SEARCH · PubMed Health

Results for “ELEMENTS, ACTINIC”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4Linked to original sources

PubMed2001

A role for actin, Cdc1p, and Myo2p in the inheritance of late Golgi elements in Saccharomyces cerevisiae.

In Saccharomyces cerevisiae, Golgi elements are present in the bud very early in the cell cycle. We have analyzed this Golgi inheritance process using fluorescence microscopy and genetics. In rapidly growing cells, late Golgi elements show an actin-dependent concentration at sites of polarized growth. Late Golgi elements are apparently transported into the bud along actin cables and are also retained in the bud by a mechanism that may involve actin. A visual screen for mutants defective in the inheritance of late Golgi elements yielded multiple alleles of CDC1. Mutations in CDC1 severely depolarize the actin cytoskeleton, and these mutations prevent late Golgi elements from being retained in the bud. The efficient localization of late Golgi elements to the bud requires the type V myosin Myo2p, further suggesting that actin plays a role in Golgi inheritance. Surprisingly, early and late Golgi elements are inherited by different pathways, with early Golgi elements localizing to the bud in a Cdc1p- and Myo2p-independent manner. We propose that early Golgi elements arise from ER membranes that are present in the bud. These two pathways of Golgi inheritance in S. cerevisiae resemble Golgi inheritance pathways in vertebrate cells.

Actins↗

PubMed1986

Nuclear actin and myosin as control elements in nucleocytoplasmic transport.

Fluorescence redistribution after photobleaching (FRAP) was used to examine the role of actin and myosin in the transport of dextrans through the nuclear pore complex. Anti-actin antibodies added to isolated rat liver nuclei significantly reduced the flux rate of fluorescently labeled 64-kD dextrans. The addition of 3 mM ATP to nuclei, which enhances the flux rate in control nuclei by approximately 250%, had no enhancement effect in the presence of either anti-actin or anti-myosin antibody. Phalloidin (10 microM) and cytochalasin D (1 micrograms/ml) individually inhibited the ATP stimulation of transport. Rabbit serum, anti-fibronectin, and anti-lamins A and C antibodies had no effect on transport. These results suggest a model for nuclear transport in which actin/myosin are involved in an ATP-dependent process that alters the effective transport rate across the nuclear pore complex.

Actins↗

PubMed1992

The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.

Actins↗

PubMed1990

Regulatory elements mediating transcription from the Drosophila melanogaster actin 5C proximal promoter.

The major cytoskeletal actin gene of Drosophila melanogaster, the actin 5C gene, has two promoters, the proximal one of which controls constitutive synthesis of actin in all growing tissues. To locate regulatory elements required for constitutive activity of the proximal promoter, mutants of this promoter were fused to the bacterial chloramphenicol acetyltransferase gene and assayed for transient expression activity in cultured Drosophila embryonic Schneider line 2 cells. An essential regulatory element has been located 313 base pairs upstream from the cap site. Deletion of this element lowered expression to one-third of the wild-type level. The element has the sequence AAGTTGTAGTTG, as shown by protein-binding footprinting with the reagent methidiumpropyl-EDTA-Fe(II). This element is probably not a general one, since it was not detected in a search of the published 5'-flanking sequences of 27 Drosophila genes. In addition to this regulatory element, there are five GAGA elements in the actin 5C proximal promoter, some or all of which are essential for the promoter activity as shown by an in vivo competition assay. Although this promoter has no classical TATA element, there is an essential promoter region about 35 base pairs upstream from the cap site that could be a TATA surrogate. The promoter also shows sequences homologous to the alcohol dehydrogenase factor 1-binding site and to the core of the vertebrate serum response element, but mutations of these sites did not affect promoter activity in transient expression assays.

Actins↗

PubMed2002

NUANCE, a giant protein connecting the nucleus and actin cytoskeleton.

