SEARCH · PubMed Health

Results for “SLE”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 667 records · Page 37Linked to original sources

PubMed1993

[Leptomeningeal abnormality on Gd-DTPA enhanced MRI in a case of SLE presenting diffuse organic brain syndrome].

Involvement of the central nervous system associated with SLE (CNS lupus) is not rare. Two types of CNS lupus are noted clinically; one group manifesting focal neurological symptoms and another group showing mental symptoms. Though it is well known that neurological symptoms are caused by arteritis and thrombus, pathophysiological mechanisms leading to mental symptoms remain obscure and there is no established clinical evidence responsible for these symptoms. A 41-year-old woman was confused and her attention was markedly impaired. Her mental symptoms consisted of disorientation, restlessness, euphoria and emotional incontinence. There were neither focal neurological signs nor meningeal signs. Cerebrospinal fluid (CSF) examination showed increased number of polymorphonuclear cells and permeability of the blood-brain barrier, calculated based on the CSF/plasma protein ratio, was also elevated. Repeated bacteriological examinations revealed to be negative. Gd-DTPA MRI demonstrated diffuse enhancement of the cerebral leptomeninges. Methylprednisolone pulse therapy ameliorated her mental deterioration effectively, and subsequently the leptomeningeal enhancement with Gd-DTPA MRI disappeared in parallel. These radiological and laboratory findings suggest that SLE itself causes inflammation of vessels in the leptomeninges and adjacent cerebral cortex. We consider mental symptoms associated with SLE may be caused, at least in part, by this mechanism. To our knowledge, we could not find similar reports in the literature. Gd-DTPA enhanced MRI seems to be of clinical use for making diagnosis, evaluating clinical activity and understanding of CNS lupus.

Adult↗

PubMed1993

[SLE (systemic lupus erythematosus)-related clinical features in dogs].

Three dogs presented with lameness and/or vague clinical signs. The results of immunological tests were suggestive of a SLE-related syndrome. ANA (antinuclear antibodies) titres were very high, 1:40960 in one of the dogs, and antibodies against single-stranded DNA were detected. Complement levels were very low in two dogs. Antibodies against histones were detected in both the serum and the synovial fluid of one dog. In another dog there was evidence of high concentrations of PCNA antibodies, which in humans are specific for SLE. It is concluded that the three dogs showed signs of a syndrome possibly related to SLE. The description of the clinical signs and of the laboratory diagnostics serve as a clinical demonstration to draw colleagues' attention to this nosologically interesting clinical syndrome and to the need to request specific immunological tests when this syndrome is suspected.

Animals↗

PubMed1993

The relevance of antimalarial therapy with regard to thrombosis, hypercholesterolemia and cytokines in SLE.

Hydroxychloroquine has several less well-known actions that may have clinical relevance in treating systemic lupus erythematosus (SLE). (1) Hydroxychloroquine has a possible anti-thrombotic action. It is a platelet inhibitor and appears to decrease the risk of thromboembolism in patients with anticardiolipin antibodies. (2) Hydroxychloroquine is associated with lower serum cholesterol and low-density lipoprotein levels compared to those present in patients who are taking corticosteroids but not antimalarials for SLE. (3) It may also decrease abnormal levels of cytokines. Interleukin-6 (IL-6), soluble CD8 and soluble IL-2 receptors (sIL-2R) are lower in patients taking antimalarials compared to those on corticosteroids alone or on neither medication. Serum levels of CD8 and sIL-2R decrease after 6 weeks of hydroxychloroquine treatment. These findings may help explain the favorable response of SLE patients treated with antimalarials.

Animals↗

PubMedDate not supplied

Levels of lupus autoantibodies in pregnant SLE patients: correlations with disease activity and pregnancy outcome.

