SEARCH · PubMed Health
Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
The nucleotide sequence of ribosomal 5S rRNA from a cellular slime mold Dictyostelium discoideum is GUAUACGGCCAUACUAGGUUGGAAACACAUCAUCCCGUUCGAUCUGAUA AGUAAAUCGACCUCAGGCCUUCCAAGUACUCUGGUUGGAGACAACAGGGGAACAUAGGGUGCUGUAUACU. A model for the secondary structure of this 5S rRNA is proposed. The sequence is more similar to those of animals (62% similarity on the average) rather than those of yeasts (56%).
Marine bacterioplankton diversity was examined by quantifying natural length variation in the 5' domain of small-subunit (SSU) rRNA genes (rDNA) amplified by PCR from a DNA sample from the Oregon coast. This new technique, length heterogeneity analysis by PCR (LH-PCR), determines the relative proportions of amplicons originating from different organisms by measuring the fluorescence emission of a labeled primer used in the amplification reaction. Relationships between the sizes of amplicons and gene phylogeny were predicted by an analysis of 366 SSU rDNA sequences from cultivated marine bacteria and from bacterial genes cloned directly from environmental samples. LH-PCR was used to compare the distribution of bacterioplankton SSU rDNAs from a coastal water sample with that of an SSU rDNA clone library prepared from the same sample and also to examine the distribution of genes in the PCR products from which the clone library was prepared. The analysis revealed that the relative frequencies of genes amplified from natural communities are highly reproducible for replicate sets of PCRs but that a bias possibly caused by the reannealing kinetics of product molecules can skew gene frequencies when PCR product concentrations exceed threshold values.
All known ribosomes of procaryotic organisms are made up of three rRNA components that are 23, 16, and 5S in size. We now report that in some Leptospira interrogans strains, the classical 23S rRNA is further processed to generate 14 and 17S rRNAs. This processing step was previously known to occur only in some eucaryotes and in a small group of procaryotes. The implications of this finding are discussed.
We present the complete sequence of the nuclear-encoded small-ribosomal-subunit RNA inferred from the cloned gene sequence of the dinoflagellate Prorocentrum micans. The dinoflagellate 17S rRNA sequence of 1798 nucleotides is contained in a family of 200 tandemly repeated genes per haploid genome. A tentative model of the secondary structure of P. micans 17S rRNA is presented. This sequence is compared with the small-ribosomal-subunit rRNA of Xenopus laevis (Animalia), Saccharomyces cerevisiae (Fungi), Zea mays (Planta), Dictyostelium discoideum (Protoctista), and Halobacterium volcanii (Monera). Although the secondary structure of the dinoflagellate 17S rRNA presents most of the eukaryotic characteristics, it contains sufficient archaeobacterial-like structural features to reinforce the view that dinoflagellates branch off very early from the eukaryotic lineage.
Most biochemical, computational and genetic approaches to gene finding assume the Central Dogma and look for genes that make mRNA and have ORFs. These approaches essentially do not work for one class of genes--the noncoding RNA. In all living organisms RNA is involved in a number of essential cell processes. Functional analysis of genome sequences has largely ignored RNA genes and their structures. Different RNA species including rRNA, tRNA, mRNA and sRNA (small RNA) are important structural, transfer, informational, and regulatory molecules containing complex folded conformations that participate in recognition and catalytic processes. Noncoding RNAs play an number of important structural, catalytic and regulatory roles in the cell. The size of the sRNA genes ranges from 70 to 500 nucleotides. Several transcripts of these genes are processed by RNAases and their final products are smaller. The encoding genes are localized between two ORFs and do not overlap with ORFs on the complementary DNA strand. As aptamers, some sRNA bind small molecular components (metal ions, peptides and nucleotides). This review summarizes recent data on the functions of prokaryotic sRNAs and approaches to their identification.
