SEARCH · PubMed Health

Results for “shared variables”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4Linked to original sources

PubMed1984

Supply dependency of oxygen uptake in ARDS: myth or reality?

Several reports state that oxygen uptake changed in direct correlation with changes in total oxygen delivery to the tissues in the adult respiratory distress syndrome (ARDS). Oxygen uptake appeared to be limited by oxygen delivery even at normally adequate levels so that uptake was abnormally dependent on supply. These reports are discussed with respect to whether or not such a result could have been due to errors in measurement or to mathematical coupling by relating two quantities that shared a common variable. Having rejected that proposition, animal experiments are cited in which abnormal oxygen supply dependency was produced by microembolization. The accompanying loss of reactive hyperemia and inability to extract oxygen were consistent with a progressive loss of recruitable capillaries. Evidence is presented that the potential for embolization in ARDS is greatly enhanced by activation of the complement and arachidonic acid cascades as well as by the xanthine oxidase system. The resultant use of molecular oxygen by non-ATP producing oxidase systems might also account for the increase of supply dependent oxygen demand in ARDS.

Animals↗

PubMed1989

Substitution between prescribed and over-the-counter medications.

Using data from the Health Insurance Experiment (HIE), this article examines use of over-the-counter drugs (OTC) in a general, nonelderly population. Families from six areas of the country were assigned to health insurance plans that varied in the amount of medical care cost sharing. Thus, the out-of-pocket prices of OTC relative to prescription drugs were experimentally varied. The sites were chosen to represent markets with differing access to physician services. Multivariate methods were used to relate OTC use (collected from bi-weekly health diaries) to cost sharing and demographic variables. The empirical results do not support the expectation that people assigned less generous insurance for prescription drugs substitute OTC for prescriptions. People with complete insurance coverage purchased more of both types of drugs, suggesting OTC are an adjunct to formal medical care, rather than a substitute for it. Better educated and more knowledgeable consumers used more OTC drugs and spent more of their drug budget on OTC products. That there was greater OTC drug use in HIE sites with poorer access to formal medical care suggests there was some substitution between formal care and self-care with OTC drugs. Overall, however, better financial access to formal care promotes rather than substitutes for OTC use.

Adolescent↗

PubMed1990

Cross-reactive idiotypes in sera from patients with leprosy, lupus and Lyme disease and from healthy individuals.

Monoclonal IgM autoantibodies have previously been generated from a patient with lepromatous leprosy. Polyclonal anti-idiotypes raised against two of these monoclonal antibodies (8E7 and TH9) were used in an immunoassay to detect the presence of idiotype in human serum. The anti-idiotypes recognize different but overlapping sets of idiotypic determinants, some of which are present on antibodies which bind to Mycobacterium leprae. Sera were tested from 16 individuals with leprosy, 45 with systemic lupus erythematosus, 20 with Lyme disease, and 80 healthy subjects. Positive sera were detected in all groups (seven, two, three, and four, respectively). In most cases the serum bound to both anti-idiotypes, the idiotype being present in the IgM and/or IgG fraction. Levels of the two idiotypes varied independently of total serum IgG concentration and, in serial samples from one patient, independently of each other. The results indicate that 8E7 and TH9 may be representative of serum antibodies which are commonly expressed in leprosy, but may also be expressed in other diseases and in health; and they suggest that such serum antibodies are encoded by a widely shared set of variable region genes.

Cross Reactions↗

PubMed1995

Direct production of the Fab fragment derived from the sperm immobilizing antibody using polymerase chain reaction and cDNA expression vectors.

