SEARCH · PubMed Health

Results for “selective vulnerability”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 757 records · Page 42Linked to original sources

PubMed1986

Alzheimer's disease, Parkinson's disease, and motoneurone disease: abiotrophic interaction between ageing and environment?

The hypothesis is that Alzheimer's disease, Parkinson's disease (PD), and motoneurone disease are due to environmental damage to specific regions of the central nervous system and that the damage remains subclinical for several decades but makes those affected especially prone to the consequences of age-related neuronal attrition. This proposal is based on the association between environmental factors and certain neurodegenerative diseases (eg, methylphenyltetra-hydropyridine and parkinsonism, poliovirus infection and post-poliomyelitis syndrome, chickling pea ingestion and lathyrism, an unidentified environmental factor and amyotrophic lateral sclerosis-PD complex of Guam, and trauma and pugilist's encephalopathy) and on the long latent period between exposure to environmental factor and the appearance of symptoms in some of these disorders. The practical implications of this hypothesis are that epidemiological attention should be focussed on the environment in early rather than late life, prevention may be a realistic goal if the cause of subclinical damage can be identified, a search should be undertaken for causal mechanisms linking subclinical neuronal damage due to an environmental factor and the normal ageing process, and (4) better understanding of the regional selective vulnerability of the nervous system to the ageing process might allow a rational approach to treatment.

1-Methyl-4-phenyl-1,2,3,6-tetrahydropyridine↗

PubMed1988

Does Sc1-70 modulate collagen production in systemic sclerosis?

Sc1-70, an autoantigen in systemic sclerosis, may accelerate collagen gene transcription by virtue of its activity as a topoisomerase I (topo I), a DNA template-modifying enzyme. A survey of sequences corresponding to all or part of the known topo I binding sequence AGAACTTAGAGAAAATTTAAA in four fibrillar collagen genes (three of them dermal) and sixteen non-collagen genes showed a striking preponderance of the tetramer 5'-CTTA-3', comprising the core of this binding sequence, at the exon-intron junctions of the fibrillar collagen genes (59% compared with 16% in the control group). In addition, a non-random clustering of three potential topo I binding sites was seen within 350 base-pairs of 5' flanking DNA in the dermal collagen gene alpha 2(I), and a fourth site occurred in the promoter region of the alpha 1(III) gene. The findings suggest that a selective vulnerability to the action of Sc1-70/topo I is built into the structure of the dermal collagen genes.

Amino Acid Sequence↗

PubMed2004

[Spinal cord ischemia].

Traditional data and recent advances in the field of spinal cord ischemia are reviewed, with special attention to clinical and radiological features, as well as underlying etiology, outcome, and pathophysiology. Acute spinal cord ischemia includes arterial and venous infarction and global ischemia resulting from cardiac arrest or severe hypotension. MRI has become the technique of choice for the imaging diagnosis of spinal cord infarction. Correlation of clinical and MRI data has allowed diagnosis of clinical syndromes due to small infarcts in the central or peripheral arterial territory of the spinal cord. Diffusion-weighted MR imaging may increase the sensitivity and specificity for diagnosis of acute spinal cord infarction. Diagnosis of venous spinal cord infarction remains difficult. As for global ischemia, neuropathological studies demonstrated a great sensitivity of spinal cord to ischemia, with selective vulnerability of lumbosacral neurons. Chronic spinal cord ischemia results in a syndrome of progressive myelopathy. The cause is usually an arteriovenous malformation. Most often, diagnosis may be suspected on MRI, leading to diagnostic, and eventually therapeutic, spinal angiography.

Arteries↗

PubMed1998

The role of neuronal growth factors in neurodegenerative disorders of the human brain.

Recent evidence suggests that neurotrophic factors that promote the survival or differentiation of developing neurons may also protect mature neurons from neuronal atrophy in the degenerating human brain. Furthermore, it has been proposed that the pathogenesis of human neurodegenerative disorders may be due to an alteration in neurotrophic factor and/or trk receptor levels. The use of neurotrophic factors as therapeutic agents is a novel approach aimed at restoring and maintaining neuronal function in the central nervous system (CNS). Research is currently being undertaken to determine potential mechanisms to deliver neurotrophic factors to selectively vulnerable regions of the CNS. However, while there is widespread interest in the use of neurotrophic factors to prevent and/or reduce the neuronal cell loss and atrophy observed in neurodegenerative disorders, little research has been performed examining the expression and functional role of these factors in the normal and diseased human brain. This review will discuss recent studies and examine the role members of the nerve growth factor family (NGF, BDNF and NT-3) and trk receptors as well as additional growth factors (GDNF, TGF-alpha and IGF-I) may play in neurodegenerative disorders of the human brain.