The organization of 18S and 26S rRNA in 14 plant species, belonging to 8 tribes of the cereal family was studied. In rDNA of all the cereals studied, except maize and reed, the similar character of localization of nucleotide sequences, recognized by restrictases BamHI and EcoRI in 18S and 26S rRNA genes was revealed. The structural organization of rDNA of sainfoin (Papilionaceae) was shown to differ from genes, coding for high molecular rRNA in cereals. The primary structure of subrepeat of non-transcribed rDNA spacer of diploid wheat Tr. urartu, consisting of 132 base pairs was determined. The given subrepeat was hybridized with BamHI-fragments of DNA from cereals and sainfoin. It is shown to hybridize with rDNA of all the cereals studied, and it hardly hybridizes with rDNA of maize and sorghum, but doesn't hybridize with rDNA of sainfoin. The conclusion is made that the size polymorphism of restriction fragments in the coding rDNA region and the level of similarity of subrepeats of rDNA of the non-transcribed spacer may help to reveal the phylogenetic affinity of plants, belonging to different tribes within one family.
Antisense strategy has high potential for curing diseases and studying gene functions by suppressing the translation step. For the strategy, it is essential to detect acceptor sites of antisense molecules on mRNA under physiological conditions. We propose a new analytical method for the detection of acceptor sites of antisense molecules with high sensitivity. 2'-O-Methyloligoribonucleotide containing 2'-O-(1-pyrenylmethyl)uridine (OMUpy) was chosen as the fluorescence probe. The fluorescence intensity due to the pyrene in single-stranded OMUpy was scarcely observed. When OMUpy was hybridized with the complementary oligoRNA, the fluorescence intensity at 375 nm was remarkably increased. It was found that the increase was derived from the localization of the pyrene by the measurements of time-resolved fluorescence spectroscopy, CD and UV absorption spectra. These results suggest that the change of the fluorescence intensity of OMUpy can be a useful index to monitor hybridization. In this study, we chose Escherichia coli. 16S-rRNA as the model RNA and chose seven regions for probing by OMUpy based on the reported secondary structure of 16S-rRNA. The fluorescence intensity of an equimolar mixture of OMUpy with 16S-rRNA varied depending on the sequence. In particular, the increment in the system of OMUpy-8, which can hybridize with region 887-896 nt of 16S-rRNA, was most significant among the systems. These results indicated that the site targeted by OMUpy-8 was exposed to regulatory molecules, and suggest that the method presented here is useful to design antisense molecules.
Protein translation is essential for all forms of life and is conducted by a macromolecular complex, the ribosome. Evolutionary changes in protein and RNA sequences can affect the 3D organization of structural features in ribosomes in different species. The most dramatic changes occur in animal mitochondria, whose genomes have been reduced and altered significantly. The RNA component of the mitochondrial ribosome (mitoribosome) is reduced in size, with a compensatory increase in protein content. Until recently, it was unclear how these changes affect the 3D structure of the mitoribosome. Here, we present a structural model of the large subunit of the mammalian mitoribosome developed by combining molecular modeling techniques with cryo-electron microscopic data at 12.1A resolution. The model contains 93% of the mitochondrial rRNA sequence and 16 mitochondrial ribosomal proteins in the large subunit of the mitoribosome. Despite the smaller mitochondrial rRNA, the spatial positions of RNA domains known to be involved directly in protein synthesis are essentially the same as in bacterial and archaeal ribosomes. However, the dramatic reduction in rRNA content necessitates evolution of unique structural features to maintain connectivity between RNA domains. The smaller rRNA sequence also limits the likelihood of tRNA binding at the E-site of the mitoribosome, and correlates with the reduced size of D-loops and T-loops in some animal mitochondrial tRNAs, suggesting co-evolution of mitochondrial rRNA and tRNA structures.
Analysis of length polymorphism of 16S rRNA genes terminal restriction fragments (T-RFLP analysis) was used to monitor the changes in the composition of the population of methanogens in enrichment cultures under high and low hydrogen concentrations. Hydrogen concentration was shown to determine the structure of a methanogenic community. High hydrogen concentration probably favors the hydrogen- and acetate-utilizing representatives of Methanosarcinaceae, while a more diverse methanogenic community is favored by low hydrogen concentrations.