NUANCE (NUcleus and ActiN Connecting Element) was identified as a novel protein with an alpha-actinin-like actin-binding domain. A human 21.8 kb cDNA of NUANCE spreads over 373 kb on chromosome 14q22.1-q22.3. The cDNA sequence predicts a 796 kDa protein with an N-terminal actin-binding domain, a central coiled-coil rod domain and a predicted C-terminal transmembrane domain. High levels of NUANCE mRNA were detected in the kidney, liver, stomach, placenta, spleen, lymphatic nodes and peripheral blood lymphocytes. At the subcellular level NUANCE is present predominantly at the outer nuclear membrane and in the nucleoplasm. Domain analysis shows that the actin-binding domain binds to Factin in vitro and colocalizes with the actin cytoskeleton in vivo as a GFP-fusion protein. The C-terminal transmembrane domain is responsible for the targeting the nuclear envelope. Thus, NUANCE is the first alpha-actinin-related protein that has the potential to link the microfilament system with the nucleus.

Actin Cytoskeleton↗

PubMed2000

The skeletal muscle alpha-actin gene of channel catfish (Ictalurus punctatus) and its association with piscine specific SINE elements.

The alpha-actin gene of channel catfish (Ictalurus punctatus) was cloned and sequenced. The gene has a similar organization and exhibited a high level of sequence similarity to those from other vertebrate animals. The upstream region of the alpha-actin gene included a TATA box, a CAAT box, three E-boxes, and a CArG box. Nested deletion segments containing these transcriptional motifs were fused to the reporter gene chloramphenicol acetyl transferase (CAT). Transfection of the clones into C2C12 cells indicated that all these motifs are required for transcriptional activities. The channel catfish alpha-actin gene is associated with two distinct short interspersed repetitive elements (SINEs). The first SINE element showed high levels of sequence similarity to the zebrafish Mermaid element, while the second SINE element is not similar to the Mermaid element except for an 8bp sequence CCCCGTGC suggesting their evolutionary linkage. However, the second SINE element appeared to co-exist with the Mermaid element in most cases and therefore was designated as the Merman element. Approximately 9000 copies and 1200 copies of the Mermaid and Merman elements exist per haploid channel catfish genome, respectively. BLAST searches indicated that both the Mermaid and the Merman elements were frequently associated with gene sequences, mostly those of aquatic animals, suggesting their evolutionary origin in association with aquatic organisms and their function in shaping the evolution of genomes in aquatic animals.

Actins↗

PubMed2003

Augmentation of endothelial cell monolayer permeability by hyperthermia but not tumor necrosis factor: evidence for disruption of vascular integrity via VE-cadherin down-regulation.

Following isolated limb perfusion (ILP) with hyperthermia (H T), TNF and melphalan, there is immediate tumor softening secondary to augmentation of capillary leak in the tumor neovasculature. TNF can induce vascular permeability but is always used with HT during ILP and the contribution of the latter on permeability is not known. This study characterizes the effects of HT and TNF on vascular permeability in vitro. Permeability across confluent human umbilical vein endothelial cells exposed to HT (40 degrees C) with or without 0.1-1000 ng/ml TNF was assessed by quantitating flux of albumin bound Evan's Blue dye from the upper to lower chamber. Immunofluorescent staining for VE-cadherin and F-actin was performed after human umbilical vein endothelial cells (hUVECs) were exposed to these conditions. HT induced a significant and reversible increase in permeability compared to untreated hUVECs (p<0.001) whereas barrier function was not altered by TNF. Untreated hUVECs had uniform cell surface staining for VE-cadherin, the primary endothelial intercellular adhesion molecule, with colocalization of F-actin cytoskeletal elements. HT resulted in a marked decrease in VE-cadherin staining and contraction of F-actin at sites of endothelial cell-cell separation. These data demonstrate that under conditions relevant to those used in ILP, HT but not TNF contributes to a rapid and reversible change in endothelial cell permeability in association with a down regulation of VE-cadherin. These data support the use of HT in isolation perfusion and demonstrate a novel mechanism for alterations in microvascular permeability by HT.

Actins↗

PubMed1995

The bacterial actin nucleator protein ActA of Listeria monocytogenes contains multiple binding sites for host microfilament proteins.

