SEARCH · PubMed Health

Results for “replicative form”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 739 records · Page 41Linked to original sources

PubMed1975

Studies on bacteriophage fd DNA. III. Nucleotide sequence preceding the RNA start-site on a promoter-containing fragment.

A short DNA fragment containing a strong promoter was isolated from phage fd replicative form DNA with the use of restriction endonucleases, and the sequence of 110 nucleotides in the region preceding the RNA start-site was determined. The sequence was : (5') CGGTCTGGTTCGCTTTGAGGCTCGAATTAAAACGCGATATTTGAAGTCTTTCGGGCTTCCTCTTAATCTTTTTGATCGAATTCGCTTTGCTTCTGACTATAATAGACAGG (3').

Base Sequence↗

PubMed1983

Interaction of minute virus of mice with differentiated cells: strain-dependent target cell specificity is mediated by intracellular factors.

The prototype strain of minute virus of mice and the immunosuppressive strain are unable to grow lytically in each other's murine host cell type. To characterize these strain-dependent virus-host cell interactions further, we have compared the early events of both productive and restrictive infections. Each virus binds to specific receptors on the surface of both productive and restrictive cell types. Competition experiments show that both viruses recognize the same receptor on each cell type. Penetration and uncoating are presumed to be similar in both productive and restrictive infections, since incoming viral genomes are converted to parental replicative form DNA independent of the final outcome of the virus-host cell interaction. In contrast to the majority of other systems studied to date, these differences in minute virus of mice target cell specificity are not mediated at the cell surface, but by the interaction of a strain-specific viral determinant with intracellular host factors that are expressed in particular cell types as a function of differentiation. These cellular factors catalyze a step in viral replication which occurs after the initiation of viral DNA synthesis, but before the detectable expression of the viral capsid polypeptide genes.

Animals↗

PubMed1995

Integration of hepatitis B virus and alteration of the 1p36 region found in cancerous tissue of primary hepatocellular carcinoma with viral replication evidenced only in noncancerous, cirrhotic tissue.

We have studied the genetic profile of the host genome and hepatitis B virus (HBV) in HBV-associated primary hepatocellular carcinoma (HCC). Comparative analyses of HCC cell line Hep 40 and the original biopsy specimens showed the episomal and replicating form of HBV only in the biopsy specimen from nontumor (NT) cirrhotic liver tissue, where a molecular change in the 1p36 region was detected (NT tissue showed a normal 46XY karyotype). In contrast, only integrated HBV was detected in HCC tumor (T) tissue and Hep 40 cells. Two HBV integration sites were identical in HCC tissue and the hyperdiploid Hep 40 cell line, where genetic alteration in the 1p36 region was identified. These data indicate that viral replication is ongoing only in NT cirrhotic-hyperplastic, chromosomally normal tissue with evidence for genetic instability. Only the tumor cell with altered genotype has virus integrated

Carcinoma, Hepatocellular↗

PubMed2001

Inhibition of hepatitis B virus production associated with high levels of intracellular viral DNA intermediates in iron-depleted HepG2.2.15 cells.

BACKGROUNDS/AIMS: The effects of iron-depletion on hepatitis B virus (HBV) replication were examined in HepG2.2.15 cells. METHODS: Proliferating cells were iron-depleted with desferrioxamine (DFO), at 20 or 100 microM for 48 h. Levels of viral mRNAs, cytoplasmic DNA replicative intermediates and virion production were examined. A comparative study was performed with hydroxyurea, a specific inhibitor of ribonucleotide reductase. RESULTS: In desferrioxamine treated cells, virion production is dramatically decreased, while viral replicative intermediates accumulate in the cytoplasm. DFO, like hydroxyurea, blocks cell cycle progression in the G1/S transition or S phase with a corresponding 2-fold increase of viral mRNAs. As expected, hydroxyurea leads to a strong reduction of virion production associated with low levels of intracellular replicative intermediates. CONCLUSIONS: These results strongly suggest that iron depletion affects the HBV life cycle indirectly through the cell cycle arrest and directly through the inhibition of the viral DNA secretion. They also indicate the need to re-evaluate with caution the iron depletion protocols on HBV infected patients since a decrease of viral markers in the serum following iron-depletion may not reflect a decrease of viral replicative forms, but on the contrary, could be associated with active viral DNA synthesis.