We have developed a statistical method that is designed for analyzing potential RNA folded substructures. The statistical significance of RNA folding is assessed by the segment score. The segment score is defined as the difference between the lowest free energy calculated for the real biological sequence and the mean of the lowest free energies from random permutations of the real segment sequence, divided by the standard deviation of the random sample. This procedure was applied to the well-studied Escherichia coli 16S rRNA and potato spindle tuber viroid (PSTV) RNA. The results showed that the predictions of the locally significant secondary structures in these two molecules are in accord with the universally conserved local secondary structure elements (Gutell, Weiser & Noller, 1985, Prog. Nucl. Acid Res. molec. Biol. 32, 155-216; Riesner & Gross, 1985, A. Rev. Biochem. 54, 531-564). In addition, a statistical analysis indicated that the lowest free energies of a random sample set follow an approximately normal distribution. A reasonable size for the random sample set was determined statistically. Moreover, the statistical evaluation has been carried out using three different sets of energy rules--two sets (Salser, 1977, Cold Spring Harb. Symp. Quant Biol. 42, 985-1002; Freier, Kierzek, Jaeger, Sugimoto, Caruthers, Neilson & Turner, 1986, Proc. natn. Acad. Sci. U.S.A. 83, 9373-9377) take into account stacking energies and are based on experimental data and their computational extension (Salser, 1977)--the third set is a simplistic "unitary matrix" approach, where any base-pair is given a weight of "minus one" and an unpaired based is "zero". The Freier energy rules usually yield the strongest indication of significant folding region. However, the results derived from paired comparisons test don't provide sufficient evidence for concluding that a different set of energy rules is effective in changing the segment score level for local stem-loop structures in the 16S rRNA.
Mosaic structure of genes is shown for three out of four known types of RNA: transfer, ribosomal and messenger. At least three different mechanisms are involved in maturation of transcripts from these genes. The peculiarity of tRNA splicing is connected with the possibility of existence of tRNA molecules free of ribonucleoprotein complexes. The mode of Tetrahymena pre-tRNA self-splicing may also take place during maturation of other RNAs (rRNA of protozoa, ribosomal and messenger rRNA of lower fungi, plant messenger rRNA), which share the similar structure. The third type of mechanism is involved in splicing messenger RNA in eukaryotic cell nuclei.
The homologous ribosomal RNA species of all organisms can be folded into a common "core" secondary structure. In addition, eukaryotic rRNAs contain a large number of segments, located at fixed positions, that are highly variable in size and sequence from one organism to another. We have investigated the role of the two largest of these variable regions in Saccharomyces cerevisiae 25S rRNA, V13, and V3, by mutational analysis in a yeast strain that can be rendered completely dependent on the synthesis of mutant (pre-)rRNA. We found that approximately half of variable region V13 can be deleted without any phenotypic effect. The remaining portion, however, contains multiple structural features whose disturbance causes serious growth defects or lethality. Accumulation of 25S rRNA is strongly reduced by these mutations, at least in part because they inhibit processing of ITS2. Removal of even a relatively small portion of V3 also strongly reduces the cellular growth rate and larger deletions are lethal. Interestingly, some of the deletions in V3 cause accumulation of 27S(A) pre-rRNA and, moreover, appear to interfere with the close coupling between the processing cleavages at sites A3 and B1(S). These results demonstrate that both variable regions play an important role in 60S subunit formation.
The complete genome sequences of the lactic acid bacteria (LAB), Lactobacillus plantarum, Lactococcus lactis, and Lactobacillus johnsonii were used to compare location, sequence, organisation, and regulation of the ribosomal RNA (rrn) operons. All rrn operons of the examined LAB diverge from the origin of replication, which is compatible with their efficient expression. All operons show a common organisation of 5'-16S-23S-5S-3' structure, but differ in the number, location and specificity of the tRNA genes. In the 16S-23S intergenic spacer region, two of the five rrn operons of Lb. plantarum and three of the six of Lb. johnsonii contain tRNA-ala and tRNA-ile genes, while L. lactis has a tRNA-ala gene in all six operons. The number of tRNA genes following the 5S rRNA gene ranges up to 14, 16, and 21 for L. lactis, Lb. johnsonii and Lb. plantarum, respectively. The tRNA gene complements are similar to each other and to those of other bacteria. Micro-heterogeneity was found within the rRNA structural genes and spacer regions of each strain. In the rrn operon promoter regions of Lb. plantarum and L. lactis marked differences were found, while the promoter regions of Lb. johnsonii showed a similar tandem promoter structure in all operons. The rrn promoters of L. lactis show either a single or a tandem promoter structure. All promoters of Lb. plantarum contain two or three -10 and -35 regions, of which either zero to two were followed by an UP-element. The Lb. plantarum rrnA, rrnB, and rrnC promoter regions display similarity to the rrn promoter structure of Esherichia coli. Differences in regulation between the five Lb. plantarum promoters were studied using a low copy promoter-probe plasmid. Taking copy number and growth rate into account, a differential expression over time was shown. Although all five Lb. plantarum rrn promoters are significantly different, this study shows that their activity was very similar under the circumstances tested. An active promoter was also identified within the Lb. plantarum rrnC operon preceding a cluster of 17 tRNA genes.
