SEARCH · PubMed Health

Results for “Enhancer Elements, Genetic”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 775 records · Page 43Linked to original sources

PubMed1985

Mapping genetic elements of Epstein-Barr virus that facilitate extrachromosomal persistence of Epstein-Barr virus-derived plasmids in human cells.

The Epstein-Barr virus (EBV) genome becomes established as a multicopy plasmid in the nucleus of infected B lymphocytes. A cis-acting DNA sequence previously described within the BamHI-C fragment of the EBV genome (J. Yates, N. Warren, D. Reisman, and B. Sugden, Proc. Natl. Acad. Sci. USA 81:3806-3810, 1984) allows stable extrachromosomal plasmid maintenance in latently infected cells, but not in EBV-negative cells. In agreement with the findings of Yates et al., deletion analysis permitted the assignment of this function to a 2,208-base-pair region (nucleotides 7315 to 9517 of the B95-8 strain of EBV) of the BamHI-C fragment that contained a striking repetitive sequence and an extended region of dyad symmetry. A recombinant vector, p410+, was constructed which carried the BamHI-K fragment (nucleotides 107565 to 112625 of the B95-8 strain, encoding the EBV-associated nuclear antigen EBNA-1), the cis-acting sequence from the BamHI-C fragment, and a dominant selectable marker gene encoding G-418 resistance in animal cells. After being transfected into HeLa cells, this plasmid persisted extrachromosomally at a low copy number, with no detectable rearrangements or deletions. Two mutations in the BamHI-K-derived portion of p410+, a large in-frame deletion and a linker insertion frameshift mutation, both of which alter the carboxy-terminal portion of EBNA-1, destroyed the ability of the plasmid to persist extrachromosomally in HeLa cells. A small in-frame deletion and linker insertion mutation in the region encoding the carboxy-terminal portion of EBNA-1, which replaced 19 amino acid codons with 2, had no effect on the maintenance of p410+ in HeLa cells. These observations indicate that EBNA-1, in combination with a cis-acting sequence in the BamHI-C fragment, is in part responsible for extrachromosomal EBV-derived plasmid maintenance in HeLa cells. Two additional activities have been localized to the BamHI-C DNA fragment: (i) a DNA sequence that could functionally substitute for the simian virus 40 enhancer and promoter elements controlling the expression of G-418 resistance and (ii) a DNA sequence which, although not sufficient to allow extrachromosomal plasmid maintenance, enhanced the frequency of transformation to G-418 resistance in EBV-positive (but not EBV-negative) cells. These findings suggest that the BamHI-C fragment contains a lymphoid-specific or EBV-inducible promoter or enhancer element or both.

Antigens, Viral↗

PubMed2006

A temporal map of transcription factor activity: mef2 directly regulates target genes at all stages of muscle development.

Dissecting components of key transcriptional networks is essential for understanding complex developmental processes and phenotypes. Genetic studies have highlighted the role of members of the Mef2 family of transcription factors as essential regulators in myogenesis from flies to man. To understand how these transcription factors control diverse processes in muscle development, we have combined chromatin immunoprecipitation analysis with gene expression profiling to obtain a temporal map of Mef2 activity during Drosophila embryonic development. This global approach revealed three temporal patterns of Mef2 enhancer binding, providing a glimpse of dynamic enhancer use within the context of a developing embryo. Our results provide mechanistic insight into the regulation of Mef2's activity at the level of DNA binding and suggest cooperativity with the bHLH protein Twist. The number and diversity of new direct target genes indicates a much broader role for Mef2, at all stages of myogenesis, than previously anticipated.

Animals↗

PubMed1995

Hepatocarcinogenesis in transgenic mice.

Transgenic mouse models of altered hepatic gene expression have provided a new set of tools with which to study the molecular genesis of normal and pathological liver growth. Previously identified carcinogenic genomic changes (such as oncogene activation) can be tested for their transforming potency in liver, and the contribution to liver growth of genetic changes of unknown significance (such as expression of a growth factor) can be directly measured in vivo. Highly novel approaches also have become possible because of the liver's unique regenerative capacity following injury: introduction of cells from another mouse's liver into young AL-uPA mice has resulted in reconstitution of up to 80% of recipient liver by donor cells (Rhim et al., 1994). Use of immunotolerant mice and human donor cells in this approach should allow creation of mice carrying human livers. Finally, by combining transgenic and embryonic stem cell technologies, the latter allowing selective mutation or inactivation of desired genes, we now have the means to begin to answer many of the critical questions regarding mechanisms of liver growth regulation in the intact animal.

