SEARCH · PubMed Health

Results for “Codon, Terminator”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 703 records · Page 39Linked to original sources

PubMed1993

Production of a severe cystic fibrosis mutation in mice by gene targeting.

We have used gene targeting in embryonic stem cells to introduce an HPRT mini-gene into the coding sequence of the murine cystic fibrosis gene (cftr). This insertion introduces a termination codon in frame with the cftr coding sequence to terminate prematurely the CFTR protein within the first nucleotide binding domain. Animals homozygous for the cftr disruption fail to thrive and display a range of symptoms including meconium ileus, distal intestinal obstructions, gastrointestinal mucus accumulation and blockage of pancreatic ducts. The animals also show lacrimal gland pathology. Tracheal and caecal transepithelial current measurements demonstrate the lack of a cAMP activatable Cl- channel. These animals will prove useful for the evaluation of new therapeutic drugs and gene therapy strategies.

Animals↗

PubMed1980

Messenger ribonucleic acid of the lipoprotein of the Escherichia coli outer membrane. I. Nucleotide sequence at the 3' terminus and sequences of oligonucleotides derived from complete digests of the mRNA.

The sequence of 92 nucleotides at the 3' end of the mRNA which codes for the lipoprotein of the outer membrane of Escherichia coli has been determined to be GCUAACCAGCGUCUGGACAACAUGGCUACUAAAUACCGCAAGUAAUAGUACCUGUGAAGUGAAAAAUGGCGCACAUUGUGCGCCAUUUUUUUOH. This sequence includes the 50 nucleotides comprising the 3' untranslated region of the mRNA and contains codons for 14 amino acids at the COOH-terminal of the lipoprotein. In addition, the nucleotide sequences of all oligonucleotides derived from complete ribonuclease T1 and ribonuclease A digestions of the lipoprotein mRNA were established. These oligonucleotides were assigned to portions of the known amino acid sequence as well as the 5' untranslated and 3' untranslated regions of the mRNA molecule. With the use of the genetic code, these oligonucleotide sequences served to establish 94% of the mRNA sequence. The lipoprotein mRNA can be deduced to be 322 nucleotides in length. All three translation termination codons (UAA, UAG, and UGA) were found in phase with the coding region of the mRNA. The region at the 3' end of the mRNA showed unusual resistance to partial degradation, and the partial fragments from this region had anomalous mobilities in two-dimensional gels, even under denaturing conditions. This indicates that there is a very stable hairpin stem-and-loop structure at the 3' end. This hairpin structure exhibits all the structural elements implicated in termination of transcription in, prokaryotes.

Base Sequence↗

PubMed1991

The cDNA for rat selenoprotein P contains 10 TGA codons in the open reading frame.

Selenoprotein P is a plasma protein recently purified and characterized as containing 7.5 +/- 1.0 selenium atoms/molecule as selenocysteine. In rats maintained on a defined diet containing nutritionally adequate amounts of selenate as the sole selenium source, over half the selenium in plasma is accounted for by selenoprotein P. Its cDNA has been cloned from a rat liver library and sequenced. The sequence is highly unusual, containing 10 TGA codons in its open reading frame prior to the TAA termination codon. TGA designates selenocysteine in other selenoproteins, and limited peptide sequencing that included the amino acids encoded by two of the TGA codons verified that they correspond to selenocysteine. The deduced 366-amino acid sequence is histidine- and cysteine-rich and contains 9 of its selenocysteines in the terminal 122 amino acids. Comparison of the deduced amino acid sequence of selenoprotein P with those of other selenoprotein reveals no significant similarities. Selenoprotein P represents a new class of selenoproteins and is the first protein described with more than 1 selenocysteine in a single polypeptide chain. The primary structure of selenoprotein P suggests that it might be responsible for some of the antioxidant properties of selenium.

Amino Acid Sequence↗

PubMed1997

Prenatal lethality of a homozygous null mutation in the human glucocerebrosidase gene.