BACKGROUND: Several intracellular pathogens, including Listeria monocytogenes, use components of the host actin-based cytoskeleton for intracellular movement and for cell-to-cell spread. These bacterial systems provide relatively simple model systems with which to study actin-based motility. Genetic analysis of L. monocytogenes led to the identification of the 90 kD surface-bound ActA polypeptide as the sole bacterial factor required for the initiation of recruitment of host actin filaments. Numerous host actin-binding proteins have been localized within the actin-based cytoskeleton that surrounds Listeria once it is inside a mammalian cell, including alpha-actinin, fimbrin, filamin, villin, ezrin/radixin, profilin and the vasodilator-stimulated phosphoprotein, VASP. Only VASP is known to bind directly to ActA. We sought to determine which regions of the ActA molecule interact with VASP and other components of the host microfilament system. RESULTS: We used the previously developed mitochondrial targeting assay to determine regions of the ActA protein that are involved in the recruitment of the host actin-based cytoskeleton. By examining amino-terminally truncated ActA derivatives for their ability to recruit cytoskeletal proteins, an essential element for actin filament nucleation was identified between amino acids 128 and 151 of ActA. An ActA derivative from which the central proline-rich repeats were deleted retained its ability to recruit filamentous actin, albeit poorly, but was unable to bind VASP. CONCLUSIONS: Our studies reveal the initial interactions that take place between invading Listeria and host microfilament proteins. The listerial ActA polypeptide contains at least two essential sites that are required for efficient microfilament assembly: an amino-terminal 23 amino-acid region for actin filament nucleation, and VASP-binding proline-rich repeats. Hence, ActA represents a prototype actin filament nucleator. We suggest that host cell analogues of ActA exist and are important components of structures involved in cell motility.

Actins↗

PubMed1994

The avian cardiac alpha-actin promoter is regulated through a pair of complex elements composed of E boxes and serum response elements that bind both positive- and negative-acting factors.

The chicken alpha-cardiac actin is one of the earliest contractile protein genes selectively expressed during embryonic skeletal and cardiac muscle differentiation. Cardiac actin promoter elements were examined in these two sarcomeric cell types. A portion of the alpha-cardiac actin promoter responsible for striated muscle specificity has been delineated (1, 2) and shown to contain four serum response elements (SRE). Previously, SRE3 was shown to be part of a complex element in conjunction with a functional E box (2), and we now show that SRE4 is also part of an upstream SRE.E box cis-element complex. The SREs function similarly, but the E boxes have dissimilar properties within and between striated muscle types. The SRE3.E1 box binds myogenic basic helix-loop-helix factors and is required for cardiac actin trans-activation in primary muscle cell cultures but functions as a negative regulatory element in cardiac muscle cells. The SRE4.E2 box, on the other hand, fails to bind basic helix-loop-helix (bHLH) factors, is negative acting in skeletal muscle cells, and is positive acting in cardiac myocytes. A DNA binding factor similar to HF1a (3) was identified that interacts specifically with the SRE4.E2 box. This study shows that the avian cardiac actin promoter elements are differentially used between skeletal and cardiac striated muscle cell lineages.

Actins↗

PubMed1997

Activator effect of coinjected enhancers on the muscle-specific expression of promoters in zebrafish embryos.