Albumins↗

PubMed2003

Analysis of the cloverleaf element in a human rhinovirus type 14/poliovirus chimera: correlation of subdomain D structure, ternary protein complex formation and virus replication.

RNA genomes of enteroviruses and rhinoviruses contain a 5'-terminal structure, the cloverleaf (CL), which serves as signal in RNA synthesis. Substitution of the poliovirus [PV1(M)] CL with that of human rhinovirus type 2 (HRV2) was shown previously to produce a viable chimeric PV, whereas substitution with the HRV14 CL produced a null phenotype. Fittingly, the HRV14 CL failed to form a complex with PV-specific proteins 3CD(pro)-3AB or 3CD(pro)-PCBP2, considered essential for RNA synthesis. It was reported previously (Rohll et al., J Virol 68, 4384-4391, 1994) that the major determinant for the null phenotype of a PV/HRV14 chimera resides in subdomain Id of the HRV14 CL. Using a chimeric PV/HRV14 CL in the context of the PV genome, stem-loop Id of HRV14 CL was genetically dissected. It contains the sequence C(57)UAU(60)-G, the underlined nucleotides forming the loop that is shorter by 1 nt when compared to the corresponding PV structure (UUGC(60)GG). Insertion of a G nucleotide to form a tetra loop (C(57)UAU(60)GG(61)) did not rescue replication of the chimera. However, an additional mutation at position 60 (C(57)UAC(60)GG(61)) yielded a replicating genome. Only the mutant PV/HRV14 CL with the UAC(60)G tetra loop formed ternary complexes efficiently with either PV proteins 3CD(pro)-3AB or 3CD(pro)-PCBP2. Thus, in the context of PV RNA synthesis, the presence of a tetra loop in subdomain D of the CL per se is not sufficient for function. The sequence and, consequently, the structure of the tetra loop plays an essential role. Biochemical assays demonstrated that the function of the CL element and the function of the cis-acting replication element in the 3D(pol)-3CD(pro)-dependent uridylylation of VPg are not linked.

Base Sequence↗

PubMed2002

Ectopic expression of the Drosophila Cdk1 inhibitory kinases, Wee1 and Myt1, interferes with the second mitotic wave and disrupts pattern formation during eye development.

Wee1 kinases catalyze inhibitory phosphorylation of the mitotic regulator Cdk1, preventing mitosis during S phase and delaying it in response to DNA damage or developmental signals during G2. Unlike yeast, metazoans have two distinct Wee1-like kinases, a nuclear protein (Wee1) and a cytoplasmic protein (Myt1). We have isolated the genes encoding Drosophila Wee1 and Myt1 and are using genetic approaches to dissect their functions during normal development. Overexpression of Dwee1 or Dmyt1 during eye development generates a rough adult eye phenotype. The phenotype can be modified by altering the gene dosage of known regulators of the G2/M transition, suggesting that we could use these transgenic strains in modifier screens to identify potential regulators of Wee1 and Myt1. To confirm this idea, we tested a collection of deletions for loci that can modify the eye overexpression phenotypes and identified several loci as dominant modifiers. Mutations affecting the Delta/Notch signaling pathway strongly enhance a GMR-Dmyt1 eye phenotype but do not affect a GMR-Dwee1 eye phenotype, suggesting that Myt1 is potentially a downstream target for Notch activity during eye development. We also observed interactions with p53, which suggest that Wee1 and Myt1 activity can block apoptosis.

Animals↗

PubMed2002

Notch activation of yan expression is antagonized by RTK/pointed signaling in the Drosophila eye.

Receptor tyrosine kinase (RTK) signaling plays an instructive role in cell fate decisions, whereas Notch signaling is often involved in restricting cellular competence for differentiation. Genetic interactions between these two evolutionarily conserved pathways have been extensively documented. The underlying molecular mechanisms, however, are not well understood. Here, we show that Yan, an Ets transcriptional repressor that blocks cellular potential for specification and differentiation, is a target of Notch signaling during Drosophila eye development. The Suppressor of Hairless (Su[H]) protein of the Notch pathway is required for activating yan expression, and Su(H) binds directly to an eye-specific yan enhancer in vitro. In contrast, yan expression is repressed by Pointed (Pnt), which is a key component of the RTK pathway. Pnt binds specifically to the yan enhancer and competes with Su(H) for DNA binding. This competition illustrates a potential mechanism for RTK and Notch signals to oppose each other. Thus, yan serves as a common target of Notch/Su(H) and RTK/Pointed signaling pathways during cell fate specification.

Animals↗

PubMed1994

Correction of accelerated autoimmune disease by early replacement of the mutated lpr gene with the normal Fas apoptosis gene in the T cells of transgenic MRL-lpr/lpr mice.