OBJECTIVE: To follow the levels of lupus autoantibodies throughout pregnancy in a large cohort of pregnant SLE patients, and to examine whether they correlate with disease activity and pregnancy outcome. METHODS: 54 pregnancies in 46 SLE patients, and 70 control pregnant women were followed in the study. All patients were receiving steroid treatment. Titers of antibodies to ssDNA, dsDNA, histones, cardiolipin (CL) and phosphatidylserine (PS) were determined at the first, second, and third trimester and post-partum by ELISA. RESULTS: Overall the average levels of autoantibodies in all the patients were within the normal range, except for the average levels of anti-dsDNA antibodies which were elevated during the second trimester. Eight women (14.5%) had active disease during pregnancy, and there was a significant correlation between the levels of anti-dsDNA and the risk of disease activity (p = 0.0225). There were 7 fetal losses. There was a tendency for correlation between elevated anti-dsDNA levels, and anti-CL levels and the risk of fetal loss; however, this did not reach statistical significance (p = 0.0685, and 0.0881, respectively). There was a significant correlation between the levels of anti-dsDNA antibodies and the risk of preterm delivery (p = 0.0331). CONCLUSIONS: Pregnancy in SLE patients is associated with significant complications to both the mother and the fetus. Anti-dsDNA levels seem to correlate with the risk of disease exacerbation, and prematurity. Elevated levels of anti-dsDNA and anti-CL may suggest an increased risk of fetal loss.

Adult↗

PubMedDate not supplied

Lack of correlation among the 3 outcomes describing SLE: disease activity, damage and quality of life.

OBJECTIVE: The aim of the this study was to correlate three outcome measures in patients with SLE, namely disease activity, damage, and quality of life. METHODS: One hundred and five SLE patients completed the Medical Outcome Survey (MOS) SF-20 during their regular clinic visit. Disease activity (SLEDAI) and damage (SLICC/ACR Damage Index) were assessed according to a standard protocol. Statistical analyses included the Pearson correlation coefficients, a logistic regression, and a linear regression analysis. RESULTS: There was no correlation between the SLEDAI and SLICC/ACR DI. There was no correlation between the SLICC/ACR DI and any of the MOS domains by Pearson correlation. Although a statistical correlation was demonstrated between the SLEDAI score and the social functioning and health perception domains of the MOS SF-20, there were not clinically important. CONCLUSION: Thus, the three outcomes of disease activity, accumulated damage, and health status remain important independent outcome measures in the assessment of prognosis in patients with SLE.

Adolescent↗

PubMed1996

Comparative value of urinalysis, urine cytology and urine sIL2R in the assessment of renal disease in patients with systemic lupus erythematosus (SLE).

Serial immunological testing has been recently proposed for monitoring patients with lupus nephritis as routine serological tests have shown sub-optimal correlation with clinical status. To assess the value of urine cytology and urine sIL2R in the evaluation of patients with SLE, in particular those with lupus nephritis, we conducted a prospective double-blind study of 31 patients with SLE, during an 18-month period. A comparison of routine urinalysis with urine cytology and urine sIL2R was performed in 84 samples: 15 from patients without a history of renal involvement and 69 from patients with a history of renal involvement. A high urine cytology score (> or = 6), particularly in the presence of lymphoblasts, plasma cells or monocytes, was significantly associated with lupus nephritis in relapse. Urine sIL2R levels were significantly elevated during all SLE relapses, unrelated to the presence of renal involvement. Fifteen urine specimens were obtained at the time of a kidney biopsy: 9 with active lesions and 6 with inactive renal disease. UC score was 2.0 +/- 1.89 for those with absent activity, 8.4 +/- 3.4 for mild activity and 11.0 +/- 2.4 for moderate/severe activity (p < 0.001 between active vs inactive disease). No urinalysis parameter alone permitted distinguishing the degree of renal disease activity. In the subgroup of patients with renal disease urinalysis was overall less accurate than urine cytology or urinary sIL2R levels for predicting renal disease activity defined by biopsy. Urine cytology and urine sIL2R proved to be reliable measures of lupus activity.

Adolescent↗

PubMed1996

Systemic lupus erythematosus (SLE) presenting as acute pancreatitis--a case report.

Acute pancreatitis is an uncommon manifestation of systemic lupus erythematosus (SLE). In most reported cases, it occurs in the setting of SLE with multi-organ involvement. We report an unusual case of SLE in a Sri Lankan woman presenting with acute pancreatitis with the pancreas as the sole major organ affected. The diagnosis of acute pancreatitis was based on clinical features, serum and urinary amylase levels and computerised tomography. She responded well to high-dose corticosteroid. We also review the literature and discuss the prevalence, theories of pathogenesis and treatment of this condition.