Cell Cycle↗

PubMed2004

NS-3 protein of the Junonia coenia densovirus is essential for viral DNA replication in an Ld 652 cell line and Spodoptera littoralis larvae.

The genome of Junonia coenia densovirus (JcDNV) shares with members of the genus Densovirus the property of possessing structural (VP) and nonstructural (NS) genes in opposite orientations. The three NS genes located in the 5' half on one strand encode three NS proteins assumed to be involved in viral DNA replication: NS-1 and NS-2, which are common to all DNVs, and a 28-kDa polypeptide, NS-3, with a unique sequence. Whereas the essential role played by JcDNV NS-1 in viral DNA replication has been clearly established (C. Ding, M. Urabe, M. Bergoin, and R. M. Kotin, J. Virol. 76:338-345, 2002), nothing is known of the biological function(s) of NS-3. To investigate this function, we designed constructs derived from pBRJ, a plasmid encompassing an infectious sequence of JcDNV DNA (M. Jourdan, F. X. Jousset, M. Gervais, S. Skory, M. Bergoin, and B. Dumas, Virology 179:403-409, 1990), with partial or complete deletion of NS-3 sequence or with the ATG initiation codon mutated by site-directed mutagenesis. Transfection of these constructs to sensitive Ld 652 cells or Spodoptera littoralis larvae prevented the accomplishment of a productive cycle. We clearly established that the blocking of the replicative cycle in the absence of NS-3 expression occurred at the level of viral DNA replication. Replication of viral DNA could be restored by cotransfecting Ld 652 cells with a plasmid expressing JcDNV-NS-3 protein in trans. Time course analysis showed that NS-3 is produced early (6 h posttransfection) in the replicative cycle, and its production parallels that of replicative-form viral DNA. Finally, we present evidence that NS-1 and NS-2 proteins are synthesized at apparently the same levels whether or not NS-3 is expressed.

Amino Acid Sequence↗

PubMed1992

Molecular and ultrastructural analysis of heavy membrane fractions associated with the replication of Kunjin virus RNA.

In subcellular extracts of Kunjin virus-infected cells prepared by lysis and differential centrifugation, the viral RNA polymerase, RNA and proteins were associated mainly with cytoplasm. When the cytoplasmic extract (500 g supernate) of infected cells labelled for 3 h from 24 h post-infection was further fractionated by rapid centrifugation through a sucrose density gradient, all viral products were located only in dense or "heavy membrane" fractions, which contained three types of virus-induced morphologically distinct membrane structures. These dense fractions were treated with 0.5% NP40 and the soluble material was again centrifuged through a sucrose gradient for analyses as before. Viral RNA polymerase activity was retained and was associated with replicative intermediate RNA and some replicative form RNA in the peak enzyme fractions sedimenting at 20S to 40S. Enrichment of NS3 and of the small nonstructural proteins NS2A and NS2B/NS4A was apparent in these fractions which were well separated from the slow sedimenting structural proteins. No detergent-resistant structures in the "heavy membrane" fractions other than ribosome-like particles were visible. The data show that the RNA polymerase complex cosedimented with virus-induced membrane structures and remained associated with specific nonstructural proteins and replicative intermediate RNA after detergent treatment.

Animals↗

PubMed1971

Nature of the complementary strands synthesized in vitro upon the single-stranded circular DNA of bacteriophage phiX174 after ultraviolet irradiation.

This paper describes experiments intended to decide whether UV lesions in DNA act as absolute blocks to chain elongation by the Escherichia coli DNA polymerase or only slow down the polymerization process. Ultraviolet (UV)-irradiated, single-stranded (SS) circular DNA of bacteriophage øX174 was used as template for the polymerase in a reaction mixture in vitro, under conditions allowing synthesis of not more than one complementary strand per template molecule. The mean length of the newly synthesized complementary strands (as determined by velocity sedimentation in alkaline CsCl gradients), as well as the over-all template activity (as measured by deoxyadenosine monophosphate [dAMP] incorporation) was found to decrease with the number of biologically lethal hits sustained by the irradiated templates. With the increase of time or temperature of reaction, the net synthesis of complementary strands increased (as a consequence of increased initiation), but their mean length remained constant. The mean length of synthesized strands was greater than would be expected if all biologically lethal hits were to block the polymerization process. The lethal hits which serve as blocking lesions are inferred to be pyrimidine dimers because it is possible to obtain synthesis of full-length complementary strands if, when heat-denatured, UV-irradiated, double-stranded replicative form (RF II) DNA of bacteriophage øX174 is used as a template, it is pretreated with yeast photoreactivating enzyme (YPRE) in presence of visible light.