MRL-lpr/lpr mice develop a generalized autoimmune disease which includes increased autoantibody production, glomerulonephritis, and development of lymphadenopathy. The lpr genetic defect has been identified as a mutation in the Fas apoptosis gene that results in low expression of Fas mRNA. To determine the significance of the lpr mutation and T cells in the development of the autoimmune disease, we constructed transgenic MRL-lpr/lpr mice using a full-length murine Fas cDNA under the regulation of the T-cell-specific CD2 promoter and enhancer. Here we show that the early correction of the lpr gene defect in T cells eliminates glomerulonephritis and development of lymphadenopathy and decreases the levels of autoantibodies. In this model, early correction of the lpr defect in T cells is sufficient to eliminate the acceleration of autoimmune disease even in the presence of B cells and other cells that express the mutant lpr gene.

Animals↗

PubMed1996

Neuronal development in the Drosophila compound eye: photoreceptor cells R1, R6, and R7 fail to differentiate in the retina aberrant in pattern (rap) mutant.

The compound eye of Drosophila is a reiterated pattern of 800 unit eyes known as ommatidia. In each ommatidium there are eight photoreceptor neurons (R1-R8) and an invariant number of accessory cells organized in a precise manner. In the developing eye, specification of cell fates is triggered by sequential inductive events mediated by cell-cell interactions. The R8 photoreceptor neuron is the first cell to differentiate and is thought to play a central role in the recruitment of the remaining photoreceptor cells. Our previous work demonstrated that mutations in the retina aberrant in pattern (rap) locus lead to abnormal pattern formation in the compound eye. Genetic mosaic experiments demonstrated that for normal retinal patterning to occur, rap gene function is required only in the photoreceptor cell R8. In this study we analyzed the R cell composition of developing as well as the adult eyes of rap mutants employing a variety of R cell specific markers. We show that in rap mutants, although some of the R8-specific markers show normal expression patterns, other aspects of the R8 cell differentiation are abnormal. In addition, the cells R1, R6, and R7 fail to differentiate properly in rap mutants. These results suggest that the rap gene encodes an R8-specific function that plays a role in the determination of the photoreceptor cells R1, R6, and R7.

Animals↗

PubMed2004

Establishment of modified retroviral vector targeting X-linked severe combined immunodeficiency.

Gene therapy targeting hematopoietic stem cells has been proposed as a potential therapy for numerous genetic disorders affecting hematopoiesis. Moloney murine leukemia retroviral vectors are now widely used for clinical gene transfer into hematopoietic progenitors and progeny. However, maintaining expression of therapeutic genes inserted via moloney murine leukemia virus (MoMLV)-based vectors has proven to be more difficult than previously expected. In this study, an MND-IL-2R vector containing IL-2Rc gamma cDNA to treat X-linked severe combined immunodeficiency (X-SCID) was constructed from an MND vector that was modified by substituting the myeloproliferative sarcoma virus (MPSV) enhancer for that of MoMLV, deleting the negative control region located in the long terminal repeat (LTR) as an enhancer, and replacing the primer binding site (PBS) of MoMLV with the PBS of the endogenous murine retrovirus dl587rev. This vector was transduced into human CD34 + progenitor cells with comparable efficiency to that of the MoMLV-based vector. The use of this newly created vector may be advantageous for gene therapy of X-SCID.

Antigens, CD34↗

PubMed1991

The doublesex proteins of Drosophila melanogaster bind directly to a sex-specific yolk protein gene enhancer.

The doublesex (dsx) gene of Drosophila melanogaster encodes both male-specific and female-specific polypeptides, whose synthesis is regulated by alternative sex-specific splicing of the primary dsx transcript. The alternative splicing of the dsx mRNA is the last known step in a cascade of regulatory gene interactions that involves both transcriptional and post-transcriptional mechanisms. Genetic studies have shown that the products of the dsx locus are required for correct somatic sexual differentiation of both sexes, and have suggested that each dsx product functions by repressing expression of terminal differentiation genes specific to the opposite sex. However, these studies have not shown whether the dsx gene products function directly to regulate the expression of target genes, or indirectly through another regulatory gene. We report here that the male- and female-specific DSX proteins, expressed in E.coli, bind directly and specifically in vitro to three DNA sequences located in an enhancer region that regulates female-specific expression of two target genes, the yolk protein genes 1 and 2. This result suggests strongly that dsx is a final regulatory gene in the hierarchy of regulatory genes controlling somatic sexual differentiation.

Animals↗

PubMed1995

The cattle major histocompatibility complex (MHC) class-I possesses HLA-like promoters.

