strains as defined by TbD1 genomic deletion analysis. These results indicate that MIRU-VNTR typing can be a useful first-line tool for studying the genetic diversity of M. tuberculosis isolates in a large urban setting such as Singapore.

Alleles↗

PubMed1993

Paucity of novel short interspersed repetitive element (SINE) families in human DNA and isolation of a novel MER repeat.

An extensive compilation of renaturation rate data for human DNA is presented as an empirical guide for genomic hybridization studies and to document as accurately as possible the repetitive sequence content of the human genome. Approximately 15% of the genome renatures with heterogeneous rates characteristic of moderately repetitive sequences. Cross hybridization studies of this fraction with known repetitive sequences show that it is largely composed of known moderately repetitive sequences and contaminating highly repetitive sequences. These findings limit the maximum possible abundance of unidentified families of short interspersed elements (SINEs) in human DNA. Exhaustive analysis by subtractive hybridization of a small library constructed from short fragments of repetitive sequences yields few additional new SINEs, again suggesting the limited abundance of such sequences.

Base Sequence↗

PubMed2000

Genomic organization of the human metabotropic glutamate receptor subtype 3.

In this study, the genomic organization of the human metabotropic glutamate receptor subtype 3 (mGluR3) gene has been determined. We have identified two transcription initiation sites and the polyadenylation signal by using 5'-rapid amplification of cDNA ends (RACE) and 3'-RACE, respectively. The exon/intron organization of the human mGluR3 gene revealed the presence of 6 exons separated by 5 introns. The size of introns varied from 10.4 to 120 kbp that contained consensus sequences for repetitive elements such as Alu and long interspersed elements. A putative promoter region flanking the 5' sequence of exon 1 was identified by computer-aided analysis. The putative promoter region was characterized by the presence of a CAAT and GC box, and the absence of a TATA box or CpG islands. Several putative binding sites for transcription factors were also identified. In addition, we have isolated, from a mouse genomic library, part of the mouse mGluR3 gene and found it to correspond to exon 2 in the human mGluR3 gene. The mouse mGluR3 gene was then mapped by fluorescent in situ hybridization analysis to chromosome 5qA2.

Animals↗

PubMed1992

Characterization of AluI repeats of zebrafish (Brachydanio rerio).

Two families of repetitive DNA sequences were isolated from the zebrafish genome and characterized. Eight different sequences were sequenced and classified by two standards, their (G + C) composition and their lengths. For convenience, the sequences were first divided into two types. Type I was (A + T)-rich, was repeated approximately 500,000 times, and constituted approximately 5% of the zebrafish genome. Type II was (G + C)-rich, was reiterated approximately 90,000 times, and comprised approximately 0.5% of the genome. Agarose gel electrophoresis of zebrafish DNA cleaved with AluI revealed three distinguishable bands of repetitive fragments: large (approximately 180 bp, designated RFAL), medium (approximately 140 bp, RFAM), and small (approximately 90 bp, RFAS). The RFAL fragments contained both type I and type II sequences. Limited digestion of genomic DNA indicated that RFAL and RFAM were tandemly arranged in the genome, whereas RFAS showed a mixed pattern of both tandem and interspersed repeated arrangements. Although inclusion of a repetitive sequence in a transgenic construct did not appreciably accelerate homologous integration of transgenes into the zebrafish genome, the AluI sequences could facilitate transgene mapping following chromosomal integration.

Animals↗

PubMed1979

Distribution pattern and enzymic hypermethylation of inverted repetitive DNA sequences in P815 mastocytoma cells.

A specific class of DNA sequences, the inverted repetitive sequences, forms a double-stranded structure within a single linear polynucleotide chain in denatured DNA. The reassociation process is unimolecular and occurs very fast. Quantitative analyses have shown that in mouse P815 cells these sequences comprise about 4% of the nuclear DNA and are interspersed within sequences of other degrees of repetitiveness. After labeling the cells with L-[Me-3H]methionine and [14C]deoxycytidine, relative rates of enzymic DNA methylation were computed on the basis of radioactivities found in pyrimidine residues of the nuclear DNA. The results indicate that in P815 cells, DNA of inverted repetitive sequences is methylated to a level about 50% higher than the normal repetitive DNA sequences and to about 300% higher than the unique and intermediary intermediatry sequences. The biological function of the inverted repetitive sequences, as well as of the role of enzymic methylation of DNA remains unknown.

