SEARCH · PubMed Health

Results for “Resolution”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 829 records · Page 46Linked to original sources

PubMed1987

X-ray holograms at improved resolution: a study of zymogen granules.

X-ray holography offers the possibility of three-dimensional microscopy with resolution higher than that of the light microscope and with contrast based on x-ray edges. In principle, the method is especially advantageous for biological samples if x-rays in the wavelength region between the carbon and oxygen K edges are used. However, until now the achieved resolution has not exceeded that of the light microscope because of the poor coherence properties of the x-ray sources and the low resolution of the detectors that were available. With a recently developed x-ray source based on an undulator on an electron storage ring, and high resolution x-ray resist, a hologram has been recorded at about 400-angstrom resolution. The experiment utilized x-rays with wavelengths of 24.7 angstroms and required a 1-hour exposure of the pancreatic zymogen granules under study.

Animals↗

PubMed1989

Nucleotide sequence required for resolution of the concatemer junction of vaccinia virus DNA.

The mature form of the vaccinia virus genome consists of a linear, 185,000-base-pair (bp) DNA molecule with a 10,000-bp inverted terminal repetition and incompletely base-paired 104-nucleotide hairpin loops connecting the two strands at each end. In concatemeric forms of intracellular vaccinia virus DNA, the inverted terminal repetitions of adjacent genomes form an imperfect palindrome. The apex of this palindrome corresponds in sequence to the double-stranded form of the hairpin loop. Circular plasmids containing palindromic concatemer junction fragments of 250 bp or longer are converted into linear minichromosomes with hairpin ends when they are transfected into vaccinia virus-infected cells, providing a model system with which to study the resolution process. To distinguish between sequence-specific and structural requirements for resolution, plasmids with symmetrical insertions, deletions, and oligonucleotide-directed mutations within the concatemer junction were constructed. A sequence (ATTTAGTGTCTAGAAAAAAA) located on both sides of the apex segment was found to be critical for resolution. Resolution was more efficient when additional nucleotides, TGTG, followed the run of A residues. Both the location and sequence of the proposed resolution signal are highly conserved among poxviruses.

Base Sequence↗

PubMed1991

The target DNA sequence for resolution of poxvirus replicative intermediates is an active late promoter.

The linear double-stranded genomes of poxviruses such as Shope fibroma virus (SFV) replicate autonomously within the cytoplasm of infected cells, and it is believed that all of the replication functions are virally encoded. During DNA replication the incompletely base-paired terminal hairpin loops of the viral genome transiently exist in the form of inverted repeat replicative intermediates. These inverted repeat structures form the target for telomere resolution events that include sequence-specific cleavage and directed strand exchange to form the hairpin termini of progeny virus genomes. The terminal sequence domain which forms the telomere resolution target (TRT) shares considerable sequence similarity with viral late promoters. In this study we demonstrate that the TRT of SFV is capable of functioning as a strong viral promoter late in infection. A spectrum of TRT mutations affects telomere resolution and late transcription in a strictly concordant fashion, suggesting that the two activities may be inextricably linked. Further support for this concept comes from the demonstration that a late SFV promoter sequence designated cryptic TRT, which differs substantially from the native TRT in terms of sequence, can support telomere resolution when placed in the correct spatial context. The proposed model for telomere resolution invokes directed unwinding of the TRT double helix by a transcription initiation complex and processing of the resulting secondary structure by viral late-gene products.

Animals↗

PubMed1997

Evidence that resolution of rotavirus infection in mice is due to both CD4 and CD8 cell-dependent activities.

The effector functions responsible for resolution of shedding in mice orally inoculated with the murine rotavirus strain EDIM were identified in B-cell-deficient and normal BALB/c mice after monoclonal antibody (MAb) depletion of CD4 and CD8 cells. When depleted of CD8 cells, B-cell-deficient muMt mice resolved their infections more slowly than nondepleted animals, but CD4 cell depletion caused chronic, high-level shedding. This finding indicated that CD4 cell-dependent immunological effectors other than, or in addition to, CD8 cells played roles in rotavirus resolution in muMt mice in the absence of antibody. The roles of CD4 and CD8 cells in resolution of rotavirus shedding were further characterized in immunologically normal BALB/c mice. Depletion of CD4 cells before EDIM inoculation resulted in rapid resolution of most shedding, but chronic, low-level shedding continued for weeks. When the CD4 cell-depleted BALB/c mice were subsequently depleted of CD8 cells, shedding levels increased significantly (P < 0.001), indicating that CD8 cells were responsible for the rapid but incomplete suppression of rotavirus shedding. Further experimentation revealed that little rotavirus antibody was made in CD4 cell-depleted BALB/c mice, and only after CD4 cells were repopulated did antibody production increase and virus shedding fully resolve. Thus, resolution of rotavirus shedding in both muMt and BALB/c mice was associated with CD4 and CD8 cell effector activities.

Animals↗

PubMed2003

Resolution of parvovirus dimer junctions proceeds through a novel heterocruciform intermediate.

