SEARCH · PubMed Health

Results for “simple sequence repeat”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 73 records · Page 4Linked to original sources

PubMed1992

Molecular mapping of mouse chromosomes 4 and 6: use of a flow-sorted Robertsonian chromosome.

The development of dense genetic maps of mammalian chromosomes is facilitated when chromosome-specific libraries are used as a source of genetic markers. To saturate the genetic maps of mouse chromosomes 4 and 6, we have made use of fluorescent-activated chromosome sorting to purify a 4:6 Robertsonian chromosome from a cell line harboring the Rb(4:6)2Bnr translocation. After staining with chromomycin A3 and Hoechst 33528, this chromosome was separated from the other mouse chromosomes. DNA was isolated from the fraction containing the Robertsonian chromosome and subcloned into the insertion vector lambda gt10, generating a library with 4.6 x 10(5) independent phage. A total of 19 single-copy sequences were used to type the progeny of a C57BL/6J x Mus spretus backcross that had previously been typed for loci on chromosomes 4 and 6. Approximately 70% of the clones in the library mapped to either chromosome 4 or 6 as assessed by genetic mapping and by use of a somatic cell hybrid panel. Simple sequence repeats have also been isolated from this library. Further characterization of these microsatellites should accelerate efforts to map mouse chromosomes 4 and 6 using PCR. In addition, flow sorting of Robertsonian chromosomes suggests a general approach for making chromosome-specific libraries in mouse.

Animals↗

PubMed1992

A genetic linkage map of human chromosome 20 composed entirely of microsatellite markers.

Twenty-six (CA)n polymorphic microsatellites were isolated from a flow-sorted chromosome 20 library. To reduce the number of sequencing gels, these microsatellites were genotyped on 15 CEPH families using a procedure derived from the multiplex sequencing technique of G. M. Church and S. Kieffer-Higgins (1988, Science 240:185-188). A primary map with a strongly supported order was constructed with 15 (CA)n markers. Regional localizations for the 11 other microsatellites were obtained with regard to the primary map. The 26 loci span approximately 160 cM. Regional localizations for a set of index markers (D20S4, D20S6, D20S16, and D20S19) and for other markers from the CEPH Public Database (D20S5, D20S15, D20S17, and D20S18) have also been determined. The total map spans a genetic distance of approximately 195 cM extending from the (CA)n marker IP20M7 on 20p to D20S19 on 20q. The density of microsatellite markers is markedly higher in the pericentromeric region, with an average distance of 3 to 4 cM between adjacent markers over a distance of 43 cM. Two-thirds of these randomly isolated microsatellites are clustered in that region between D20S5 and D20S16 representing approximately one-fourth of the linkage map. This might suggest a nonrandom distribution of (CA)n simple sequence repeats on this chromosome.

Chromosome Mapping↗

PubMed1989

Telomeric DNA dimerizes by formation of guanine tetrads between hairpin loops.

The telomeric ends of eukaryotic chromosomes are composed of simple repeating sequences in which one DNA strand contains short tracts of guanine residues alternating with short tracts of A/T-rich sequences. The guanine-rich strand is always oriented in a 5'-3' direction towards the end of the chromosome and is extended to produce a 3' overhang of about two repeating units in species where the telomeric terminus is known. This overhang has been implicated in the formation of several unusual intra-and intermolecular DNA structures, although none of these structures has been characterized fully. We now report that oligonucleotides encoding Tetrahymena telomeres dimerize to form stable complexes in solution. This salt-dependent dimerization is mediated entirely by the 3'-terminal telomeric overhang (TT-GGGGTTGGGG) and produces complexes in which the N7 position of every guanine in the overhangs is chemically inaccessible. We therefore propose that telomeric DNA dimerizes by hydrogen bonding between two intramolecular hairpin loops, to form antiparallel quadruplexes containing cyclic guanine base tetrads. These novel hairpin dimers may be important in telomere association and recombination and could also provide a general mechanism for pairing two double helices in other recombinational processes.