The complete spectrum of clinical phenotypes resulting from glucocerebrosidase deficiency continues to evolve. While most patients with Gaucher disease have residual glucocerebrosidase activity, we describe a fetus with severe prenatal lethal type 2 (acute neuronopathic) Gaucher disease lacking glucocerebrosidase activity. This 22-week fetus was the result of a first cousin marriage and had hydrops, external abnormalities, hepatosplenomegaly, and Gaucher cells in several organs. Fetal fibroblast DNA was screened for common Gaucher mutations, none of which was detected. Southern blot analysis using the restriction enzymes SstII and SspI ruled out a fusion gene, deletion, or duplication of either allele, and quantitative studies of SspI digested genomic DNA indicated that both alleles were present. Northern blot analysis of total RNA from fetal fibroblasts demonstrated no detectable transcription, although RT-PCR successfully amplified several exons, suggesting the presence of a very unstable mRNA. Direct PCR sequencing of all exons demonstrated a homozygous frameshift mutation (deletion of a C) on codon 139 in exon 5, thereby introducing a premature termination codon in exon 6. The absence of glucocerebrosidase protein was confirmed by Western analysis. This unique case confirms the essential role of glucocerebrosidase in human development and, like the null allele Gaucher mouse, demonstrates the lethality of a homozygous null mutation. The presence of this novel mutation and the resulting unstable mRNA accounts for the severity of the phenotype observed in this fetus, and contributes to the understanding of genotype/phenotype correlation in Gaucher disease.

Blotting, Southern↗

PubMed2005

The goose reovirus genome segment encoding the minor outer capsid protein, sigma1/sigmaC, is bicistronic and shares structural similarities with its counterpart in Muscovy duck reovirus.

Reoviruses have recently been shown to be associated with disease in young geese and to be involved in epizooties of severe outcome in Hungary. To assess the genetic variability among these pathogenic goose reoviruses (GRVs), we sequenced the S4 genome segment of five GRV strains isolated from different diseased flocks. We found that the GRV S4 genome segment, consisting of two partially overlapping open reading frames (ORFs), shares substantial structural similarity with its counterpart in muscovy duck reoviruses (DRVs). ORF1 is predicted to encode a polypeptide highly similar to the p10 polypeptide of DRV, and ORF2 supposedly encodes the minor outer capsid protein, sigma1/sigmaC. In one of the five GRV strains examined, we identified a single uracil base insertion close to the middle of ORF2. This insertion resulted in a frameshift and in concomitant acquisition of a termination codon (UAA) a few codons downstream, apparently causing truncation of the C-terminal part of the protein. The functional consequences of this assumed mutation, which would result in loss of more than a half of the protein, have yet to be determined. Nonetheless, the sequence and structural similarities between the genome segment encoding sigmal/sigmaC in GRVs and DRVs suggest that these viruses belong to a species distinct from other established species within subgroup 2 of orthoreoviruses.

Amino Acid Sequence↗

PubMed2004

Tyrosinase gene analysis in Japanese patients with oculocutaneous albinism.

BACKGROUND: Oculocutaneous albinism (OCA) is a heterogeneous congenital disorder. Tyrosinase is a key enzyme in melanin biosynthesis, and tyrosinase gene mutations cause the OCA1 subtype. OBJECTIVE: This study was intended evaluate the frequency and details of tyrosinase gene mutations in Japanese OCA patients. PATIENTS AND METHODS: We examined nine non-consanguineous OCA families, sequenced the tyrosinase gene of the patients and also confirmed a splicing site mutation using exon trapping system. RESULTS: Tyrosinase gene mutations were identified in five out of nine OCA families (55%). IVS2-10deltt-7t-a was present in 3 out of 18 alleles in three families (16%), P310insC was present in three alleles in three families (16%) and R278X was found in three alleles (16%), including those in one heterozygous and one compound homozygous patient. G97V (290 G-T) was found in 1 out of 18 alleles, and we could not find G97V in the mutation database. We have added this mutation as 9th mutation of Japanese OCA1 patients. In 8 of 18 alleles, four families, no tyrosinase mutations were identified. They were presumed not to be OCA1, but other subtypes of OCA. Exon trapping system demonstrated IVS2-10deltt-7t-a mutation generated the abnormal splicing site, and inserted the codon 4 bases in mRNA level resulting in premature termination codon downstream. CONCLUSION: This study provided new information about OCA1 mutations, and highlights the requirement of broader detailed search to make precise diagnosis of OCA.