Escherichia coli pseudouridine synthase RluD makes pseudouridines 1911, 1915, and 1917 in the loop of helix 69 in 23S RNA. These are the most highly conserved ribosomal pseudouridines known. Of 11 pseudouridine synthases in E. coli, only cells lacking RluD have severe growth defects and abnormal ribosomes. We have determined the 2.0 A structure of the catalytic domain of RluD (residues 77-326), the first structure of an RluA family member. The catalytic domain folds into a mainly antiparallel beta-sheet flanked by several loops and helices. A positively charged cleft that presumably binds RNA leads to the conserved Asp 139. The RluD N-terminal S4 domain, connected by a flexible linker, is disordered in our structure. RluD is very similar in both catalytic domain structure and active site arrangement to the pseudouridine synthases RsuA, TruB, and TruA. We identify five sequence motifs, two of which are novel, in the RluA, RsuA, TruB, and TruA families, uniting them as one superfamily. These results strongly suggest that four of the five families of pseudouridine synthases arose by divergent evolution. The RluD structure also provides insight into its multisite specificity.
The topography and the length of the non-ribosomal sequences present in 7-S RNA, the immediate precursor of 5.8-S ribosomal RNA, from the yeast Saccharomyces carlsbergensis were determined by analyzing the nucleotide sequences of the products obtained after complete digestion of 7-S RNA with RNase T1. The results show that 7-S RNA contains approximately 150 non-ribosomal nucleotides. The majority (90%) of the 7-S RNA molecules was found to have the same 5'-terminal pentadecanucleotide sequence as mature 5.8-S rRNA. The remaining 10% exhibited 5'-terminal sequences identical to those of 5.9-S RNA, which has the same primary structure as 5.8-S rRNA except for a slight extension at the 5' end [Rubin, G.M. (1974) Eur. J. Biochem. 41, 197--202]. These data show that the non-ribosomal nucleotides present in 7-S RNA are all located 3'-distal to the mature 5.8-S rRNA sequence. Moreover, it can be concluded that 5.9-S RNA is a stable rRNA rather than a precursor of 5.8-S rRNA. The 3'-terminal sequence of 5.8-S rRNA (U-C-A-U-U-UOH) is recovered in a much longer oligonucleotide in the T1 RNase digest of 7-S RNA having the sequence U-C-A-U-U-U-(C-C-U-U-C-U-C)-A-A-A-C-A-(U-U-C-U)-Gp. The sequences enclosed in brackets are likely to be correct but could not be established with absolute certainty. The arrow indicates the bond cleaved during processing. The octanucleotide sequence -A-A-A-C-A-U-U-C- located near the cleavage site shows a remarkable similarity to the 5'-terminal octanucleotide sequence of 7-S RNA (-A-A-A-C-U-U-U-C-). We suggest that these sequences may be involved in determining the specificity of the cleavages resulting in the formation of the two termini of 5.8-S rRNA.