To study the genetic regulation of the cattle major histocompatibility complex (MHC) class-I, a cattle MHC class-I promoter DNA fragment was isolated and characterized for the first time. Semi-degenerate PCR was performed on cattle genomic DNA and the resulting product was isolated, subcloned and sequenced. Sequence comparison of the HLA-A, -B and -C promoters to the cloned product, designated BL3-6prmtr, revealed the cattle MHC class-I promoter to have close homology to human MHC class-I promoters. To address the ability of the cattle MHC class-I promoter to initiate transcription, BL3-6prmtr was subcloned into a luciferase reporter vector and transiently transfected into cattle and human B-lymphoblastoid cell lines. A strong transcription initiation ability of BL3-6prmtr was observed, including the ability of the enhancer A and interferon response sequence (IRS) to upregulate transcription initiation.

Animals↗

PubMed1990

Extinction of Ig genes expression in myeloma x fibroblast somatic cell hybrids is accompanied by repression of the oct-2 gene encoding a B-cell specific transcription factor.

In most instances, fusion of differentiated cell types with fibroblasts has resulted in the extinction of differentiation-specific traits of the nonfibroblast parental cell. To explore the genetic basis of this phenomenon, we have used a series of somatic cell hybrids between myeloma cells and fibroblasts. Previous findings show that in these hybrids expression of the immunoglobulin (Ig) genes was extinguished at the transcriptional level. Our present results show that NF-kappa B transcription factor, known to be critical for kappa-chain enhancer activity, is present although in a lower amount, in the nucleus and in the cytosolic fraction of most of these hybrids (probably attached to the previously postulated I-kappa B inhibitor). In contrast, the expression of the NF-A2/OTF-2 transcription factor encoded by the oct-2 gene, which binds to the octameric motif located in the Ig promoters and heavy chain gene enhancer, is extinguished at the transcriptional level. Our data thus suggest that extinction of Ig genes expression occurs via an indirect mechanism in which a fibroblast factor suppresses transcription factor(s) which are critical for Ig transcription.

Animals↗

PubMed1998

Modification of gene activity in mouse embryos in utero by a tamoxifen-inducible form of Cre recombinase.

The ability to generate specific genetic modifications in mice provides a powerful approach to assess gene function. When genetic modifications have been generated in the germ line, however, the resulting phenotype often only reflects the first time a gene has an influence on - or is necessary for - a particular biological process. Therefore, systems allowing conditional genetic modification have been developed (for a review, see [1]); for example, inducible forms of the Cre recombinase from P1 phage have been generated that can catalyse intramolecular recombination between target recognition sequences (loxP sites) in response to ligand [2] [3] [4] [5]. Here, we assessed whether a tamoxifen-inducible form of Cre recombinase (Cre-ERTM) could be used to modify gene activity in the mouse embryo in utero. Using the enhancer of the Wnt1 gene to restrict the expression of Cre-ERTM to the embryonic neural tube, we found that a single injection of tamoxifen into pregnant mice induced Cre-mediated recombination within the embryonic central nervous system, thereby activating expression of a reporter gene. Induction was ligand dependent, rapid and efficient. The results demonstrate that tamoxifen-inducible recombination can be used to effectively modify gene function in the mouse embryo.

Animals↗

PubMed1990

Frequent activation of N-myc genes by hepadnavirus insertion in woodchuck liver tumours.

The recent finding of c-myc activation by insertion of woodchuck hepatitis virus DNA in two independent hepatocellular carcinoma has given support to the hypothesis that integration of hepatitis B viruses into the host genome, observed in most human and woodchuck liver tumours, might contribute to oncogenesis. We report here high frequency of woodchuck hepatitis virus DNA integrations in two newly identified N-myc genes: N-myc1, the homologue of known mammalian N-myc genes, and N-myc2, an intronless 'complementary DNA gene' or 'retroposon' that has retained extensive coding and transforming homology with N-myc. N-myc2 is totally silent in normal liver, but is overexpressed without genetic rearrangements in most liver tumours. Moreover, viral integrations occur within either N-myc1 or N-myc2 in about 20% of the tumours, giving rise to chimaeric messenger RNAs in which the 3' untranslated region of N-myc was replaced by woodchuck hepatitis virus sequences encompassing the viral enhancer. Insertion sites were clustered in a short sequence of the third exon that coincides with a retroviral integration hotspot within the murine N-myc gene, recently described in T-cell lymphomas induced by murine leukaemia virus. Thus, comparable mechanisms, leading to deregulated expression of N-myc genes, may operate in the development of tumours induced either by hepatitis virus or by nonacute retroviruses in rodents. Activation of myc genes by insertion of hepadnavirus DNA now emerges as a common event in the genesis of woodchuck hepatocellular carcinoma.