Brain↗

PubMed1999

Neuronal death and survival in two models of hypoxic-ischemic brain damage.

Two unilateral hypoxic-ischemia (HI) models (moderate and severe) in immature rat brain have been used to investigate the role of various transcription factors and related proteins in delayed neuronal death and survival. The moderate HI model results in an apoptotic-like neuronal death in selectively vulnerable regions of the brain while the more severe HI injury consistently produces widespread necrosis resulting in infarction, with some necrosis resistant cell populations showing evidence of an apoptotic type death. In susceptible regions undergoing an apoptotic-like death there was not only a prolonged induction of the immediate early genes, c-jun, c-fos and nur77, but also of possible target genes amyloid precursor protein (APP751) and CPP32. In contrast, increased levels of BDNF, phosphorylated CREB and PGHS-2 were found in cells resistant to the moderate HI insult suggesting that these proteins either alone or in combination may be of importance in the process of neuroprotection. An additional feature of both the moderate and severe brain insults was the rapid activation and/or proliferation of glial cells (microglia and astrocytes) in and around the site of damage. The glial response following HI was associated with an upregulation of both the CCAAT-enhancer binding protein alpha (microglia only) and NFkappaB transcription factors.

Animals↗

PubMed1997

Immunocytochemical method for investigating in vivo neuronal oxygen radical-induced lipid peroxidation.

The investigation of oxygen radical-induced lipid peroxidative neuronal damage in the context of acute and chronic neurodegenerative disorders has been largely limited to the use of ex vivo analytical methodologies. These are often fraught with sensitivity or specificity problems, or they are indirect. Furthermore, none of the analytical methods allow precise anatomical identification of the cells that are undergoing peroxidative injury. This paper describes an immunocytochemical method for localization of central nervous system (CNS) lipid peroxidation (LP) that employs a rabbit-derived antibody raised against malondialdehyde (MDA)-modified rabbit serum albumin (RSA). MDA is a breakdown product of peroxidized membrane polyunsaturated fatty acids that avidly binds to cellular proteins. Using the anti-MDA-RSA, we herein illustrate increased MDA-derived immunostaining: (1) in the spinal cord of transgenic familial amyotrophic lateral sclerosis (ALS) mice; and (2) in the selectively vulnerable gerbil hippocampal CA1 region after a 5 min episode of forebrain ischemia and its relationship to the time course of neuronal degeneration.

Amyotrophic Lateral Sclerosis↗

PubMed2003

Blunted metabolic response to SKF 82958 in the mesolimbic system following preweaning cocaine treatment.

This study examined glucose metabolic rates following dopamine D(1) agonist challenge in adult male rats pretreated with cocaine during postnatal days 11-20. Water-pretreated control rats showed a reliable decrease in glucose metabolism of rostral mesolimbic structures when challenged with SKF 82958 while cocaine-pretreated males did not. These data support the notion that cocaine exposure during the preweaning period dampens D(1) receptor-mediated function and that the mesolimbic system exhibits a selective vulnerability to early cocaine exposure.

Animals↗

PubMed1998

Age-dependent regulation of seizure activity by nitric oxide in the developing rat.

The role of nitric oxide (NO) on the age-dependent selective vulnerability to the consequences of epileptic seizures was studied in 10-day old (P10) and 21-day old (P21) rats. At P10, the NO synthase (NOS) inhibitor, NG-nitro-l-arginine (LNA), increased severity of seizures while l-arginine (l-Arg), the NOS substrate, had no effect. At P21, l-Arg improved the outcome of seizures while LNA had no effect. These results demonstrated the age-dependent role of NO in epilepsy.

Aging↗

PubMed1999

Dopamine transporters and neuronal injury.