Acute Disease↗

PubMed1997

[Reversible changes of cranial MRI in a girl with SLE].

The 11-year-old girl had hypertension and generalized tonic-clonic convulsions during the steroid pulse therapy. Her cranial T2-weighed MRI showed small areas of high signal intensity in the right occipital lobe. Her neurological findings were normal. After 2 months of steroid pulse therapy, multiple high signal intensities were demonstrated on T2-weighed MRI. After 5 months of the therapy, however, only a small T2-weighed MRI spot of high signal intensity in the white matter was observed, and the multiple lesions disappeared. On follow up, she did not show any neurological defects. It is postulated that not only steroid pulse therapy-induced hypertension but also SLE-induced angiopathy caused such flexible lesions. According to the literature, these lesions can be considered to be edema around small vessels. Such MRI findings have been reported in adult patients with SLE, but to our knowledge there have not been reports on children with SLE.

Brain↗

PubMed1996

[CpG motif in DNA from immune complexes of SLE patients augments expression of intercellular adhesion molecule-1 on endothelial cells].

The sequence of 9 DNA clones obtained from DNA-anti-DNA antibody immune complexes (IC) in 11 SLE patients was analyzed and the possible pathogenic role of the circulating DNA in SLE patients was discussed. Nucleic acid length of 9 cloned DNAs ranged from 87 to 312 base pairs(bp), with a mean length of 177 +/- 62bp, which were rich in guanine (G) + cytosine(C), CpG dinucleotide and palindromic sequences. Oligonucleotide TTTTCAATTCGAAGATGATT which contain the CpG motif in hexamer palindromic sequence segments in cloned DNA augmented the expression of ICAM-1 on the endothelial cells detected by FACS analysis and also augmented the gene expression of several cytokines such as interleukin-2, interleukin-6, interleukin-8 and tumor necrosis factor alpha. These data suggest that DNA in IC of SLE patients will augment expression of ICAM-1 on endothelial cells, resulting in exacerbation of vasculitis.

Antigen-Antibody Complex↗

PubMed1996

[A case of ASD with SLE treated with Carmeda BioActive surface circuit in cardiopulmonary bypass system].

A 61-year-old woman of ASD complicated with SLE was operated on. We used a heparin coating Carmeda BioActive Surface (CBS) in cardiopulmonary bypass circuit for the purpose to prevent the postoperative complications due to the reduced complement activation by SLE. This system could prevent the decline of the reduced complement activation during cardiopulmonary bypass and after operation. The management of steroid therapy for SLE patient, usefulness of heparin coating CBS system for hypocomplement disease were discussed.

Anti-Inflammatory Agents↗

PubMed1996

[Subjective happiness and psychological condition in SLE].

We reported the relationship between subjective happiness and psychological condition to investigate which factor effects the quality of life (QOL) in 18 patients with systemic lupus erythematosus (SLE) and compared them with age, sex and dose of steroid matched 18 patients with chronic glomerular nephritis (CGN). The patients were evaluated in morale scale-revised (Japanese version) which is a standard method of evaluating subjective happiness in relation to QOL. State-trait anxiety inventory (STAI) of Spielberger was used for evaluation of anxiety condition with self rating depression scale (SDS) of Zung in evaluation of depressive state. We examined the relationship between morale scale and SDS and morale scale and STAI. The relationship between morale scale and age; period of the disease, dose of steroid and activity were also investigated. There were no significant differences between the groups on morale scale, SDS and STAI and there were no significant correlations between morale scale and age; period of the disease and the dose of steroid in the both groups. There were correlations between morale scale and state and trait anxiety in the group with SLE and morale scale and trait anxiety in the group with CGN. We concluded that anxiety decreased the QOL in patients with SLE and CGN.

Adolescent↗

PubMed1997

[Two cases with SLE and MCTD developed after a long period of chronic arthritis that was initially diagnosed as JRA].