Animals↗

PubMed1992

Linkage disequilibrium mapping in isolated founder populations: diastrophic dysplasia in Finland.

Linkage disequilibrium mapping in isolated populations provides a powerful tool for fine structure localization of disease genes. Here, Luria and Delbrück's classical methods for analysing bacterial cultures are adapted to the study of human isolated founder populations in order to estimate (i) the recombination fraction between a disease locus and a marker; (ii) the expected degree of allelic homogeneity in a population; and (iii) the mutation rate of marker loci. Using these methods, we report striking linkage disequilibrium for diastrophic dysplasia (DTD) in Finland indicating that the DTD gene should lie within 0.06 centimorgans (or about 60 kilobases) of the CSF1R gene. Predictions about allelic homogeneity in Finland and mutation rates in simple sequence repeats are confirmed by independent observations.

Base Sequence↗

PubMed2026

EST-SSR based genetic polymorphism among Lablab (Lablab purpureus L. Sweet) accessions contrasting for drought stress at seedling stage.

Lablab is a multipurpose and the most drought-tolerant (DT) crop compared with its relatives. Despite its potential, Lablab is still an underutilized crop with a lack of improved varieties in many countries. The DT (D349, D147, HA4, D363, D352, D359, D348, D311, D55 and D250) and drought-susceptible (DS) (D271, D66, D106, D6, D26, D255, D28, D186, D95, and D258) accessions were earlier identified according to their morphological and biochemical responses to moisture stress at the seedling stage. These accessions were used to establish genetic polymorphism among the accessions contrasting for drought stress based on the Expressed Sequence Tag-Simple Sequence Repeats (EST-SSR) markers. The CTAB protocol was employed for the genomic DNA extraction. After DNA quality and quantity verification, the PCR was conducted using 16 EST-SSR primer pairs specific to the Lablab. The products were separated through the horizontal polyacrylamide gel electrophoresis (hPAGE). Discriminating ability of the markers and primers' efficiency were evaluated based on various genetic parameters. Principal Coordinate Analysis (PCoA) was performed to estimate the distance matrix among the population and among the accessions. While cluster analysis was processed to trace the genetic relationship among the accessions, dendrogram was constructed to decipher their genetic relationship. Analysis of Molecular Variance (AMOVA) was finally computed to quantify the diversity level and genetic relationship among the population, and among the accessions. A low polymorphism (GD = 0.19) was observed between the DT and DS accessions, likely due to limited discriminatory power of the EST-SSR markers. However, the PCoA, cluster analysis and AMOVA identified DT (D147, HA4, and D349) and DS (D106, D95, and D271) accessions as strongly contrasting populations under drought stress, with D147, HA4, D349, D363, D359, D352, and D348 further recommended as DT accessions. Given the low polymorphism observed, further validation using more informative molecular markers and advanced genomic approaches is recommended to improve the identification of drought-tolerance genes and related QTLs to support Lablab breeding programs.

Expressed Sequence Tags↗

PubMed2026

Molecular investigation of the progenitors, origin and domestication patterns of diploid Chinese old garden roses.