Adenine Nucleotides↗

PubMed1996

Characterization of RNA synthesis during a one-step growth curve and of the replication mechanism of bovine viral diarrhoea virus.

The noncytopathic Australian bovine viral diarrhoea virus (BVDV) Trangie isolate was used to establish a one-step growth curve and to investigate previously uncharacterized aspects of pestivirus replication. The eclipse phase was found to be approximately 8 to 10 h and the first appearance of viral antigen assayed by immunofluorescence occurred around 6 h post-infection (p.i.). Both positive- and negative-sense virus RNAs were first detected at 4 h p.i. by Northern blot hybridization using strand-specific RNA probes generated by in vitro transcription from cDNA cloned from the NS3 region. The ratio of positive- to negative-sense virus RNA changed from 2:1 at 4 h p.i. to 10:1 at 12 h p.i. and thereafter. The kinetics of synthesis showed that the rate of synthesis of positive-strand viral RNA increased rapidly from 6 h p.i., whereas the rate of synthesis of the negative-strand remained constant. The copy number of genomic RNA determined by Northern blot hybridization analysis was estimated to be 1.5 x 10(4) copies per cell, 16 to 24 h p.i. Viral RNA species that were thought to represent replicative intermediate (RI) and replicative forms (RF) were detected after electrophoretic separation by urea-PAGE. Confirmation of the identity of the RI and RF was obtained using LiCl precipitation and RNase A digestion of [3H]uridine-labelled RNA. Pulse-chase labelling of BVDV-infected cells was consistent with synthesis of nascent BVDV RNA through an RI derived by strand displacement from an RF template and thus the synthesis of BVDV RNA is likely to be similar to the model proposed for flavivirus replication.

Animals↗

PubMed1976

Bacterial rep- mutations that block development of small DNA bacteriophages late in infection.

Several related mutants of Escherichia coli C have been isolated that block the growth of the small icosahedral DNA phages phiX174 and S13 late in infection. Phage G6 is also blocked, at a stage not yet known. Growth of the filamentous phage M13, though not blocked, is affected in these strains. These host mutations co-transduce with ilv at high frequency, as do rep- mutations. However, the new mutants, designated groL-, differ from previously studied rep- mutants in that they permit synthesis of progeny replicative-form DNA. The groL- mutants are blocked in synthesis of stable single-stranded DNA of phiX174 and related phages. They are gro+ for P2. Evidence that groL- mutations and rep- mutations are in the same gene is presented. Spontaneous mutants (ogr) of phiX174, S13, and the G phages can grow on groL- strains. The ogr mutations are located in the phage's major capsid gene, F, as determined by complementation tests. There are numerous sites for mutation to ogr. Some mutations in genes A and F interfere with the ogr property when combined with an ogr mutation on the same genome. The ogr mutations are cis acting in a groL- cell; i.e., an ogr mutant gives very poor rescue of a non-ogr mutant. The wild-type form of each G phage appears to be naturally in the ogr mutant state for one or more groL- strains. It is suggested that a complex between F and rep proteins is involved in phage maturation. The A protein appears to interact with this complex.

Chloramphenicol↗

PubMed1976

Isolation and characterization of the protein coded by gene A of bacteriophage phiX174 DNA.

Replication of phiX174 circular replicative form (RFI) DNA by extracts of Escherichia coli infected with bacteriophage phiX174 (amber in gene A) requires the phiX174 gene A product. This requirement has been used as an assay for the isolation of this protein. The gene A product (purified 4000-fold) caused relaxation of superhelical phiX174 RFI and formation of discontinuities in the viral strand of phiX174 RFI uniquely situated in the A region of the genome, and yielded a complex after interacting with phiX174 RFI that is active in replication of phiX RFI.

Coliphages↗

PubMed1997

Missense mutations in the 3' end of the Escherichia coli dnaG gene do not abolish primase activity but do confer the chromosome-segregation-defective (par) phenotype.