Adolescent↗

PubMed2004

Regulation of Semliki Forest virus RNA replication: a model for the control of alphavirus pathogenesis in invertebrate hosts.

Alphavirus nonstructural proteins are translated as a polyprotein that is ultimately cleaved into four mature proteins called nsP1, nsP2, nsP3, and nsP4 from their order in the polyprotein. The role of this nonstructural polyprotein, of cleavage intermediates, and of mature proteins in synthesis of Semliki Forest virus (SFV) RNA has been studied using mutants unable to cleave one or more of the sites in the nonstructural polyprotein or that had the arginine sense codon between nsP3 and nsP4 changed to an opal termination codon. The results were compared with those obtained for Sindbis virus (SINV), which has a naturally occurring opal codon between nsP2 and nsP3. We found that (1) an active nonstructural protease in nsP2 is required for RNA synthesis. This protease is responsible for all three cleavages in the nonstructural polyprotein. (2) Cleavage between nsP3 and nsP4 (the viral RNA polymerase) is required for RNA synthesis by SFV. (3) SFV mutants that are able to produce only polyprotein P123 and nsP4 synthesize minus-strand RNA early after infection as efficiently as SF wild type but are defective in the synthesis of plus-strand RNA. The presence of sense or opal following nsP3 did not affect this result. At 30 degrees C, they give rise to low yields of virus after a delay, but at 39 degrees C, they are nonviable. (4) SFV mutants that produce nsP1, P23, nsP4, as well as the precursor P123 are viable but produce an order of magnitude less virus than wild type at 30 degrees C and two orders of magnitude less virus at 39 degrees C. The ratio of subgenomic mRNA to genomic RNA is much reduced in these mutants relative to the parental viruses. (5) At 30 degrees C, the variants containing an opal codon grow as well as or slightly better than the corresponding virus with a sense codon. At 39 degrees C, however, the opal variants produce significantly more virus. These results support the conclusion that SFV and SINV, and by extension all alphaviruses, regulate their RNA synthesis in the same fashion after infection. P123 and nsP4 form a minus-strand replicase that synthesizes plus-strand RNA only inefficiently, especially at the higher temperatures found in mammals and birds. A replicase containing nsP1, P23, and nsP4 can make both plus and minus strands, but prefers the promoter for genomic plus sense RNA to that for subgenomic mRNA. The fully cleaved replicase can make only plus-strand RNA, and prefers the promoter for subgenomic mRNA to that for genomic RNA. Alphaviruses alternate between infection of hematophagous arthropods and higher vertebrates. Although the infection of higher vertebrates is acute and often accompanied by disease, continuing transmission of the virus in nature requires that infection of arthropods be persistent and relatively asymptomatic. We propose that this mechanism for control of RNA synthesis evolved to moderate the pathogenicity of the viruses in their arthropod hosts.

Animals↗

PubMed2003

Characterization and tissue expression of acidic fibroblast growth factor binding protein homologue in Drosophila melanogaster.

We have earlier reported a Drosophila protein, which aligned significantly with the amino acid sequence of the human acidic fibroblast growth factor intracellular binding protein (FIBP). In attempts to further elucidate the function of FIBP and its putative role in fibroblast growth factor (FGF) signaling we have cloned and characterized FIBP from Drosophila melanogaster (DrFIBP). Using comparative sequence analysis of Drosophila and human FIBP genes we demonstrate a remarkable conservation of their structural architecture suggesting that FIBP from vertebrates and insects are genuine homologues. Reverse transcriptase polymerase chain reaction analysis of FIBP mRNA from Drosophila revealed differential splicing by intron retention resulting in the production of three distinct FIBP transcripts. The retention of the intronic sequences introduces termination codons within the mature FIBP mRNA leading to premature termination of translation. Analysis of FIBP mRNA distribution in the fruit fly suggests that DrFIBP, like its mammalian homologue, is an abundant protein whose expression is maintained during embryonic, larval and adult stages. The spatial expression pattern investigated by whole mount embryo immunostaining reveals expression of FIBP in the developing tracheal system and in ventral midline cells, two known sites of FGF signaling in the fruit fly.