BACKGROUND AND AIMS: Chinese old garden roses are major contributors to the genetic development of modern roses. The RoKSN gene is associated with continuous flowering in roses and is proposed to have originated from Chinese wild roses. However, the wild roses that are implicated in the breeding of Chinese old garden roses and the origin of the RoKSN locus remain unidentified. We collected 25 of the most renowned and classic diploid Chinese old garden roses along with all related wild roses from East Asia. These roses were analysed with the aim of identifying the wild species that contributed to the genetic composition of Chinese old garden roses. In addition, we aimed to infer the geographical origin of the RoKSN gene and to develop a schematic overview of hybrid domestication of Chinese old garden roses. METHODS: We compared the haplotypes of internal transcribed spacers (nrITS), six nuclear single-copy genes and three chloroplast genes between Chinese old garden roses and wild roses. Additionally, we assessed genetic organization using 21 expressed sequence tag-simple sequence repeats to identify potential donor species that contributed to the emergence of these cultivars. Primers were designed for RoKSN to allow comparison of the gene across the entire distribution range of Rosa sect. Chinenses. KEY RESULTS: Our findings confirmed that the majority of rose cultivars are descendants of early hybridization events. Rosa chinensis var. spontanea, R. odorata var. gigantea and R. multiflora var. cathayensis were the primary donors for the 25 cultivar roses. Chinese old garden roses were categorized into four groups. Ten cultivars were hybrids between R. chinensis var. spontanea and R. multiflora var. cathayensis, thereby forming the 'Old Blush' group. Five cultivars were hybrids between 'Old Blush' and the R. kwangtungensis species complex, thereby forming the 'Slater's crimson' group. Six cultivars were hybrids between 'Old Blush' and R. odorata var. gigantea, thereby forming the 'Tea Rose' group, and three cultivars were hybrids that evolved from more than three donors. Moreover, we observed relatively close genetic proximity among Chinese old garden roses with an identical RoKSN-copia gene that is responsible for continuous flowering, which indicates a single origin for this retrotransposon-containing allele. Additionally, we determined that the haplotypes of the RoKSN-copia gene predominantly occurred in the Sichuan Basin region. In contrast, R. chinensis cultivated in the Ya'an region showed no markers of hybridization and displayed a genetic composition that was close to that of the wild species R. chinensis var. spontanea. This cultivar may represent the earliest mutated individual that bears the RoKSN-copia gene and may have served as a bridge from wild species to continuous-flowering old rose cultivars. CONCLUSIONS: The study provides crucial evidence that elucidates the origin of cultivated roses and lays the groundwork for further analysis of the breeding history of Chinese old garden roses using genomic data.

Domestication↗

PubMed1992

The recombinant congenic strains for analysis of multigenic traits: genetic composition.

The genetic control of susceptibility to many common diseases, including cancer, is multigenic both in humans and in animals. This genetic complexity has presented a major obstacle in mapping the relevant genes. As a consequence, most geneticists and molecular biologists presently focus on "single gene" diseases. To make the multigenic diseases accessible to genetic and molecular analysis, we developed a novel genetic tool, the recombinant congenic strains (RCS) in the mouse (4). The RC strains are produced by inbreeding of mice of the second backcross generation between two inbred strains, one of which serves as the "donor" and the other as the "background" strain. A series of RCS consists of approximately 20 strains, each carrying a different set of genes: approximately 12.5% genes from the common donor inbred strain, the remaining 87.5% from the common background inbred strain. As the set of donor strain genes in each RC strain is different, the nonlinked genes of the donor strain involved in the control of a multigenic trait, e.g., cancer susceptibility, become distributed into different RC strains where they can be analyzed one by one. Hence, the RCS system transforms a multigenic trait into a series of single gene traits, where each gene contributing to the multigenic control can be mapped and studied separately. Recently we demonstrated that the RCS system is indeed capable of resolving multigenic traits, which are hardly analyzable otherwise, by mapping four new colon tumor susceptibility loci (8; P. C. Groot, C. J. A. Moen, W. Dietrich, L. F. M. van Zutphen, E. S. Lander, and P. Demant, unpublished results). For successful application of the RCS system, extensive genetic characterization of the individual recombinant congenic strains is essential. In this paper we present detailed information about the genetic composition of three series of RC strains on the basis of typing of 120-180 markers distributed along all autosomes. The data indicate that the relative representation of the donor strain genes in the RC strains does not deviate from the theoretical expectation, and that the RC strains achieved a very high degree of genetic homogeneity and for all practical purposes can be considered inbred strains. The density and distribution of markers reported here permits an effective mapping of unknown genes of donor strain origin at almost all autosomal locations. Much of this information has been obtained using the new class of genetic markers, the simple sequence repeat polymorphisms.(ABSTRACT TRUNCATED AT 400 WORDS)

Animals↗

PubMed2025

Genomic signature and evolutionary history of completely cleistogamous lineages in the non-photosynthetic orchid Gastrodia.