In order to discuss the diversity of clinical features and the difficulty in diagnosis of children with juvenile rheumatoid arthritis (JRA), we present two cases who have documented the development of systemic lupus erythematosus (SLE) and mixed connective tissue disease (MCTD) after a long period of disease characterized only by arthritis that was initially diagnosed as JRA. The first case was a girl diagnosed for her arthritic joints as polyarticular JRA at 15 years of age. At onset, she had Raynaud phenomenon but autoantibodies such as anti-nuclear antibody (ANA), anti-DNA antibody, and rheumatoid factor were negative. Five years after onset, she became ANA positive and 3 years later she became pregnant. During her pregnancy, she became positive for anti-DNA antibody without any signs of nephritis. One month after the delivery, however, she developed butterfly rash, carditis, nephritis, and was diagnosed as SLE. No destructive changes were observed in her joints though arthritis continued for 8 years form onset to pregnancy. The second case was a 3 years old girl who was diagnosed as polyarticular JRA. Treatment by aspirin induced complate remission after one year from the onset. However, 10 years after that remission, she developed Raynaud phenomenon and arthralgia in her knees and hip joints. Her laboratory findings showed hypergammaglobulinemia, positive ANA, positive anti-DNA antibody, positive anti-RNP antibody. She was eventually diagnosed as MCTD when she was found to have polymyositis by EMG and serum CK. In the present paper, two cases imply the difficulty in diagnosing JRA and diversity of rheumatic diseases such as JRA, SLE and MCTD. Closer and longer period of observation is essential for the JRA patients with nondestructive arthritis.

Adolescent↗

PubMedDate not supplied

SC5b-9 is the most sensitive marker in assessing disease activity in Brazilian SLE patients.

This study investigated whether increased plasma levels of terminal complement complex (SC5b-9) or split products correlate with disease activity and clinical manifestations in Brazilian systemic lupus erythematosus (SLE) patients. Comparisons with conventional measurements of complement and other inflammatory markers were also performed. Plasma levels of SC5b-9, C3a desArg, C1rs-C1Inhibitor, C3b(Bb)P, C3, C4, erythrocyte sedimentation rate (ESR) and mucoproteins (MP) were measured in 41 patients with SLE of different disease activity: 10 patients with none, 15 patients with mild, and 16 patients with moderate or severe activity. All parameters, with the exception of C3 and C3b(Bb)P, showed a statistically significant correlation with disease activity. Plasma levels of SC5b-9, C3a desArg, C4, CH50, ESR and MP revealed significant differences between the groups of patients without activity and those with moderate or severe disease. Although none of the variables were able to discriminate between patients without and those with mild activity, SC5b-9, C3a desArg, C4, ESR and mucoproteins showed significant differences between the patients with mild and those with moderate or severe disease. Among all the variables, SC5b-9 levels showed the most significant results and correlated well with the severity of the disease (p < 0.0005). Our data suggest that elevated levels of complement activation products, particularly of SC5b-9 are more sensitive markers in assessing disease activity than conventional laboratory diagnosis. Modern complement diagnosis is therefore recommended for monitoring disease progress in SLE patients.

Adolescent↗

PubMed1998

High prevalence of thrombocytopenia in SLE patients with a high level of anticardiolipin antibodies combined with lupus anticoagulant.

The relationship between thrombocytopenia and the level of anticardiolipin antibodies (aCL) and/or the existence of lupus anticoagulant (LA) ware studied in 146 patients with systemic lupus erythematosus (SLE). These patients were divided into six groups: A, those LA positive with a high level of aCL (>10 U/ml) (10 cases); B, those LA positive with a low level of aCL (3-10 U/ml) (15 cases); C, those LA positive but aCL negative (<3 U/ml) (12 cases); D, LA negatives with a high level of aCL (12 cases); E, LA negatives with a low level of aCL (16 cases); and F, aCL and LA double negatives (81 cases). The prevalence of thrombocytopenia (platelet count < or = 100 x 10(9)L) was by far the highest in group A (9/10 cases, 90.0%, P < 0.005, Fisher's exact probability test) as compared with group B (4/15 cases, 26.7%), group C (4/12 cases, 33.3%), group D (1/12 cases, 8.3%), group E (4/16 cases, 25.5%), and group F (9/81 cases, 11.1%). When the relationship between moderate thrombocytopenia and arterial or venous thrombosis was studied in these patients with SLE, thrombocytopenia was detected in 10 (83.3%, P < 0.005, Fisher's exact probability test) of 12 patients with arterial thrombosis; however, it was present in only 4 (23.5%) of 17 patients with venous thrombosis and in 14 (12.3%) of 114 patients without thrombosis. These findings suggest that a high aCL activity combined with LA positively reflects a high risk for both thrombocytopenia and arterial thrombosis.