Isogenic dnaG strains of Escherichia coli with the parB and dnaG2903 alleles in the MG1655 chromosomal background displayed the classic par phenotype at the nonpermissive temperature of 42 degrees C. These strains synthesized DNA at 42 degrees C, but remained chromosome segregation defective as determined by cytology. A strain with the dnaG2903 allele was tested for its ability to support DNA replication of a primase-dependent G4ori(c)-containing M13 phage derivative by quantitative competitive PCR (QC-PCR). The dnaG2903 strain converted the single-stranded DNA into double-stranded replicative form DNA at 42 degrees C. These results indicate that DnaG2903 retains primase activity at the restrictive temperature. Nucleoids remained unsegregated in the central region of cell filaments at 42 degrees C. The observed suppression of cell filamentation in dnaG sfiA or dnaG lexA double mutants suggests that the SOS response is induced at the restrictive temperature in parB and dnaG2903 strains but fails to account entirely for the cell filamentation phenotype. ParB and DnaG2903 presumably can synthesize primer RNA for DNA replication, but may be defective in their interactions with DNA replication proteins, cell cycle regulatory factors, or the chromosome segregation apparatus itself.

Alleles↗

PubMed2007

An extended stem-loop 1 is necessary for human immunodeficiency virus type 2 replication and affects genomic RNA encapsidation.

Genomic RNA encapsidation in lentiviruses is a highly selective and regulated process. The unspliced RNA molecules are selected for encapsidation from a pool of many different viral and cellular RNA species. Moreover, two molecules are encapsidated per viral particle, where they are found associated as a dimer. In this study, we demonstrate that a 10-nucleotide palindromic sequence (pal) located at the 3' end of the psi encapsidation signal is critical for human immunodeficiency virus type 2 (HIV-2) replication and affects genomic RNA encapsidation. We used short-term and long-term culture of pal-mutated viruses in permissive C8166 cells and their phenotypic reversion to show the existence of a structurally extended SL1 during HIV-2 replication, formed by the interaction of the 3' end of the pal within psi with a motif located downstream of SL1. The stem extending HIV-2 SL1 is structurally similar to stem B described for HIV-1 SL1. Despite the high degree of phylogenetic conservation, these results show that mutant viruses are viable when the autocomplementary nature of the pal sequence is disrupted, but not without a stable stem B. Our observations show that formation of the extended SL1 is necessary during viral replication and positively affects HIV-2 genomic RNA encapsidation. Sequestration of part of the packaging signal into SL1 may be a means of regulating its presentation during the replication cycle.

Animals↗

PubMed1990

Novel replication mutant of microvirid phage alpha 3 deleted in the complementary strand origin.

The bacteriophage alpha 3 origin of complementary strand DNA synthesis (-ori) contains two potential secondary loop structures (I and II), which have been implicated as direct recognition sites for host Escherichia coli DnaG protein. To elucidate to what extent such structures are essential, we introduced a nucleotide deletion within the -ori region, by nuclease digestion of alpha 3 replicative form DNA. A mutant, delB, thus constructed had a 121 nucleotide deletion within the -ori region and was completely lacking in the two putative hairpin loops, I and II. The delB mutant formed smaller plaques on the host E. coli C and had a longer latent period, but the mean burst size at 37 degrees C was almost the same (400 phages) as that of the wild type. In contrast to the parental phage, growth of the mutant depends on host dnaB and dnaC functions. These results indicate that the prototype secondary structures in the alpha 3 origin of complementary strand synthesis are dispensable for delB and that the alpha 3 mutant has an additional replication origin whose function is dependent on DnaB and DnaC proteins, rather than on DnaG protein alone.

Bacteriophages↗

PubMed1996

Effect on DNA topology by DnaA protein, the initiation factor of chromosomal DNA replication in Escherichia coli.

We examined effects on supercoiled DNA topology of DnaA protein, the initiator protein of chromosomal DNA replication in Escherichia coli. The activity was identified in an analysis of plasmid DNA incubated with DnaA protein and DNA topoisomerase I. In Superose 12 gel filtration chromatography, the activity coeluted with DnaA protein. Incubation of DnaA protein with DNA at temperatures over 24 degrees C was required for this activity, which was observed with either oriC plasmid or the replicative form I of phi X174 with no DnaA box. As binding of ATP or ADP to DnaA protein prevented the activity of DnaA protein on DNA topology, binding of the adenine nucleotide may regulate the activity.