Despite a long-standing interest since Darwin's time, the genomic implications of obligate self-fertilization remain elusive. Complete cleistogamy-the obligate production of closed, self-pollinating flowers-represents an extreme reproductive strategy. Here, we present the genomic profiles and evolutionary history of two lineages of the mycoheterotrophic orchid Gastrodia, both of which independently acquired complete cleistogamy, based on detailed sampling and a combination of simple sequence repeat (SSR), multiplexed ISSR genotyping by sequencing (MIG-seq) and RNA-seq data. Our analysis reveals clear species delimitation, with no evidence of introgression between the completely cleistogamous species and their co-occurring allogamous sisters. Intriguingly, all analyses indicate that both the completely cleistogamous Gastrodia species and their allogamous sisters exhibit genetic profiles typical of self-pollinating plants. This pattern suggests that their ancestors, probably bearing allogamous flowers, had already evolved mechanisms to mitigate the deleterious effects of selfing, potentially facilitating the emergence of complete cleistogamy through benefits such as reproductive assurance, enhanced colonization ability and species reinforcement. Meanwhile, further analyses suggest that complete cleistogamy evolved very recently (possibly within the last 1000-2000 years) in these two Gastrodia lineages. Combined with the scant evidence of complete cleistogamy outside Gastrodia, our findings imply a limited and ephemeral role for complete cleistogamy in plant speciation.

Biological Evolution↗

PubMed2025

Alternative splice acceptor site in MSH4 gene is responsible for male sterility conferred by ms5 in soybean.

In soybean breeding, using the recessive male-sterile ms5 gene, derived from fast neutron mutagenesis, for recurrent selection is advantageous because of the d2 locus, which controls cotyledon color in mature seeds and can be used as a phenotypic selection marker for ms5 male sterility. However, occasional self-fertilization occurs because of the elimination of d2 linkage and instability of male sterility. Elucidating the mechanism and the gene responsible for ms5 male sterility may resolve these problems. Using fine mapping with 15 simple sequence repeat (SSR) markers, we narrowed down the candidate ms5 locus to a 54-kbp region. Bulked-DNA analysis using next-generation sequencing revealed a deletion as a candidate variation in the region. This 15-bp deletion and a nucleotide substitution were identified in intron 1 of MutS homolog (GmMSH4), which modulates chromosomal recombination in meiosis. The ms5 transcript contained a novel exon with a premature termination codon. This exon originated from an alternative splice acceptor site caused by the deletion and nucleotide substitution, disrupting gene function. Co-segregation of male sterility with five independent mutations in GmMSH4 was confirmed using progeny of mutant lines. Mutations in GmMSH4 led to biased DNA partitioning during meiosis, resulting in collapsed or enlarged pollen and suggesting that ms5 male sterility is caused by the failure of pollen formation during meiosis due to the loss of function of GmMSH4. These findings could help explain the mechanism of instability of ms5 male sterility and improve the efficiency of recurrent selection using DNA markers in soybean breeding.

Glycine max↗

PubMed2024

Comparative analysis of chloroplast genomes in ten holly (Ilex) species: insights into phylogenetics and genome evolution.

In order to clarify the chloroplast genomes and structural features of ten Ilex species and provide insights into the phylogeny and genome evolution of the genus Ilex, we conducted a comparative analysis of chloroplast genomes using bioinformatics methods. The chloroplast genomes of ten Ilex species were obtained, and their structural features and variations were compared. The results indicated that all chloroplast genomes in the genus Ilex exhibit a double-stranded circular structure, with sizes ranging from 157,356 to 158,018 bp, showing minimal differences in size. The chloroplast genomes of the ten Ilex species have a relatively conservative gene count, with a total of 134 to 135 genes, including 88 or 89 protein-coding genes, and a conserved number of 8 rRNA genes. Each chloroplast genome contains 3 to 123 SSR (Simple Sequence Repeat) sites, predominantly composed of mononucleotide and trinucleotide repeats, with no detection of pentanucleotide or hexanucleotide repeats. The variation in dispersed repeat sequences among Ilex species is minimal, with a total repeat sequence number ranging from 1 to 14, concentrated in the length range of 30 to 42 base pairs. The expansion and contraction of chloroplast genome boundaries among Ilex species are relatively stable, with only minor variations observed in individual species. Variations in non-coding regions are more pronounced than those in coding regions, with the variability in the Large Single Copy region (LSC) being the highest, while the variability in the Inverted Repeat region A (IRa) is the lowest. The divergence time among Ilex species was estimated using the MCMC-tree module, revealing the evolutionary relationships among these species, their common ancestors, and their differentiation throughout the evolutionary process. The research findings provide a valuable reference for the systematic study and molecular marker development of Ilex plants.