Alternative Splicing↗

PubMed2001

Isolation and molecular characterization of the first genomic clone of a major peanut allergen, Ara h 2.

BACKGROUND: Peanuts have been identified as potent food allergens responsible for life-threatening IgE reactions among hypersensitive individuals. With the current increase of peanut allergies, there is an urgent need to molecularly characterize the genes encoding the target proteins and to understand the nature of their regulation. OBJECTIVES: The objectives of this study were to isolate, sequence, and characterize at least one full-length genomic clone encoding the major peanut allergen Ara h 2. METHODS: A peanut genomic library, constructed in a Lambda Fix II vector, was screened with an 80-bp oligonucleotide probe constructed on the basis of the 5' end of a published Ara h 2 cDNA partial sequence. One putative positive lambda clone was isolated, digested with Bam HI to release its 16-kb insert, and confirmed by means of dot blot and Southern hybridization. The positive clone was subcloned in pBluescript SK+ vector, sequenced, and characterized. RESULTS: Sequence analysis revealed a full-length genomic clone with an open reading frame starting with an initiation codon (ATG) at position 1 and ending with a termination codon (TGA) at position 622. One putative polyadenylation signal (AATAAA) is identified at positions 951 in the 3' untranslated region, and 6 additional stop codons are located at positions 628, 769, 901, 946, 967, and 982 downstream from the start codon. In the 5' promoter region, a putative TATA box (TATTATTA) is located at position -72 upstream from the start codon. The deduced amino acid sequence has 207 residues and includes a putative signal peptide of 21 residues. CONCLUSIONS: The results reveal for the first time information on the structure of a major peanut allergen, Ara h 2. Comparison of the cDNA and genomic sequences revealed the absence of an intron but the presence of 2 isoforms of Ara h 2 or different members of the same gene family.

2S Albumins, Plant↗

PubMed1995

Syk mutation in Jurkat E6-derived clones results in lack of p72syk expression.

The human leukemic Jurkat cell line is commonly used as a model cellular system to study T lymphocyte signal transduction. Various clonal derivatives of Jurkat T cells exist which display different characteristics with regard to responses to external stimuli. Among these, the E6-1 clone of Jurkat T cells has been used as a parental line from which numerous important somatic mutant clones have been generated. During the course of experiments examining signals initiated by the T cell antigen receptor in an E6-1-derived Jurkat cell clone J.CaM1, we observed that the 72-kilodalton Syk protein tyrosine kinase previously found in other Jurkat cells was not detected. Upon further analysis it was determined that Syk transcripts from the J.CaM1 cells as well as the parental E6-1 cells contain a single guanine nucleotide insertion at position 92. This nucleotide insertion results in a shift in the Syk open reading frame leading to alternate codon usage as well as the generation of a termination codon at position 109. Thus, Syk transcripts in E6-1 cells and E6-1-derived clones are predicted to be capable of encoding only the first 33 amino acids of the 630-amino acid wild type Syk. These findings are incompatible with a recently proposed model of T cell antigen receptor signal transduction based, in part, on experiments conducted using E6-1-derived cells, suggesting that Syk might play a role upstream of Lck and Zap70.

Amino Acid Sequence↗

PubMed1990

DNA sequence analysis of five genes; tnsA, B, C, D and E, required for Tn7 transposition.

A region of DNA sequence of the bacterial transposon Tn7, which is required for transposition, has been determined. This DNA sequence completes an 8351 base pair (bp) region containing five long open reading frames (ORF's) that correspond to the genetically defined genes, tnsA, B, C, D and E, required for Tn7 transposition. All of the ORF's are oriented in the same direction, ie. inward from the element's right end. The genes are in a very compact arrangement with the presumed initiation codons never more than two bases beyond the preceding termination codon. Domains with similarity to the helix-turn-helix genre of Cro-like, sequence specific DNA binding sites occur within the deduced amino acid (a.a.) sequence of the TnsA, TnsB, TnsD and TnsE proteins. Translation of the tnsC ORF reveals strong homology to a consensus sequence for nucleotide binding sites as well as a region of similarity to a transcriptional activator (MalT). No striking a.a. sequence similarity to other DNA recombinases is observed. The possible roles of these proteins in Tn7 transposition is discussed in light of the analysis presented.