PROBLEM: Sperm immobilizing antibodies cause infertility mainly through complement dependent sperm immobilization. To analyze any effect of sperm immobilizing antibody on fertilization, we had already established cell lines that secrete IgM monoclonal antibody (MAb H6-3C4) and IgG monoclonal antibody (MAb EnBCMGS). The latter was a class-switched recombinant IgG antibody that shares the same variable region as MAb H6-3C4. The biological effects of the IgG antibody were also reported previously to eliminate sperm immobilizing or sperm agglutinating activities. However, the method of chemical digestion of IgG had some disadvantage to prepare the purified Fab fragment stably and in large quantities. This time we report a unique method to obtain the recombinant Fab fragments (Fab EnBCMGS) using polymerase chain reaction (PCR) and cDNA expression vectors. METHOD: Two kinds of PCR primers were designed to make a truncated heavy chain (Fd) gene of MAb EnBCMGS. The amplified Fd gene and light chain gene were ligated into cDNA expression vectors and then transfected into mammalian cells. RESULTS: Expression of the Fd gene and light chain gene were confirmed by Northern blotting. Secretion of the recombinant Fab fragment from mammalian cells was also confirmed by Western blotting. The Fab fragment showed biological activity as is expected by FACS analysis. CONCLUSION: This method enables the stable production of genuine Fab fragments of IgG in mammalian cells without any chemical treatment that may be time consuming and affect the quality of the Fab fragments.

Amino Acid Sequence↗

PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗

PubMed1994

Average case analysis of an Hebb-type rule that finds the network connectivity.

We describe an Hebb-type algorithm for learning unions of nonoverlapping perceptrons with binary weights. Two perceptrons are said to be nonoverlapping if they do not share any input variables. The learning algorithm is able to find both the network architecture and the weight values necessary to represent the target function. Moreover, the algorithm is local, homogeneous, and simple enough to be biologically plausible. We investigate the average behavior of this algorithm as a function of the size of the training set. We find that, as the size of the training set increases, the hypothesis network built by the algorithm "converges" to the target network, both in terms of the number of perceptrons and the connectivity. Moreover, the generalization rate converges exponentially to perfect generalization as a function of the number of training examples. The analytic expressions are in excellent agreement with the numerical simulations. To our knowledge, this is the first average case analysis of an algorithm that finds both the weight values and the network connectivity.

Algorithms↗

PubMed1992

Modification of oxygen extraction ratio by change in oxygen transport in septic shock.

To help clarify the oxygen uptake/transport (VO2/TO2) relationship and because the oxygen extraction ratio (OER) and TO2 share no common variable such as cardiac index, we examined the changes in OER when TO2 was decreased in 12 patients with sepsis in whom a PEEP trial was performed. From zero end-expiratory pressure (ZEEP) to PEEP (12 +/- 3 cm H2O), a significant increase in OER from 30 +/- 10 percent to 38 +/- 12 percent (p less than 0.005) was observed, and individual percentage changes in OER were well correlated with individual percentage changes in TO2. The VO2 measured (VO2m) by respiratory gas analysis was unchanged, while VO2 calculated by the Fick equation (VO2f) decreased, suggesting a mathematical coupling between VO2f and TO2. Patients with hyperlactacidemia (n = 5) exhibited the same relationships between OER, VO2m, and TO2 as those without hyperlactacidemia. Our results suggest an adaptive response in the OER when TO2 is decreased in patients with established septic shock.

Adult↗

PubMedDate not supplied

The syndrome of idiopathic CD4+ lymphocytopenia.

The syndrome of idiopathic CD4+ lymphocytopenia has recently been recognized and referred to as the persistent depletion of peripheral blood CD4+ T lymphocytes below 300 cells per cubic millimeter or less than 20% of total lymphocytes in the absence of either HIV infection or other known causes of immunodeficiency. The available literature indicates that neither human retroviruses (HIV-1, HIV-2, HTLV-I, HTLV-II) nor other transmissible agents play any clear-cut role in the pathogenesis. Furthermore, the epidemiologic, immunologic and clinical features of this syndrome differ substantially from those of HIV infection. The heterogeneity of both immunologic abnormalities, in addition to CD4+ depletion, and clinical course in patients with this disorder points out no common cause although in at least a subset of patients the pathogenetic pathways could be shared with common variable immunodeficiency.

Humans↗

PubMed1974

Structure of antibodies with shared idiotypy: the complete sequence of the heavy chain variable regions of two immunoglobulin M anti-gamma globulins.