Genome, Chloroplast↗

PubMed2016

Genomic heterozygosity and hybrid breakdown in cotton (Gossypium): different traits, different effects.

BACKGROUND: Hybrid breakdown has been well documented in various species. Relationships between genomic heterozygosity and traits-fitness have been extensively explored especially in the natural populations. But correlations between genomic heterozygosity and vegetative and reproductive traits in cotton interspecific populations have not been studied. In the current study, two reciprocal F2 populations were developed using Gossypium hirsutum cv. Emian 22 and G. barbadense acc. 3-79 as parents to study hybrid breakdown in cotton. A total of 125 simple sequence repeat (SSR) markers were used to genotype the two F2 interspecific populations. RESULTS: To guarantee mutual independence among the genotyped markers, the 125 SSR markers were checked by the linkage disequilibrium analysis. To our knowledge, this is a novel approach to evaluate the individual genomic heterozygosity. After marker checking, 83 common loci were used to assess the extent of genomic heterozygosity. Hybrid breakdown was found extensively in the two interspecific F2 populations particularly on the reproductive traits because of the infertility and the bare seeds. And then, the relationships between the genomic heterozygosity and the vegetative reproductive traits were investigated. The only relationships between hybrid breakdown and heterozygosity were observed in the (Emian22 × 3-79) F2 population for seed index (SI) and boll number per plant (BN). The maternal cytoplasmic environment may have a significant effect on genomic heterozygosity and on correlations between heterozygosity and reproductive traits. CONCLUSIONS: A novel approach was used to evaluate genomic heterozygosity in cotton; and hybrid breakdown was observed in reproductive traits in cotton. These findings may offer new insight into hybrid breakdown in allotetraploid cotton interspecific hybrids, and may be useful for the development of interspecific hybrids for cotton genetic improvement.

Chromosomes, Plant↗

PubMed2026

Strong phylogenetic signal from chloroplast genomes of three Barringtonia species provides the first genomic resources for their conservation.

BACKGROUND: The genus Barringtonia (Lecythidaceae) is a vital component of tropical coastal forests and mangrove ecosystems. Among its members, B. racemosa and B. fusicarpa are classified as Endangered and Vulnerable, respectively, due to habitat degradation and anthropogenic pressures, underscoring the urgent need for genetic studies to guide conservation. Chloroplast (cp.) genomes serve as essential resources for phylogenetic reconstruction and conservation genetics. However, the scarcity of cp. genome data for Barringtonia has limited comprehensive evolutionary and conservation-oriented investigations. RESULTS: We assembled and annotated the first complete cp. genomes of B. racemosa, B. fusicarpa, and B. acutangula. All three genomes exhibit the typical quadripartite structure, ranging from 158,959 bp (B. racemosa) to 159,837 bp (B. acutangula), and contain 132 genes (87 protein-coding, 37 tRNA, 8 rRNA) with a GC content of 36.68%-36.86%. Collinearity and IR boundary analyses revealed high structural conservation without large-scale rearrangements. Interspecific sequence-level variations were detected in simple sequence repeats (SSRs) and long repeats. Nucleotide diversity (π) analysis identified highly polymorphic regions, including rpl20 (π = 0.080), rpoA (π = 0.064), rps3 (π = 0.063), and ndhF (π = 0.060), which represent promising molecular markers for population genetics within the genus. Codon-based selection analyses (Ka/Ks) showed that all protein-coding genes are under strong purifying selection (mean Ka/Ks 0.32-0.37), with no evidence of positive selection. Pairwise genetic distances (p-distances) among Barringtonia species are extremely low (mean 0.0046), while distances to the related genus Bertholletia are ~ 6-fold higher, supporting their generic distinction. CONCLUSIONS: Phylogenetic analysis robustly supports Barringtonia as a monophyletic clade (bootstrap = 100%), with B. racemosa and B. fusicarpa forming a sister lineage to B. acutangula. This study provides the first high-quality cp. genome resources for the two threatened Barringtonia species, revealing strong structural and sequence conservation but no direct chloroplast genomic correlates of endangerment. The identified polymorphic regions and repeat markers lay a foundation for future population genetics, phylogeographic studies, and conservation-oriented genetic management of these ecologically important coastal plants.