The plasma membrane dopamine transporter (DAT) and the vesicular monoamine transporter (VMAT2) are essential for normal dopamine neurotransmission. DAT terminates the actions of dopamine by rapidly removing dopamine from the synapse, whereas VMAT2 loads cytoplasmic dopamine into vesicles for storage and subsequent release. Recent data suggest that perturbation of the tightly regulated balance between these two transporters predisposes the neurone to damage by a variety of insults. Most notable is the selective degeneration of DAT- and VMAT2-expressing dopamine nerve terminals in the striatum thought to underlie Parkinson's disease. DAT and VMAT2 expression can predict the selective vulnerability of neuronal populations, which suggests that therapeutic strategies aimed at altering DAT and VMAT2 function could have significant benefits in a variety of disorders.

Animals↗

PubMed2000

S100A6, a calcium- and zinc-binding protein, is overexpressed in SOD1 mutant mice, a model for amyotrophic lateral sclerosis.

Amyotrophic lateral sclerosis (ALS) is a neurodegenerative disease characterised by selective degeneration of motoneurones. Familial ALS is an age-dependent autosomal dominant disorder in which mutations in the homodimeric enzyme Cu/Zn superoxide dismutase 1 (SOD1) is linked to the disease. An animal model for this disease is a transgenic mouse expressing the mutated human SOD1(G93A) gene. Recent electrophysiological data emphasised that the striking selective vulnerability of motoneurones might be due to their differential calcium buffering capacities. Therefore we have investigated, using immunohistochemistry, the expression of different calcium binding proteins in brainstem and spinal cord from normal and SOD1 mutated mice. Among the 13 calcium-binding proteins screened, only one, S100A6, a homodimeric calcium-binding protein able to bind four Zn(2+), appeared to be highly expressed in the SOD1 mutated mice. In brainstem, reactive astrocytes, but not motoneurones, from several regions, including nerve 12 root, were highly S100A6-positive. Hypoglossal nucleus was negative for S100A6. In dorsal root, reactive astrocytes from both white matter and anterior horn were highly reactive. If overexpression of S100A6 is specific for ALS, it will be a valuable diagnostic marker for this disease.

Amyotrophic Lateral Sclerosis↗

PubMed1997

Acute 3-nitropropionic acid intoxication induces striatal astrocytic cell death and dysfunction of the blood-brain barrier: involvement of dopamine toxicity.

Mechanisms underlying the selective vulnerability of the lateral striatal area to the toxic effects of 3-nitropropionic acid (3-NPA) were investigated in rats. A single exposure to 3-NPA (20 mg/kg, s.c.) induced no deficits in behavior and histology, but subsequent injection produced motor symptoms, catalepsy, lip smacking, abnormal gait, paddling, rolling, opisthotonos, tremor, recombence, somnolence and so on, in 30% of the animals within a few hours. Diffusion-weighted magnetic resonance imaging of the brains revealed an area of high signal intensity in the bilateral striata. By this stage (within a few hours), striatal astrocytes had become swollen and disintegrated. Extravasation of immunoglobulin G was detected, indicating blood-brain barrier (BBB) dysfunction. Electron microscopy revealed edema and disorganization of structures inside the astrocytic end-feet around the branches of the lateral striatal artery. Neurons were less vulnerable than astrocytes to the 3-NPA injury. Treatment of the rats with D2 receptor agonist prior to exposure to 3-NPA attenuated the behavioral abnormalities and histological damage whereas pretreatment with D2 antagonist exacerbated these changes. The concentrations of extracellular dopamine (DA) and dihydroxyphenyl acetic acid (DOPAC) were both increased in rats exposed to 3-NPA. In vitro imaging of astrocytes revealed a progressive increase in [Ca2+]i after superfusion with 3-NPA, and the 'ceiling' level was maintained even after extensive washing. DA superfusion also increased the astrocytic [Ca2+]i and this increase was reversible. Data indicate that 3-NPA-induced striatal damage was associated with astrocytic cell death and dysfunction of the BBB. Intracellular edema and extreme Ca2+ overload induced by the toxin were further aggravated by an increase in the level of DA activity. These factors acting either singly or in combination may trigger astrocyte destruction.

Animals↗

PubMed1999

Enduring changes in Purkinje cell electrophysiology following transient exposure to AMPA: correlates to dark cell degeneration.