Amino Acid Sequence↗

PubMed1996

Hereditary angioedema caused by a point mutation of exon 7 in the C1 inhibitor gene.

Hereditary angioedema (HAE) is a genetic disease which may be detected serologically. We present a patient with HAE, in whom we examined the gene defect using the polymerase chain reaction. The patient presented with recurrent episodes of abdominal pain, or non-itchy swellings of the hands, feet, and penis. The serum levels of C1 inhibitor (C1-INH) and C4 were below normal. We determined that a single base change (C-->T) at nucleotide 1482 in the seventh exon was present in the C1-INH gene. This mutation converted the codon for the Gln-339 to a premature translation termination codon TAG. A point mutation in the C1-INH gene can cause type I HAE.

Adult↗

PubMed2003

Production of plant-specific flavanones by Escherichia coli containing an artificial gene cluster.

In plants, chalcones are precursors for a large number of flavonoid-derived plant natural products and are converted to flavanones by chalcone isomerase or nonenzymatically. Chalcones are synthesized from tyrosine and phenylalanine via the phenylpropanoid pathway involving phenylalanine ammonia lyase (PAL), cinnamate-4-hydroxylase (C4H), 4-coumarate:coenzyme A ligase (4CL), and chalcone synthase (CHS). For the purpose of production of flavanones in Escherichia coli, three sets of an artificial gene cluster which contained three genes of heterologous origins--PAL from the yeast Rhodotorula rubra, 4CL from the actinomycete Streptomyces coelicolor A3(2), and CHS from the licorice plant Glycyrrhiza echinata--were constructed. The constructions of the three sets were done as follows: (i) PAL, 4CL, and CHS were placed in that order under the control of the T7 promoter (P(T7)) and the ribosome-binding sequence (RBS) in the pET vector, where the initiation codons of 4CL and CHS were overlapped with the termination codons of the preceding genes; (ii) the three genes were transcribed by a single P(T7) in front of PAL, and each of the three contained the RBS at appropriate positions; and (iii) all three genes contained both P(T7) and the RBS. These pathways bypassed C4H, a cytochrome P-450 hydroxylase, because the bacterial 4CL enzyme ligated coenzyme A to both cinnamic acid and 4-coumaric acid. E. coli cells containing the gene clusters produced two flavanones, pinocembrin from phenylalanine and naringenin from tyrosine, in addition to their precursors, cinnamic acid and 4-coumaric acid. Of the three sets, the third gene cluster conferred on the host the highest ability to produce the flavanones. This is a new metabolic engineering technique for the production in bacteria of a variety of compounds of plant and animal origin.

Acyltransferases↗

PubMed1986

Nucleotide sequence of the type A streptococcal exotoxin (erythrogenic toxin) gene from Streptococcus pyogenes bacteriophage T12.

The gene specifying type A streptococcal exotoxin (speA), also known as erythrogenic toxin, was cloned from the Streptococcus pyogenes bacteriophage T12 genome and analyzed by nucleotide sequencing. The speA gene consists of 753 base pairs and codes for a 29,244-molecular-weight protein. The speA gene product contains a putative 30-amino acid signal peptide, resulting in a molecular weight of 25,787 for the secreted protein. A possible promoter and ribosome-binding site are present in the region upstream from the speA gene, and a transcriptional terminator is located 69 bases downstream from the translational termination codon. The amino acid sequence of the carboxy-terminal portion of the type A streptococcal exotoxin exhibits extensive homology with the carboxy terminus of Staphylococcus aureus enterotoxins B and C1.

Amino Acid Sequence↗

PubMed2003

A novel mutation in the anion exchanger 1 gene is associated with familial distal renal tubular acidosis and nephrocalcinosis.