Genome, Chloroplast↗

PubMed2024

Nanopore-based full-length transcriptome sequencing for understanding the underlying molecular mechanisms of rapid and slow progression of diabetes nephropathy.

BACKGROUND: Diabetic nephropathy (DN) has been a major factor in the outbreak of end-stage renal disease for decades. As the underlying mechanisms of DN development remains unclear, there is no ideal methods for the diagnosis and therapy. OBJECTIVE: We aimed to explore the key genes and pathways that affect the rate progression of DN. METHODS: Nanopore-based full-length transcriptome sequencing was performed with serum samples from DN patients with slow progression (DNSP, n = 5) and rapid progression (DNRP, n = 6). RESULTS: Here, transcriptome proclaimed 22,682 novel transcripts and obtained 45,808 simple sequence repeats, 1,815 transcription factors, 5,993 complete open reading frames, and 1,050 novel lncRNA from the novel transcripts. Moreover, a total of 341 differentially expressed transcripts (DETs) and 456 differentially expressed genes (DEGs) between the DNSP and DNRP groups were identified. Functional analyses showed that DETs mainly involved in ferroptosis-related pathways such as oxidative phosphorylation, iron ion binding, and mitophagy. Moreover, Functional analyses revealed that DEGs mainly involved in oxidative phosphorylation, lipid metabolism, ferroptosis, autophagy/mitophagy, apoptosis/necroptosis pathway. CONCLUSION: Collectively, our study provided a full-length transcriptome data source for the future DN research, and facilitate a deeper understanding of the molecular mechanisms underlying the differences in fast and slow progression of DN.

Humans↗

PubMed1992

Isolation of YAC clones from the pericentromeric region of chromosome 10 and development of new genetic markers linked to the multiple endocrine neoplasia type 2A gene.

Genetic linkage mapping and contig assembly using yeast artificial chromosome (YAC) technology form the basis of our strategy to clone and define the genomic structure of the pericentromeric region of chromosome 10 containing the multiple endocrine neoplasia type 2A gene. Thus far YAC walks have been initiated from five chromosome 10 pericentromeric loci including RBP3, D10S94, RET, D10Z1, and FNRB. Long range pulsed-field gel electrophoresis maps are constructed from the YACs isolated to define clone overlaps and to identify putative CpG islands. Bidirectional YAC walks are continued by rescreening the YAC library with sequence-tagged site assays developed from end-clones. Several new restriction fragment length polymorphisms and simple sequence repeat polymorphism markers have been identified from the YAC clones. In particular, two highly informative (CA)n dinucleotide repeat markers, sTCL-1 from proximal chromosome 10p (16 alleles, PIC = 0.68) and sJRH-1 from the RBP3 locus (18 alleles, PIC = 0.88), provide useful reagents for a polymerase chain reaction-based predictive genetic test that can be performed rapidly from small amounts of DNA.

Chromosomes, Fungal↗

PubMed1991

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.

Animals↗

PubMed1985

Complete nucleotide sequence of the murine gamma 3 switch region and analysis of switch recombination sites in two gamma 3-expressing hybridomas.