Hughes (1996, J Mol Biol 259:645-654) proposed that the box A region of U3 snoRNA interacts by complementary base pairing with small subunit (ss) rRNA sequences within precursor (pre-) rRNA and through rearrangement and displacement mediates the formation of the universally conserved 5' end pseudoknot. We wondered how this conserved pseudoknot might be formed in the ss rRNAs of archaeal and bacterial organisms that lack a U3 RNA. In examining the 5' external transcribed spacer (5' ETS) region in pre-rRNA transcripts from some of these organisms, we noted the presence of U3 box A-like sequences. By analogy with the U3-ss rRNA intermolecular interaction, we suggest that the box A-like 5' ETS sequence interacts through intramolecular complementary base pairing with the 5' end pseudoknot sequences within pre-rRNA; rearrangement of this structure mediates the formation of the conserved 5' end pseudoknot. If correct, this means that some of the pre-rRNA maturation-folding functions provided in trans by snoRNAs in eukaryotic organisms may be provided in cis by the spacer sequences in pre-rRNA transcripts in some bacterial or archaeal organisms lacking snoRNAs.
OBJECTIVE: To detect the alterations of mitochondrial 12S rRNA in patients with gastric cancer, and further evaluate their effects on development of gastric carcinomas. METHODS: Mitochondrial 12S rRNA of 22 samples of gastric cancer tissues and 22 corresponding normal gastric mucosa taken from the distal portion of surgical specimens were PCR amplified, followed by direct DNA sequencing. Laser capture microdissection technique (LCM) was used to isolate cancerous cells and dysplastic cells from patients with specific mutations. Denaturing high-performance liquid chromatography (DHPLC) plus allele-specific PCR (AS-PCR), nest-PCR and polyacrylamide gel electrophoresis (PAGE) were applied to further evaluate this mutant property and quantitative difference of mutant type between cancerous and dysplastic cells. Finally, RNAdraw bio-soft was used to analyze the RNA secondary structure of mutant type 12S rRNA. RESULTS: Compared with mitomap database, some variations were firstly found, among which np652 G insertion and np716 T-G transversion were only found in cancers. There existed statistically significant difference in variant frequency of 12S rRNA between intestinal type and diffuse type of gastric carcinoma, 5/17 (29.4%) and 12/17 (70.6%) respectively (P < 0.05). DHPLC analysis showed that 12S rRNA np652 G insertion and np716 T-G transversion were heteroplasmic mutation. Variant frequency of 12S rRNA in cancer was higher than that in dysplasia (P < 0.01). 12S rRNA 652G insertion had more adverse effect on secondary structure stability of 12S rRNA than T-G transversion did. CONCLUSION: Highly variant frequency of mitochondrial 12S rRNA may be associated with intestinal type of gastric cancer. Most parts of variations exist in both cancer and normal tissues and may not be characteristic of tumor specificity. However np652 G insertion and np716 T-G transversion may possess some molecular significance on gastric cancerogenesis. During the process of progression from normality through dysplasia to cancer, 12S rRNA tended to transit from homoplasmy (wild type) and heteroplasmy to homoplasmy (mutant type, np717 T-G).
A library of random mutations in Xenopus ribosomal protein L5 was generated by error-prone PCR and used to delineate the binding domain for 5S rRNA. All but one of the amino acid substitutions that affected binding affinity are clustered in the central region of the protein. Several of the mutations are conservative substitutions of non-polar amino acid residues that are unlikely to form energetically significant contacts to the RNA. Thermal denaturation, monitored by circular dichroism (CD), indicates that L5 is not fully structured and association with 5S rRNA increases the t(m) of the protein by 16 degrees C. L5 induces changes in the CD spectrum of 5S rRNA, establishing that the complex forms by a mutual induced fit mechanism. Deuterium exchange reveals that a considerable amount of L5 is unstructured in the absence of 5S rRNA. The fluorescence emission of W266 provides evidence for structural changes in the C-terminal region of L5 upon binding to 5S rRNA; whereas, protection experiments demonstrate that the N terminus remains highly sensitive to protease digestion in the complex. Analysis of the amino acid sequence of L5 by the program PONDR predicts that the N and C-terminal regions of L5 are intrinsically disordered, but that the central region, which contains three essential tyrosine residues and other residues important for binding to 5S rRNA, is likely to be structured. Initial interaction of the protein with 5S rRNA likely occurs through this region, followed by induced folding of the C-terminal region. The persistent disorder in the N-terminal domain is possibly exploited for interactions between the L5-5S rRNA complex and other proteins.