The minute virus of mice initiator protein, NS1, excises new copies of the left viral telomere in a single sequence orientation, dubbed flip, during resolution of the junction between monomer genomes in palindromic dimer intermediate duplexes. We examined this reaction in vitro using both (32)P-end-labeled linear substrates and similar unlabeled templates labeled by incorporation of [alpha-(32)P]TTP during the synthesis. The observed products suggest a resolution model that explains conservation of the hairpin sequence and in which a novel heterocruciform intermediate plays a crucial role. In vitro, NS1 initiates two replication pathways from OriL(TC), the single active origin embedded in one arm of the dimer junction. NS1-mediated nicking liberates a base-paired 3' nucleotide to prime DNA synthesis and, in a reaction we call "read-through synthesis," forks established while the substrate is a linear duplex synthesize DNA in the flop orientation, leading to DNA amplification but not to junction resolution. Nicking leaves NS1 covalently attached to the 5' end of the DNA, where it can serve as a 3'-to-5' helicase, unwinding the NS1-associated strand. In the second pathway, resolution substrates are created when such unwinding induces the palindrome to reconfigure into a cruciform prior to fork assembly. New forks can then synthesize DNA in the flip orientation, copying one cruciform arm and creating a heterocruciform intermediate. Resolution proceeds via hairpin transfer in the extended arm of the heterocruciform, which releases one covalently closed duplex telomere and a partially single-stranded junction intermediate. We suggest that the latter intermediate is finally resolved via an NS1-induced single-strand nick at the otherwise inactive origin, OriL(GAA).

Animals↗

PubMed1995

Comparison of high resolution cytogenetics, fluorescence in situ hybridisation, and DNA studies to validate the diagnosis of Prader-Willi and Angelman's syndromes.

Eighty seven referrals with Prader-Willi syndrome and 49 with Angelman's syndrome were studied. High resolution cytogenetics was performed on all probands. Molecular studies, performed on the proband and both parents in each case, utilised multiple probes from within and distal to the 15(q11-13) region in order to establish the presence of DNA deletion or uniparental disomy. In addition, FISH, with probes at D15S11 and GABR beta 3 from the Prader-Willi syndrome/Angelman's syndrome region, was performed on a subset of 25 of these patients. In the referral group with Prader-Willi syndrome, 62 patients had a normal karyotype and 25 were deleted on high resolution cytogenetics. Twenty nine were found to be deleted with DNA techniques. In the Angelman's syndrome group, 37 had a normal karyotype and 12 were deleted on high resolution cytogenetics while 26 were deleted on molecular studies. The diagnosis was reassessed in 35 referrals with Prader-Willi syndrome and 11 with Angelman's syndrome following a non-deleted, non-disomic result. Of individuals who were neither deleted nor disomic on DNA studies, a false positive rate of 11.4% (4/35) for Prader-Willi syndrome and 16.7% (2/12) for Angelman's syndrome was found for a cytogenetically detected deletion. The false negative rate for deletion detected on high resolution cytogenetics was 19.5% (12/62) for Prader-Willi syndrome and 35% (13/37) for Angelman's syndrome. Thus high resolution cytogenetics was shown to be unreliable for deletion detection and should not be used alone to diagnose either syndrome. There were no discrepancies with FISH in 25 cases when FISH was compared with the DNA results, indicating that FISH can be used reliably for deletion detection in both syndromes.

Adolescent↗

PubMed1999

High resolution in vivo intra-arterial imaging with optical coherence tomography.

BACKGROUND: Optical coherence tomography (OCT) is a new method of catheter based micron scale imaging. OCT is analogous to ultrasound, measuring the intensity of backreflected infrared light rather than sound waves. OBJECTIVE: To demonstrate the ability of OCT to perform high resolution imaging of arterial tissue in vivo. METHODS: OCT imaging of the abdominal aorta of New Zealand white rabbits was performed using a 2.9 F OCT imaging catheter. Using an ultrashort pulse laser as a light source for imaging, an axial resolution of 10 micrometer was achieved. RESULTS: Imaging was performed at 4 frames/second and data were saved in either super VHS or digital format. Saline injections were required during imaging because of the signal attenuation caused by blood. Microstructure was sharply defined within the arterial wall and correlated with histology. Some motion artefacts were noted at 4 frames/second. CONCLUSIONS: In vivo imaging of the rabbit aorta was demonstrated at a source resolution of 10 micrometer, but required the displacement of blood with saline. The high resolution of OCT allows imaging to be performed near the resolution of histopathology, offering the potential to have an impact both on the identification of high risk plaques and the guidance of interventional procedures.

Animals↗

PubMedDate not supplied

A milestone in ribosomal crystallography: the construction of preliminary electron density maps at intermediate resolution.