Animals↗

PubMed1999

A ribosomal orphon sequence from Xenopus laevis flanked by novel low copy number repetitive elements.

We have used a differential cloning approach to isolate ribosomal/non-ribosomal frontier sequences from Xenopus laevis. A ribosomal intergenic spacer sequence (IGS) was cloned and shown not to be physically linked with the ribosomal locus. This ribosomal orphon contained the IGS sequences found immediately downstream of the 28S gene and included an array of enhancer repetitions and a non-functional spacer promoter. The orphon sequence was flanked by a member of the novel 'Frt' low copy repetitive element family. Three individual Frt repeats were sequenced and all members of this family were shown to lie clustered at two chromosomal sites, one of which contained the ribosomal orphon. One of the Frt elements contained an insertion of 297 bp that showed extensive homology to sequences within at least three other Xenopus genes. Each homology region was flanked by members of the T2 family of short interspersed repetitive elements, (SINEs), and by its target insertion sequence, suggesting multiple translocation events. The data are discussed in terms of the evolution of the ribosomal gene locus.

Animals↗

PubMed2003

Mycobacterial interspersed repetitive units (MIRU) differentiate Mycobacterium avium subspecies paratuberculosis from other species of the Mycobacterium avium complex.

Mycobacterial interspersed repetitive units (MIRU) comprise short tandem repeat structures found at multiple loci throughout the Mycobacterium tuberculosis genome and have been used for typing these pathogens. We have identified MIRU at 18 conserved loci throughout the common portions of the Mycobacterium avium subspecies paratuberculosis (MAP) and M. avium subspecies avium (MAA) genomes. Six of these loci were found to differ between MAA and MAP in the number of tandem repeat motifs occurring at each MIRU locus. Locus specific PCR at 4 of these loci segregated MAP into two major groups, which could be differentiated from ovine-pigmented strains of MAP and the MAP vaccine strain 316F. The same PCR differentiated MAA into five MIRU profiles. PCR at either MIRU locus 1 or MIRU locus 4 distinguished between MAP and all other M. avium complex (MAC) tested. PCR at both loci 1 and 4 also distinguished MAP from Mycobacterium intracellulare. MIRU typing may provide an additional simple and rapid procedure for the differentiation between MAP and other MAC.

Amino Acid Sequence↗

PubMed1990

Selective cloning and sequence analysis of the human L1 (LINE-1) sequences which transposed in the relatively recent past.

L1 (LINE-1), a long interspersed repetitive DNA family of mammalian genomes, is thought to be a sequence family derived from a retrotransposon-like element(s), but its actively transposable unit(s) has not been identified yet. We developed a novel method for selective isolation of the human L1 sequences which transposed in a relatively recent past and may have still retained a feature of the 'active L1' unit. From the inspection of the nucleotide sequences, we conjectured that the 'active L1' or 'nearly active L1' units should have a high content of the CpG dinucleotide sequence, a mutation hot spot sequence, and contain several sites for rare cutters such as BssH II and Nar I at their 5' terminal regions. Using these rare cutter sites as selection markers, the L1 sequences were isolated, which had the high content of CpG at the 5' terminal regions and over 90% homology to L1 transcripts found in a human teratocarcinoma cell line. These L1s were shown to be 'relatively new L1' units which had integrated into chromosomes within these several million years during evolution. From the sequence data of these L1s and L1 cDNA, a consensus sequence of the 5' terminal region of high CpG L1s were constructed. A region of the consensus sequence showed about 69% homology to the 5' terminal region of Drosophila jockey element.

Animals↗

PubMed1995

Evolution of the active sequences of the HpaI short interspersed elements.

Ninety-nine members of the salmonid HpaI and AvaIII families of short interspersed repetitive elements (SINEs) were aligned and a general consensus sequence was deduced. The presence of 26 correlated changes in nucleotides (diagnostic nucleotides) from those in the consensus sequence allowed us to divide the members of the HpaI family into 12 subfamilies and those of the AvaIII family into two subfamilies. On the basis of the average sequence divergences and the phylogenetic distributions of the subfamilies, the relative antiquity of the subfamilies and the process of sequential changes in the respective source sequences were inferred. Despite the higher mutation rates of CG dinucleotides in individual dispersed members, no hypermutability of CG positions was observed in changes in the source sequences. This result suggests that sequences of SINEs located in a nonmethylated or hypomethylated genomic region could have been selected as source sequences for retroposition and/or that some CG sites are the parts of recognition sequences of retropositional machineries.

Animals↗