Amino Acid Sequence↗

PubMed1999

Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Carcinoma, Non-Small-Cell Lung↗

PubMed2001

Depletion of a novel SET-domain protein enhances the sterility of mes-3 and mes-4 mutants of Caenorhabditis elegans.

Four maternal-effect sterile genes, mes-2, mes-3, mes-4, and mes-6, are essential for germline development in Caenorhabditis elegans. Homozygous mes progeny from heterozygous mothers are themselves fertile but produce sterile progeny with underproliferated and degenerated germlines. All four mes genes encode chromatin-associated proteins, two of which resemble known regulators of gene expression. To identify additional components in the MES pathway, we used RNA-mediated interference (RNAi) to test candidate genes for enhancement of the Mes mutant phenotype. Enhancement in this assay was induction of sterility a generation earlier, in the otherwise fertile homozygous progeny of heterozygous mothers, which previous results had suggested represent a sensitized genetic background. We tested seven genes predicted to encode regulators of chromatin organization for RNAi-induced enhancement of mes-3 sterility and identified one enhancer, called set-2 after the SET domain encoded by the gene. Depletion of SET-2 also enhances the sterile phenotype of mes-4 but not of mes-2 or mes-6. set-2 encodes two alternatively spliced transcripts, set-2(l) and set-2(s), both of which are enriched in the germline of adults. In the adult germline, SET-2(L) protein is localized in mitotic and mid-late-stage meiotic nuclei but is undetectable in early pachytene nuclei. SET-2(L) protein is localized in all nuclei of embryos. The localization of SET-2(L) does not depend on any of the four MES proteins, and none of the MES proteins depend on SET-2 for their normal localization. Our results suggest that SET-2 participates along with the MES proteins in promoting normal germline development.

Alleles↗

PubMed1999

Specific activation of a STAT family member in Xiphophorus melanoma cells.

Melanoma formation in the teleost fish Xiphophorus is caused by the uncontrolled activity of the genetically defined tumor locus Tu. The critical component of this locus is the Xmrk oncogene encoding a subclass I receptor tyrosine kinase. Overexpression and constitutive activation of the Xmrk receptor triggers a set of specific signal transduction events eventually resulting in the malignant phenotype. We have identified a melanoma-specific DNA-protein complex which seems to depend on Xmrk activation as shown in a heterologous cell system. The critical component of this complex, which directs transcriptional activation in the melanoma cells, proved to be a fish homologue of STAT5. Two other STAT factors, STAT1 and STAT3, implied in signaling by the Xmrk-related EGF receptor, were not activated in this particular cell type. Thus, Xmrk initiates very specific signaling pathways and transcriptional responses in Xiphophorus melanoma.

Animals↗

PubMed1998

Analysis of a Caenorhabditis elegans Twist homolog identifies conserved and divergent aspects of mesodermal patterning.

Mesodermal development is a multistep process in which cells become increasingly specialized to form specific tissue types. In Drosophila and mammals, proper segregation and patterning of the mesoderm involves the bHLH factor Twist. We investigated the activity of a Twist-related factor, CeTwist, during Caenorhabditis elegans mesoderm development. Embryonic mesoderm in C. elegans derives from a number of distinct founder cells that are specified during the early lineages; in contrast, a single blast cell (M) is responsible for all nongonadal mesoderm formation during postembryonic development. Using immunofluorescence and reporter fusions, we determined the activity pattern of the gene encoding CeTwist. No activity was observed during specification of mesodermal lineages in the early embryo; instead, the gene was active within the M lineage and in a number of mesodermal cells with nonstriated muscle fates. A role for CeTwist in postembryonic mesodermal cell fate specification was indicated by ectopic expression and genetic interference assays. These experiments showed that CeTwist was responsible for activating two target genes normally expressed in specific subsets of nonstriated muscles derived from the M lineage. In vitro and in vivo assays suggested that CeTwist cooperates with the C. elegans E/Daughterless homolog in directly activating these targets. The two target genes that we have studied, ceh-24 and egl-15, encode an NK-2 class homeodomain and an FGF receptor (FGFR) homolog, respectively. Twist activates FGFR and NK-homeodomain target genes during mesodermal patterning of Drosophila and similar target interactions have been proposed to modulate mesenchymal growth during closure of the vertebrate skull. These results suggest the possibility that a conserved pathway may be used for diverse functions in mesodermal specification.

Amino Acid Sequence↗