The complete amino acid sequence of the heavy chain variable regions of two different molecules of immunoglobulin M anti-gamma globulin has been determined. These proteins, from different human patients, had independently been shown to share idiotypic specificity. Only eight sequence differences were discernible for the entire length of their heavy chain variable regions. Five of the differences occurred outside hypervariable regions, while three were placeable within such regions. A comparison of these molecules of anti-gamma globulin with the seven human V(H)III variable region sequences presently available for immunoglobulins without known antibody activity showed that the great majority of sequence differences between the two idiotypically similar antibodies and these seven proteins were confined to hypervariable regions. This study illustrates in precise terms a convergence of the distinct immunological properties of idiotypy, hypervariable region structure, and combining site specificity as they relate to the variable region of the immunoglobulin molecule. To a great degree these properties now appear to be a reflection of the same structural attributes of the variable region.

Amino Acid Sequence↗

PubMed1985

Variability within the rabbit C repeats and sequences shared with other SINES.

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence TCCCAGCAACCACATGGGAGGCAGAGA was found in all mammalian SINES examined. The 3' portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.

Animals↗

PubMed1984

Human figure drawing ability and vestibular processing dysfunction in learning-disabled children.

Explored the relationship between vestibular function as measured by duration of postrotary nystagmus and human figure drawing ability in 40 children labeled as learning disabled. Regression analysis revealed that the variable of chronological age shared the most variance with human figure drawing scores. Postrotary nystagmus durations also shared a significant amount of variance with human figure drawing scores, while the variables of IQ and sex were nonsignificant. The results provide additional support for the assertion that some learning-disabled children evidence deficits in vestibular processing ability and that these deficits may affect performance on cognitive-perceptual tasks.

Child↗

PubMed1985

Determinants of market share for a hospital's services.

This study identifies and analyzes factors under a hospital's control that can affect its market share. The study, utilizing the Multiplicative Competitive Interaction model, specifically focuses on determining the market share for each hospital within a geographic area, as opposed to the total demand for hospital services within an area. The results indicate that the effect of the number of physician affiliations on hospital patient share is statistically significant. The article investigates the variables that affect the level of physician affiliation. Besides physician affiliation, hospital location, a PROFILE factor based on a composite of a number of variables, and the proportion of affiliated physicians who are not affiliated elsewhere have a significant impact on each hospital's market share. The variables examined resulted in an R2 = 0.901 for individual hospital patient market share.

Catchment Area, Health↗

PubMed1986

Variable susceptibility to immune complex glomerulonephritis among mice sharing the same major histocompatibility complex.

Three inbred strains of mice were identified which demonstrated different susceptibilities to induction of immune complex glomerulonephritis (ICGN) despite sharing the same major histocompatibility complex haplotype (H-2k). Groups of mice from each of these three strains, B10.BR, CBA and C3H/HeJ, were injected with one of two different dose schedules of horse apoferritin (HAF) for 4 weeks, after which glomerular morphology, immunoglobulin deposition, and serum anti-HAF antibody levels were examined. With either dose schedule, only those mice which demonstrated a high level antibody response developed ICGN and glomerular immunoglobulin deposition. These results suggest that susceptibility to ICGN in this model is related to the level of antigen exposure and to the magnitude of the antibody response, which is not under strict control of the major histocompatibility complex.

Animals↗

PubMed1984

Muscular synergism--II. A minimum-fatigue criterion for load sharing between synergistic muscles.

P6new physiological criterion for muscular load sharing is developed. The criterion is based on the assumption that the endurance time of muscular contractions is maximized, hence muscular fatigue is minimized. The optimization problem is cast in the form of a linearly constrained, non-linear MINIMAX optimization. The new method predicts that: (1) there is synergistic muscle action, (2) muscle force increases non-linearly with external force (load), (3) relatively more force is allocated to muscles that have a large maximum force (large muscles), (4) relatively more force is allocated to muscles with a high percentage of slow-twitch fibers (muscles that are fatigue-resistant), (5) the load sharing does not depend on the moment arm of the muscles (although the absolute force levels do depend on this variable). The predicted load sharing between two cat muscles during standing and walking is in good agreement with direct force measurement data from the literature.

Animals↗

PubMedDate not supplied

Needle sharing behaviour among injection drug users (IDUs) in treatment in Montreal and Toronto, 1988-1989.