The transient expression of reporter gene constructs in embryos provides a powerful tool to characterise cis-acting transcriptional elements of the genes involved in development. In the present study, we have analysed the expression pattern of several muscle-specific and ubiquitous regulatory sequences in microinjected zebrafish embryos. By using a fast and reproducible coinjection strategy, the mosaic expression of lacZ reporter gene was monitored in wholemount embryos injected with sequences containing putative enhancer elements and a carp myosin heavy chain promoter/lacZ reporter construct. We have found that a 0.9-kb myosin heavy chain (MyHC) proximal promoter containing several putative myogenic regulatory factors (MRF) binding sites is sufficient to restrict lacZ expression to the skeletal muscle fibres of prim-6 stage zebrafish embryos. Expression of a rat-derived foetal myosin light chain enhancer (MyLC) and different fragments of a carp beta-actin regulatory region together with the MyHC promoter were compared by accumulating the type, number and spatial distribution of beta-galactosidase-expressing cells on an expression map. beta-galactosidase activity increased similarly whether the MyLC enhancer was ligated to the promoter/ reporter construct directly or when coinjected as a separate fragment whilst skeletal muscle specificity was retained. The coinjection of two different forms of the beta-actin regulatory elements also showed a marked effect on the MyHC promoter activity. The coinjection of putative enhancers with minimal promoter constructs and subsequent analysis of the transient expression pattern in the developing embryos provides a rapid and simple technique to identify cis acting activator elements of genes expressed in the vertebrate embryo.

Actins↗

PubMed1992

Different E-box regulatory sequences are functionally distinct when placed within the context of the troponin I enhancer.

Basic helix-loop-helix (bHLH) regulatory proteins are known to bind to a single DNA consensus sequence referred to as an E-box. The E-box is present in the regulatory elements of many developmentally controlled genes, including most muscle-specific genes such as troponin I (TnI). Although the E-box consensus is minimally defined as CANNTG, the adjacent nucleotides of functional E-boxes are variable for genes regulated by the bHLH proteins. In order to examine how E-box regulatory regions containing different internal and flanking nucleotides function when placed within the context of a single regulatory element, the E-box region (14 bp) present within the TnI enhancer was substituted with the corresponding E-box sequences derived from the muscle-specific M-creatine kinase (MCK) and cardiac alpha-actin regulatory elements as well as from the immunoglobulin kappa (Ig kappa) enhancer. Within the TnI enhancer, the E-box sequence derived from cardiac alpha-actin was inactive whereas the corresponding sequence from the MCK right E-box efficiently restored wild-type enhancer activity in muscle cells. Intermediate levels of gene activity were observed for TnI enhancers containing E-boxes derived from the MCK left E-box site or from the Ig kappa E2 E-box. DNA binding studies of MyoD:E12 protein complexes with each substituted TnI enhancer confirmed that DNA binding activity in vitro mimics the relative strength of the enhancers in vivo. These studies demonstrate that the specific nucleotide composition of individual E-boxes, which are contained within the regulatory elements of most if not all muscle-specific genes, contributes to the complex regulatory mechanisms governing bHLH-mediated gene expression.

Actins↗

PubMed1998

Two MCAT elements of the SM alpha-actin promoter function differentially in SM vs. non-SM cells.

Transcriptional activity of the smooth muscle (SM) alpha-actin gene is differentially regulated in SM vs. non-SM cells. Contained within the rat SM alpha-actin promoter are two MCAT motifs, binding sites for transcription enhancer factor 1 (TEF-1) transcriptional factors implicated in the regulation of many muscle-specific genes. Transfections of SM alpha-actin promoter-CAT constructs containing wild-type or mutagenized MCAT elements were performed to evaluate their functional significance. Mutation of the MCAT elements resulted in increased transcriptional activity in SM cells, whereas these mutations either had no effect or decreased activity in L6 myotubes or endothelial cells. High-resolution gel shift assays resolved several complexes of different mobilities that were formed between MCAT oligonucleotides and nuclear extracts from the different cell types, although no single band was unique to SM. Western blot analysis of nuclear extracts with polyclonal antibodies to conserved domains of the TEF-1 gene family revealed multiple reactive bands, some that were similar and others that differed between SM and non-SM. Supershift assays with a polyclonal antibody to the TEF-related protein family demonstrated that TEF-1 or TEF-1-related proteins were contained in the shifted complexes. Results suggest that the MCAT elements may contribute to cell type-specific regulation of the SM alpha-actin gene. However, it remains to be determined whether the differential transcriptional activity of MCAT elements in SM vs. non-SM is due to differences in expression of TEF-1 or TEF-1-related proteins or to unique (cell type specific) combinatorial interactions of the MCAT elements with other cis-elements and trans-factors.