Purkinje cells (PCs) are selectively vulnerable to alpha-amino-3-hydroxy-5-methylisoxazole-4-propionic acid (AMPA)-mediated delayed toxicity that is manifested as dark cell degeneration (DCD) rather than necrosis. The purpose of the present study was to utilize electrophysiologic changes induced by AMPA to gain mechanistic insights into its cytotoxic actions. The whole-cell configuration of the patch clamp technique was used to record spontaneous electrical activity and ionic currents of Purkinje neurons from cerebellar slices using an experimental paradigm known to produce DCD in response to AMPA. Initial electrophysiologic responses to AMPA consisted of a large transient depolarization and inward current that declined by 75% 20 min into the 30-min exposure to 30 microM AMPA. Cellular responses temporarily continued towards basal levels following removal of AMPA. A sustained membrane depolarization (and underlying persistent inward current), an abundance of apparent excitatory synaptic events, and loss of electro- and chemoresponsiveness were observed 60-75 min into the expression phase (following AMPA removal). These events correspond temporally to the development of DCD in Purkinje cells and may represent an electrophysiological signature of AMPA receptor-mediated delayed neurotoxic events. Antagonists of the AMPA receptor present concomitantly with AMPA are known not to affect DCD and failed to alter the electrophysiologic changes. The secondary depolarization and loss of electroresponsiveness were prevented by antagonists present after removal of AMPA, at a time when DCD also is prevented. Electrical clamping of the PC membrane to equivalent depolarized membrane potentials (V(m)s) obtained with AMPA failed to elicit any long lasting alterations in PC physiology. Collectively, morphological and electrophysiological data indicate that induction of DCD is not strongly dependent on ionotropic mechanisms elicited by AMPA receptors, but that expression of DCD does possess an ionotropic element.

6-Cyano-7-nitroquinoxaline-2,3-dione↗

PubMed2000

Quantitation of BDNF mRNA in human parietal cortex by competitive reverse transcription-polymerase chain reaction: decreased levels in Alzheimer's disease.

Alzheimer's disease is a progressive neurodegenerative disorder of the central nervous system. One pathological characteristic is excessive neuronal loss in specific regions of the brain. Among the areas most severely affected are the basal forebrain cholinergic neurons and their projection regions, the hippocampus and cortex. Neurotrophic factors, particularly the neurotrophins nerve growth factor and brain-derived neurotrophic factor, play an important role in the development, regulation and survival of basal forebrain cholinergic neurons. Furthermore, brain-derived neurotrophic factor regulates the function of hippocampal and cortical neurons. Neurotrophins are synthesized in hippocampus and cortex and retrogradely transported to the basal forebrain. Decreased levels of neurotrophic factors are suspected to be involved in the neurodegenerative changes observed in Alzheimer's disease. We examined autopsied parietal cortex samples from age- and gender-matched Alzheimer's diseased and neurologically non-impaired individuals using the quantitative technique of competitive RT-PCR. We demonstrate a 3.4-fold decrease in brain-derived neurotrophic factor mRNA levels in the parietal cortex of patients with Alzheimer's disease compared to controls (p<0.004). A decrease in brain-derived neurotrophic factor synthesis could have detrimental effects on hippocampal, cortical and basal forebrain cholinergic neurons and may account for their selective vulnerability in Alzheimer's disease.

Actins↗

PubMed1996

The role of the cyclic AMP-responsive element binding protein (CREB) in hypoxic-ischemic brain damage and repair.

The cyclic AMP-responsive element binding protein (CREB) is a basally expressed, post-translationally activated transcription factor that has been implicated in the trans-activation of a number of genes in response to cAMP and calcium signals. A unilateral hypoxic-ischemic (HI) injury in the 21 day old rat was used to examine a potential role for CREB (phosphorylated and unphosphorylated) in neuronal programmed cell death or cell survival. The selectively vulnerable CAI pyramidal cells, which undergo delayed neuronal death following mild HI, show a loss of CREB and phosphorylated CREB (pCREB) immunoreactivity on the injured side 48 and 72 h following HI. In contrast the resistant dentate granule cells and cortical cells produce a bimodal increase in pCREB immunoreactivity, peaking 6 and 48 h following HI. The fact that cells surviving the HI insult are showing increased activation of CREB suggests that this protein might be involved in the process of neuroprotection.

Animals↗

PubMed1997

Loss of Ref-1 protein expression precedes DNA fragmentation in apoptotic neurons.

Ref-1 is a bifunctional protein that has been implicated in the transcriptional regulation of AP-1 elements and in DNA repair. To investigate whether Ref-1 is involved in programmed cell death its expression was measured in the 21-day-old rat brain at various time-points following a moderate unilateral hypoxic-ischemic (HI) insult. The CA1 pyramidal cells, which are selectively vulnerable to HI injury, showed a significant decrease in Ref-1 immunoreactivity 48 h-7 days post-insult. This loss of Ref-1 immunoreactivity may contribute to a decrease in endogenous repair activity and the development of apoptosis in the CA1 pyramidal cells.