The heavy chain isotype switch is mediated by a DNA rearrangement between a donor switch region (usually mu) and a recipient switch region (gamma, epsilon, or alpha). Switch regions lie upstream of the appropriate heavy chain constant region gene and are composed of simple sequences repeated in tandem. It is not known to what extent the tandemly repeated sequences are important to the heavy chain switch recombination, and to what extent other features of switch region sequences might contribute to the switch process. We studied switches to the gamma 3 isotype by sequencing the entire gamma 3 switch region. This switch region is composed of forty-four 49 base pair units repeated in tandem. These repeated units share modest homology with the mu switch region repeated elements. Evolution of the gamma 3 switch region seems to involve insertions and deletions of the 49mer elements. We also molecularly cloned rearranged switch regions from two gamma 3-expressing hybridomas and determined the DNA sequences at the mu-gamma 3 recombination sites. We located these switch recombination sites within the germ-line gamma 3 switch region, as well as switch recombination sites from two myelomas. All four sites are found in the 5' one-third of the gamma 3 switch region. We discuss some additional trends in the sequence data near these four recombination sites.

Animals↗

PubMed1978

Complex and simple sequences in human repeated DNAs.

Highly repeated human DNA sequences were isolated by isopycnic centrifugation, or were eluted from gels after restriction enzyme cleavage. High molecular weight DNA peaks separable from the bulk of the DNA in a variety of gradients were shown to consist of very simple sequences characteristic of simple satellite DNAs; DNA fingerprint studies indicated each of these peaks could consist of tandem repeats of a specific oligonucleotide sequence as low as 10 base pairs (bp) long. All the gradient peaks could be assigned to one of two sequence groups and several "different" buoyant density peaks revealed the same sequence.--Restriction fragment multimers did not share common sequences with the satellite DNAs as judged by hybridization data. They could not be separated by isopycnic centrifugation. Furthermore these highly repeated DNAs were more complex in sequence and more variable than the satellites. Even the smallest (50 bp) fragments by depurination and other direct sequencing methods were shown to be more complex than the high molecular weight satellite peaks.--The idea that subsets of repeated DNAs may be defined by sequence complexity, possibly with discrete or separable functions, is proposed.

Base Sequence↗

PubMed1992

Somatic cell hybrids, sequence-tagged sites, simple repeat polymorphisms, and yeast artificial chromosomes for physical and genetic mapping of proximal 17p.

Somatic cell hybrids retaining the deleted chromosome 17 from 15 unrelated Smith-Magenis syndrome (SMS) [del(17)(p11.2p11.2)] patients were obtained by fusion of patient lymphoblasts with thymidine kinase-deficient rodent cell lines. Seventeen sequence-tagged sites (STSs) were developed from anonymous markers and cloned genes mapping to the short arm of chromosome 17. The STSs were used to determine the deletion status of these loci in these and four previously described human chromosome 17-retaining hybrids. Ten STSs were used to identify 28 yeast artificial chromosomes (YACs) from the St. Louis human genomic YAC library. Four of the 17 STSs identified simple repeat polymorphisms. The order and location of deletion breakpoints were confirmed and refined, and the regional assignment of several probes and cloned genes were determined. The cytogenetic band locations and relative order of six markers on 17p were established by fluorescence in situ hybridization mapping to metaphase chromosomes. The latter data confirmed and supplemented the somatic cell hybrid results. Most of the hybrids derived from [del(17)(p11.2p11.2)] patients demonstrated a similar pattern of deletion for the marker loci and were deleted for D17S446, D17S258, D17S29, D17S71, and D17S445. However, one of them demonstrated a unique pattern of deletion. This patient is deleted for several markers known to recognize a large DNA duplication associated with Charcot-Marie-Tooth (CMT) disease type 1A. These data suggest that the proximal junction of the CMT1A duplication is close to the distal breakpoint in [del(17)(p-11.2p11.2)] patients.

Abnormalities, Multiple↗