Actins↗

PubMed2001

A proline-rich protein binds to the localization element of Xenopus Vg1 mRNA and to ligands involved in actin polymerization.

A 340 nucleotide element within the 3' untranslated region of Vg1 mRNA determines its localization to the vegetal cortex of Xenopus oocytes. To identify protein factors that bind to this region, we screened a cDNA expression library with an RNA probe containing this sequence. Five independent isolates encoded a protein (designated Prrp for proline-rich RNA binding protein) having two RNP domains followed by multiple polyproline segments. Prrp and Vg1 mRNAs are co-localized to the vegetal cortex of stage IV oocytes, substantiating an interaction between the two in vivo. Prrp also associates with VegT mRNA, which like Vg1 mRNA uses the late localization pathway, but not with Xcat-2 or Xwnt-11 mRNAs, which use the early pathway. The proline-rich domain of Prrp interacts with profilin, a protein that promotes actin polymerization. Prrp can also associate with the EVH1 domain of Mena, another microfilament-associated protein. Since the anchoring of Vg1 mRNA to the vegetal cortex is actin dependent, one function of Prrp may be to facilitate local actin polymerization, representing a novel function for an RNA binding protein.

3' Untranslated Regions↗

PubMed1996

Regulation of epithelial sodium channels by short actin filaments.

Cytoskeletal elements play an important role in the regulation of ion transport in epithelia. We have studied the effects of actin filaments of different length on the alpha, beta, gamma-rENaC (rat epithelial Na+ channel) in planar lipid bilayers. We found the following. 1) Short actin filaments caused a 2-fold decrease in unitary conductance and a 2-fold increase in open probability (Po) of alpha,beta,gamma-rENaC. 2) alpha,beta,gamma-rENaC could be transiently activated by protein kinase A (PKA) plus ATP in the presence, but not in the absence, of actin. 3) ATP in the presence of actin was also able to induce a transitory activation of alpha, beta,gamma-rENaC, although with a shortened time course and with a lower magnitude of change in Po. 4) DNase I, an agent known to prohibit elongation of actin filaments, prevented activation of alpha,beta,gamma-rENaC by ATP or PKA plus ATP. 5) Cytochalasin D, added after rundown of alpha,beta,gamma-rENaC activity following ATP or PKA plus ATP treatment, produced a second transient activation of alpha,beta,gamma-rENaC. 6) Gelsolin, a protein that stabilizes polymerization of actin filaments at certain lengths, evoked a sustained activation of alpha,beta,gamma-rENaC at actin/gelsolin ratios of <32:1, with a maximal effect at an actin/gelsolin ratio of 2:1. These results suggest that short actin filaments activate alpha, beta,gamma-rENaC. PKA-mediated phosphorylation augments activation of this channel by decreasing the rate of elongation of actin filaments. These results are consistent with the hypothesis that cloned alpha,beta,gamma-rENaCs form a core conduction unit of epithelial Na+ channels and that interaction of these channels with other associated proteins, such as short actin filaments, confers regulation to channel activity.

Actins↗

PubMed1979

Tumor promoters induce changes in the chick embryo fibroblast cytoskeleton.

We have examined the effect of the tumor promoter, 12-0-tetradecanoyl phorbol-13-acetate (TPA), on the actin-containing elements of the cytoskeleton of chick embryo fibroblasts (CEF). TPA at concentrations as low as 7.3 times 10-10M indices a reversible change in the cytoskeleton as visualized by indirect immunofluorescence using anti-actin antibodies. Cells incubated with TPA lose the ordered actin-containing structures found in normal cells and resemble Rous sarcoma virus-transformed cells in that the immunofluorescent actin pattern is diffuse. The TPA effects are both dose-and time-dependent. Analogs of TPA which are inactive as tumor promoters do not induce cytoskeletal changes at the concentrations tested, while a second tumor promoter, PDD, is also able to cause alterations in actin-containing structures. The action of TPA requires de novo synthesis of both RNA and protein. The direct cytoskeletal changes are neither plasmin-dependent nor subject to inhibition by incubating the cells with high levels of protease inhibitors during the exposure to TPA. However, plasminogen does increase the sensitivity of cells to TPA.