Animals↗

PubMed1997

Activation of CPP-32 protease in hippocampal neurons following ischemia and epilepsy.

Recent in vitro studies indicate an involvement of members of the interleukin-1beta converting enzyme (ICE) family of proteases in programmed neuronal cell death. Cell death of hippocampal neurons in animal models of cerebral ischemia and epilepsy shows morphological features of apoptosis and can be prevented by administration of protein synthesis inhibitors suggesting that de novo synthesis of components of the cell death program is necessary for neuronal apoptosis. In the present study we demonstrate by in situ hybridization analysis that expression of CPP-32, an ICE-related protease, is significantly upregulated in CA1 hippocampal neurons following global ischemia induced by cardiac arrest and in hippocampal neurons of the CA3/CA4 region after kainate-mediated epilepsy, respectively. Moreover, an increase in CPP-32-like proteolytic activity was detected in hippocampal extracts 24 h after ischemia using the fluorogenic CPP-32 substrate Ac-DEVD-AMC. Activation of CPP-32 clearly preceded cell death of hippocampal neurons as assessed by in situ end-labelling of nuclear DNA fragments. These results indicate that CPP-32 protease may be activated at both the transcriptional and post-translational level during neuronal apoptosis and that activation correlates with the selective vulnerability of hippocampal pyramidal neurons to ischemic and epileptic insults.

Animals↗

PubMed1997

Prostaglandin H synthase-2 and cytosolic phospholipase A2 in the hypoxic-ischemic brain: role in neuronal death or survival?

The breakdown of membrane phospholipids and subsequent arachidonic acid metabolism to prostanoids is a well-documented brain response to cerebral ischemia. To further elucidate the components of this signal transduction pathway, immunocytochemistry was used to determine the levels of two potentially important enzymes, cytosolic phospholipase A2 (cPLA2) and prostaglandin H synthase-2 (PGHS-2), in the immature rat brain following moderate unilateral hypoxic-ischemia (HI). The CA1 pyramidal cells of the hippocampus which undergo delayed neuronal death on the injured side following HI demonstrated a significant induction of PGHS-2 immunoreactivity 48 h post-insult. However, a consistent increase in PGHS-2 was also evident in the resistant dentate granule cells at an earlier time point. Although PGHS-2 is present in both susceptible and resistant cell populations following HI, the possibility remains that divergence further down-stream in the pathway is responsible for selective vulnerability. In contrast to the neuronal PGHS-2 expression, cPLA2 immunoreactivity appears to be of glial origin with increases in and around the CAI-2 pyramidal cell layer at the 72-168-h time points. These results suggest that prostanoids are likely to serve important roles in HI brain damage and repair in infant brain.

Animals↗

PubMed1999

Expression of NMDA glutamate receptor subunit mRNAs in neurochemically identified projection and interneurons in the striatum of the rat.

NMDA receptors are composed of proteins from two families: NMDAR1 and NMDAR2. We used quantitative double-label in situ hybridization to examine in rat brain the expression of NMDAR1, NMDAR2A, NMDAR2B, and NMDAR2C mRNA in six neurochemically defined populations of striatal neurons: preproenkephalin (ENK) and preprotachykinin (SP) expressing projection neurons, and somatostatin (SOM), glutamic acid decarboxylase 67 (GAD67), parvalbumin (PARV), and choline acetyltransferase (ChAT) expressing interneurons. NMDAR1 was expressed by all striatal neurons: strongly in ENK, SP, PARV and ChAT neurons, and less intensely in SOM and GAD67 positive cells. NMDAR2A mRNA was present at moderate levels in all striatal neurons except those containing ChAT. Labeling for NMDAR2B was strong in projection neurons and ChAT interneurons, and only moderate in SOM, GAD67 and PARV interneurons. NMDAR2C was scarce in striatal neurons, but a low level signal was detected in GAD67 positive cells. NMDAR2C expression was also observed in small cells not labeled by any of the markers, most likely glia. These data suggest that all striatal neurons have NMDA receptors, but different populations have different subunit compositions which may affect function as well as selective vulnerability.

Animals↗