Injection drug users (IDUs) entering treatment programs in Montreal and Toronto were recruited for a study of drug using behaviour and risk of HIV infection. Only those who had injected within 6 months of entering their treatment program were eligible for participation. 183 subjects were recruited in Montreal and 167 in Toronto between November, 1988 and October, 1989. Each participant completed a standardized interviewer-administered questionnaire which focussed on, among other things, drug history and needle sharing behaviour. Approximately three-quarters of respondents in both cities reported sharing needles and syringes within the 6-month period prior to their entry into treatment. Our analysis, which focussed on variables associated with needle sharing revealed that having a sexual partner who injected, trouble obtaining sterile needles and syringes and cocaine injection were significantly and independently associated with needle sharing in a logistic regression model which also controlled for city of recruitment.

AIDS Serodiagnosis↗

PubMed1989

Shared surface epitopes among trypanosomes of the same serodeme expressing different variable surface glycoprotein genes.

African trypanosomes evade the immune response of the mammalian host by undergoing antigenic variation, caused by sequence changes in a variable surface glycoprotein (VSG). The majority of trypanosome clones analyzed thus far are not known to share surface exposed epitopes or express appreciably homologous VSGs. We show here that four clones of Trypanosoma brucei from the same serodeme express different VSGs and share exposed epitopes to varying degrees, as defined by monoclonal antibodies. Rabbit antiserum against any one of the four VSGs recognizes epitopes present on all four trypanosomes in live cell immunofluorescence assay. The expressed VSGs are partially homologous at the N-terminus with multiple point substitutions of amino acids which distinguish each of the four VSGs. The genes coding for these VSGs are members of one gene family and an expression-linked copy with a unique restriction map is present in each trypanosome. Analysis of the ontogeny of the expressed genes should reveal mechanisms of evolution in trypanosome variable antigen repertoires.

Amino Acid Sequence↗

PubMed1990

Bivariate survival models for analysis of genetic and environmental effects in twins.

Classic methods in genetics for the analysis of binary attributes, based on an assumption of a "threshold" on a normally distributed latent variable called "liability," estimate the strength of genetic and environmental effects from differences in correlations between relatives of differing genetic relatedness. Two problems that are not easily addressed by these methods are the need to take the age of onset into account (particularly in chronic diseases in which incidence rates vary considerably with age and the lengths of time at risk can vary between individuals) and the desirability of incorporating measured covariates (genetic or environmental). The standard methods of cohort analysis used in epidemiology allow for both of these features, but until recently have been restricted to independent individuals. Recent developments in survival analysis have extended the widely used "proportional hazards" model of Cox by the addition of latent variable, epsilon, reflecting the shared susceptibility of related subjects because of their shared genes or shared environment. We show how this approach can be combined with more traditional models of gene-environment interaction to allow the main effects of measured genetic markers and environmental variables to be estimated, as well as the residual variance of genetic and environment and their interactions. The approaches are applied to a cohort of female twin births in Sweden from 1886 to 1958, linked with the Swedish cancer registry from 1961 to 1982.

Adult↗

PubMed1988

Use of syllable-scale timing to discriminate words.

Assuming that only primitive, imperfect phonetic labeling of speech could be achieved by an automatic speech segmenter, words from several small vocabularies were identified using discriminant analysis, where the locations of prominent acoustic boundaries were combined in the optimum linear fashion. A set of two-syllable words that shared the same spelling in a weak alphabet (using categories like stop closure, fricative, vowel, etc.), but that differed in such features as which syllable was stressed, the tensity of the vowel, the identity of particular segments, etc., was selected. Discriminant analysis on the vector of six segmental boundaries achieved recognition accuracy 6.3 times better than chance. The words were produced by six talkers at two speaking tempos and measured by hand from sound spectrograms. Testing was performed on productions different from those used in training. When more confusable words (sharing the same stress pattern) were employed, performance was still five times better than chance. In a third experiment, the first two word sets were combined, and a subset of the variables (four of them) shared in common was employed for identification. This time recognition using temporal information was still able to do a reasonable job of discriminating the words. The results suggest that considerable information is available in segmental timing for identifying words even when the phonetic labeling of speech is weak.

Female↗