Actins↗

PubMed2004

Myofibrillogenesis in the developing chicken heart: role of actin isoforms and of the pointed end actin capping protein tropomodulin during thin filament assembly.

Recently, important differences between myofibrillogenesis in cultured cardiomyocytes vs. the three-dimensional setting in situ could be determined. We investigated thin filament assembly in situ by confocal microscopy of whole-mount preparations of immunostained embryonic chicken hearts. Of interest, a distinct localisation of different actin isoforms was observed in immature thin filaments. Cardiac alpha-actin is restricted to filaments with a length comparable to mature thin filaments as soon as the first contractions occur, while vascular alpha-actin makes up filaments that extend toward the M-band. The pointed-end actin filament capping protein tropomodulin can be found initially in close association with the plasma membrane, but attains its mature localisation pattern at the ends of the thin filaments only comparatively late during myofibrillogenesis. Thus tropomodulin acts as a length stabilising element of actin filaments also in developing cardiomyocytes in situ, but plays an additional role together with membrane-associated actin filaments in the earliest steps of myofibril assembly.

Actin Cytoskeleton↗

PubMed1994

Tissue specific expression of an alpha-skeletal actin-lacZ fusion gene during development in transgenic mice.

Transgenic mice carrying a chimaeric transgene containing 730 bp of the 5'-flanking sequences and the entire first intron of the rat alpha-skeletal actin gene fused to the lacZ reporter gene have been produced by microinjection. The lacZ reporter gene was used to verify the suitability of using the rat alpha-actin promoter elements to target expression of genes of agricultural and therapeutic value exclusively to skeletal and heart muscle cells and fibres of transgenic mice. Expression of the transgene indicates a tightly regulated developmental and muscle specific control of the rat alpha-skeletal actin gene, making it a useful promoter for gene targeting to muscle tissues. The cells destined to form muscle tissues in these transgenic mice are readily visualized in intact embryos by staining for beta-galactosidase activity, making them a suitable animal model for studying the origin and development of skeletal and cardiac muscle tissues.

Actins↗

PubMed1993

Characterization of the thyroid hormone response element in the skeletal alpha-actin gene: negative regulation of T3 receptor binding by the retinoid X receptor.

We have identified a T3 response element (TRE) in the human skeletal alpha-actin gene between nucleotide positions -273 and -249 (5' GGGCAACTGGGTCGGGTCAGGAGGG 3') that is accommodated by the core receptor binding motif, A/G GG T/A C A/G. This sequence conferred appropriate hormonal regulation in a thyroid hormone receptor (TR alpha) dependent manner to an enhancerless SV40 promoter. Electrophoretic mobility shift assay experiments showed that Escherichia coli expressed and affinity purified TR alpha bound to the skeletal alpha-actin TRE in a sequence specific manner. The alpha-actin TRE bound TR alpha dimers cooperatively. Mutagenesis of the alpha-actin TRE indicated that the core binding motifs and the gap sequences were the most important for efficient binding to TR alpha. The retinoid X receptor alpha (RXR alpha) interacted with the alpha-actin TRE in a sequence specific fashion and formed heterodimeric complexes with TR alpha on the alpha-actin TRE. However, increased levels of RXR alpha decreased the binding of TR alpha to the alpha-actin TRE, in contrast to promoting TR alpha binding to the alpha-myosin heavy chain TRE. Furthermore, the alpha-actin, palindromic, synthetic direct repeat, alpha-myosin heavy chain, and growth hormone TREs interacted with an identical nuclear factor in vitro in muscle cells. In conclusion, our data suggest that the human skeletal alpha-actin TRE is a target for direct cross-talk between two different hormonal signals (T3 and 9-cis-retinoic acid) at the receptor level.(ABSTRACT TRUNCATED AT 250 WORDS)

Actins↗