Adolescent↗

PubMed1994

Autoimmune-thrombocytopenia and SLE in a patient with 5q-anomaly and deletion of the c-fms oncogene.

Autoimmune-thrombocytopenia was the striking feature in a patient with typical clinical symptoms of systemic lupus erythematosus (SLE), complement C4 deficiency, and positive lupus serology. However, myelodysplasia was found in the bone marrow and chromosome analysis revealed a deletion of the long arm of chromosome 5 (5q-anomaly), which was confirmed by a hemizygosity for the c-fms oncogene (CSF-1-receptor) on Southern blot. Autoimmune phenomena reported in conjunction with myelodysplastic syndromes (MDS), e.g., an elevation of antinuclear antibodies, are usually regarded as nonspecific. This case report suggests that SLE can occur in patients with MDS and that a concomitant autoimmune-thrombocytopenia may mask the typical signs of the 5q- syndrome.

Adult↗

PubMedDate not supplied

Retardation of colony growth of in vitro bone marrow culture using sera from patients with Felty's syndrome, disseminated lupus erythematosus (SLE), rheumatoid arthritis, and other disease states.

Whole sera and serum fractions from 24 patients with Felty's syndrome, 42 patients with systemic lupus erythematosus (SLE), and 48 patients with rheumatoid arthritis (RA), as well as 30 patients with miscellaneous acute and chronic disease states, were studied for their effect on numbers of mouse bone marrow colonies grown on soft agar in the presence of human colony stimulating factor. Significant early retardation of mouse bone marrow colony counts was recorded in 87.5 percent of Felty's sera, 43 percent of SLE sera, and 12.5 percent of sera from patients with uncomplicated RA. Forty percent of 30 other control patients with acute or chronic inflammatory diseases also showed this activity. No diminution was noted with any of 40 normal control sera. Degree of marrow colony retardation could be directly correlated to amounts of test serum added. No single serum fraction isolated by ion exchange chromatography, gel filtration, or electrophoresis was identified as solely responsible for marrow growth retardation; however lipoprotein fractions including chylomicrons, LDL and HDL showed inhibiting activity in various sera.

Animals↗

PubMedDate not supplied

Significance of persisting serologic abnormalities in SLE.

The significance of abnormal serum anti-DNA and complement levels persisting in SLE patients on treatment has been explored. Instances when serologic abnormalities returned to normal were followed by a significantly longer mean duration of remission. When anti-DNA persisted at abnormal levels, a more severe exacerbation was likely to follow, although this result was not the case for persisting hypocomplementemia. These data did not result from two variants of SLE, one mild and one severe, because druation of remission correlated directly with dosage of steroid. Randomly discovered abnormalities in anti-DNA and complement levels were of limited predictive value, because they frequently persisted for over 1 year before exacerbations occurred. Hypocomplementemia resolved spontaneously without recognizable exacerbation in nearly half the observed instances.

Adult↗

PubMedDate not supplied

IgG antilymphocyte antibodies in SLE detected by 125I protein A.

125I-labeled protein A was utilized to detect lymphocyte binding of IgG at 37 degrees C in 50 sera from patients with SLE. IgG binding was partially inhibited by preincubation of test cells with immune complexes in 50% of sera. In 10%, cytophilic Ig was increased by immune complex preincubation, and in 40% no appreciable change was recorded. With purified preparations of T and B cells, binding of SLE IgG at 37 degrees C was equal for both cell populations.

B-Lymphocytes↗