Adenosine Diphosphate↗

PubMed1988

Amastigotes of Trypanosoma cruzi sustain an infective cycle in mammalian cells.

The two main stages of development of the protozoan parasite Trypanosoma cruzi found in the vertebrate host are the trypomastigote and the amastigote. It has been generally assumed that only trypomastigotes are capable of entering cells and that amastigotes are the intracellular replicative form of the parasite. We show here that after incubation for 4 h with human monocytes in vitro 90% or more of extracellularly derived (24 h) amastigotes of T. cruzi are taken up by the cells. Within 2 h they escape the phagocytic vacuole and enter the cytoplasm, where they divide and after 4-5 d transform into trypomastigotes. Trypomastigotes also invade cultured human monocytes. However, they show a lag of several hours between invasion and the start of DNA duplication, while amastigotes commence replication without an apparent lag. Amastigotes also infect cultured fibroblasts, albeit with lower efficiency. When injected intraperitoneally into mice, amastigotes are as infective as trypomastigotes. Based on these results, and on prior findings that amastigotes are found free in the circulation of mice during the acute stage of the disease (3), it seems likely that the cellular uptake of amastigotes can initiate an alternative subcycle within the life cycle of this parasite in the mammalian host. Also, because trypomastigotes and amastigotes have diverse surface antigens, they may use different strategies to invade host cells.

Animals↗

PubMed1980

Process of attachment of phi X174 parental DNA to the host cell membrane.

The phi X174-DNA membrane complex was isolated from Escherichia coli infected with phi X174 am3 by isopycnic sucrose gradient centrifugation followed by zone electrophoresis. The phi X174 DNA-membrane complex banded at two positions, intermediate density membrane fraction and cytoplasmic membrane fraction, having bouyant densities of 1.195 and 1.150 g/ml, respectively. Immediately after infection with phi X147, replicating DNA was pulse-labeled and then the incorporated label was chased. The radioactivity initially recovered in the intermediate density membrane fraction migrated to the cytoplasmic membrane fraction. The DNAs from both complexes sedimented mainly at the position of parental replicative form I (RFI). The phi X174 DNA-membrane complex contained a speficic membrane-bound protein having a molecular weigth of 80,000 which is accumulated in the host DNA-membrane complex. These results suggest that when phi X174 DNA penetrated into cells in the early phase of infection, single-stranded circular DNA was converted to parental RFI at a wall/membrane adhesion region and migrated to the cytoplasmic membrane fraction, where the parental RF could serve as a template in the replication of progeny RF.

Bacteriophage phi X 174↗

PubMed1997

Hepatitis B virus replication is cell cycle independent during liver regeneration in transgenic mice.

The content of hepatitis B virus (HBV) replicative forms and HBV core protein in the liver of HBV transgenic mice is transiently reduced during massive liver regeneration following partial hepatectomy while the steady-state content of viral RNA is unchanged. This antiviral effect is triggered by interferon and tumor necrosis factor that are induced in the liver following hepatectomy and either prevent the formation or accelerate the degradation of viral nucleocapsids in the cytoplasm of the hepatocyte. Despite massive hepatocellular turnover, this effect is independent of liver cell division, indicating that HBV replicates efficiently in resting and dividing hepatocytes.

Animals↗

PubMed1993

Replicative viral DNA in Epstein-Barr virus associated Burkitt's lymphoma biopsies.

Epstein-Barr virus (EBV) is linked to a spectrum of human diseases including epithelial and lymphoid malignancies in which it exists predominantly in a latent state. EBV is capable of establishing replicative infection at oropharyngeal and genital sites. Replicative EBV infection also occurs in oral hairy leukoplakia, in EBV associated lymphoproliferative disorders, and to a minor degree in nasopharyngeal carcinomas. Recent evidence also suggests that EBV replication, also, may be associated with AIDS related lymphomas and Hodgkin's disease. However it is widely believed that virus in circulating B-lymphocytes and in B-cell malignancies is stringently latent. We now show that by Southern blot analysis we can detect replicative forms of virion DNA in 14.5% (8 of 55) of EBV-positive Burkitt's lymphoma biopsies. This may be the explanation for the elevation of the titres of lytic cycle EBV antigens that is associated with presentation and relapse of EBV associated Burkitt's lymphoma.

Biopsy↗