OBJECTIVE: The anion exchanger gene (AE1) or band 3 encodes a chloride-bicarbonate (Cl(-)/HCO(3)(-)) exchanger expressed in the erythrocyte and in the renal alpha-intercalated cells involved in urine acidification. The purpose of the present study was to screen for mutations in the AE1 gene in 2 brothers (10 and 15 years of age) with familial distal renal tubular acidosis (dRTA), nephrocalcinosis, and failure to thrive. METHODS: AE1 mutations were screened by single-strand conformation polymorphism, cloning, and sequencing. RESULTS: A complete form of dRTA was confirmed in the 2 affected brothers and an incomplete form in their father. All 3 were heterozygous for a novel 20-bp deletion in exon 20 of the AE1 gene. This deletion resulted in 1 mutation in codon 888 (Ala-888-->Leu) followed by a premature termination codon at position 889, truncating the protein by 23 amino acids. As band 3 deficiency might lead to spherocytic hemolytic anemia or ovalocytosis, erythrocyte abnormalities were also investigated, but no morphologic changes in erythrocyte membrane were found and the osmotic fragility test was normal. CONCLUSIONS: A novel mutation in the AE1 gene was identified in association with autosomal dominant dRTA. We suggest that RTA be considered a diagnostic possibility in all children with failure to thrive and nephrocalcinosis.

Acidosis, Renal Tubular↗

PubMed1992

Rapid molecular diagnosis of hemoglobin variants by RT-PCR of reticulocyte mRNA and direct sequencing.

We have developed a rapid and simple approach for the molecular characterization of hemoglobin variants by a one-step reverse transcription-polymerase chain reaction of reticulocyte mRNA and direct sequencing of the product. This method can selectively amplify the alpha 1- or alpha 2-globin gene or the beta-globin gene transcript. The amino acid substitution of Hb G-Taichung is due to a G----C mutation at codon 74 of the alpha 1-globin gene, that of Hb J-Meinung to a G----A substitution at codon 56 of the beta-globin gene, and that of Hb Kaohsiung (or New York) to a T----A substitution at codon 113 of the beta-globin gene. The amplified segment encompassed the sequence from upstream of the initial codon behind the Cap site to downstream of the terminal codon before the polyadenylation addition signal. Hence, all hemoglobin variants should be able to be characterized by this approach.

Base Sequence↗

PubMed1978

Nucleotide sequence of DNA template for the 3' ends of SV40 mRNA. II. The sequence of the DNA fragment EcorII-F and a part of EcorII-H.

The nucleotide sequence for two-thirds of restriction endonuclease fragment EcoRII-F and part of RII-H of SV40 DNA is presented. This segment of SV40 DNA is complementary to the sequence near the 3' end of early mRNA. This sequence could be translated in one reading frame to form a large protein. However, in a second translational frame there are four AUG codons followed by 91 sense triplets, followed by a termination codon. These results provide the sequence for the entire 3' untranslated ends of SV40 early and late mRNAs and for the DNA beyond the 3' ends of the mRNAs. The ends of early and late mRNA are transcribed from the opposite strands of the same segment of DNA. At or beyond the 3' ends of both early and late mRNA are sequences whose transcripts would include uridylic acid-rich products.

Base Sequence↗

PubMed1998

The evolutionarily conserved eukaryotic arginine attenuator peptide regulates the movement of ribosomes that have translated it.

Translation of the upstream open reading frame (uORF) in the 5' leader segment of the Neurospora crassa arg-2 mRNA causes reduced initiation at a downstream start codon when arginine is plentiful. Previous examination of this translational attenuation mechanism using a primer-extension inhibition (toeprint) assay in a homologous N. crassa cell-free translation system showed that arginine causes ribosomes to stall at the uORF termination codon. This stalling apparently regulates translation by preventing trailing scanning ribosomes from reaching the downstream start codon. Here we provide evidence that neither the distance between the uORF stop codon and the downstream initiation codon nor the nature of the stop codon used to terminate translation of the uORF-encoded arginine attenuator peptide (AAP) is important for regulation. Furthermore, translation of the AAP coding region regulates synthesis of the firefly luciferase polypeptide when it is fused directly at the N terminus of that polypeptide. In this case, the elongating ribosome stalls in response to Arg soon after it translates the AAP coding region. Regulation by this eukaryotic leader peptide thus appears to be exerted through a novel mechanism of cis-acting translational control.

Amino Acid Sequence↗