Preliminary electron density maps of the large and the small ribosomal particles from halophilic and thermophilic sources, phased by the isomorphous replacement method, have been constructed at intermediate resolution. These maps contain features comparable in size with what is expected for the corresponding particles, and their packing arrangements are in accord with the schemes obtained by ab-initio procedures as well as with the motifs observed in thin sections of the crystals by electron microscopy. To phase higher resolution data, procedures are being developed for derivatization by specific labeling of the ribosomal particles at selected locations with rather small and dense clusters. Potential binding sites are being inserted either by site directed mutagenesis or by chemical modifications to facilitate cluster binding on the surface of the halophilic large and the thermophilic small ribosomal particles, which yield the crystals diffracting to highest resolution (2.9 and 7.3 A (1 A = 0.1 nm), respectively). For this purpose, the surface of these ribosomal particles is being characterized and procedures are being developed for quantitative detachment of selected ribosomal proteins and for their incorporation into core particles. The genes of these proteins are being cloned, sequenced, mutated to introduce reactive side groups, mainly cysteines, and overexpressed. In parallel, two in situ small and stable complexes were isolated from the halophilic ribosome. Procedures for their crystal production in large quantities are currently being developed. Models, reconstructed at low resolution from crystalline arrays of ribosomes and their large subunits, are being used for initial low-resolution phasing of the X-ray amplitudes. The interpretation of these models stimulated the design and the crystallization of complexes mimicking defined functional states of a higher quality than those obtained for isolated ribosomes. These models also inspired modelling experiments according to results of functional studies, performed elsewhere, focusing on the progression of nascent proteins.

Base Sequence↗

PubMedDate not supplied

Motion artifacts in subsecond conventional CT and electron-beam CT: pictorial demonstration of temporal resolution.

To visually demonstrate the effective temporal resolution of subsecond conventional (slip-ring) and electron-beam computed tomographic (CT) systems, two phantoms containing high-contrast test objects were scanned with a slip-ring CT system (effective exposure time, 0.5 second) and an electron-beam CT system (exposure time, 0.1 second). Images were acquired of each phantom at rest, during translation along the x axis at speeds of 10-100 mm/sec, and during rotation about isocenter at speeds of 0.1 and 0.5 revolution per second. Motion artifacts and loss of spatial resolution were judged to be absent, noticeable, or severe. For 0.5-second conventional CT images, motion artifacts and loss of spatial resolution were noticeable at 10 mm/sec and 0.1 revolution per second and were severe at speeds greater than or equal to 20 mm/sec and at 0.5 revolution per second. For 0.1-second electron-beam CT scans, noticeable, but not severe, motion artifacts and loss of spatial resolution occurred at speeds between 40 and 100 mm/sec and at 0.5 revolution per second. Over the range of physiologic speeds examined, the images provide visually compelling evidence of the effect of improving temporal resolution in CT.

Artifacts↗

PubMed2002

MR Imaging of the heart with cine true fast imaging with steady-state precession: influence of spatial and temporal resolutions on left ventricular functional parameters.

The influence of changes in spatial and temporal resolutions on functional parameters in the left ventricle (LV) were investigated with magnetic resonance (MR) imaging with a modified true fast imaging with steady-state precession, or FISP, two-dimensional sequence that provided temporal resolution of 21-90 msec and spatial resolution of 1-3 mm. MR imaging in the heart was performed in 15 healthy volunteers. A decrease in LV functional parameters was observed with reduced spatial and temporal resolutions. The influence of temporal resolution was more relevant.

Adult↗

PubMed2004

Periampullary tumors: high-spatial-resolution MR imaging and histopathologic findings in ampullary region specimens.

PURPOSE: To prospectively determine the magnetic resonance (MR) signal intensity characteristics of structures of the ampullary region and to assess the potential use of MR imaging in evaluation of the extent of periampullary tumors in resected specimens. MATERIALS AND METHODS: Twenty-five specimens from the ampullary region obtained in four autopsy cases without periampullary tumors and in 21 patients with periampullary tumors were examined with a 1.5-T MR system and a circular surface coil with 5-inch (12.7-cm) diameter. High-spatial-resolution MR images were obtained with field of view of 100 x 100 mm, matrix of 256 x 256 or 512 x 256, and section thickness of 2 mm. MR imaging findings were compared with histopathologic findings. Sensitivity, specificity, accuracy, positive predictive value, and negative predictive value of high-spatial-resolution MR imaging for assessment of tumor invasion into surrounding tissues were evaluated by two radiologists. RESULTS: T1- and T2-weighted MR images clearly depicted normal structures in the ampullary region that included Oddi muscle, duodenal wall, common bile duct, and pancreas; these findings corresponded well with histologic findings. In 20 (95%) of 21 tumors, high-spatial-resolution MR imaging depicted location and extension of periampullary tumors precisely. Sensitivity, specificity, accuracy, positive predictive value, and negative predictive value of high-spatial-resolution MR imaging for assessment of tumor invasion into surrounding tissue were 88%, 100%, 96%, 100%, and 94%, respectively. CONCLUSION: In this study, MR imaging correctly depicted location, extension, and origin of tumor. High-spatial-resolution MR imaging has potential for presurgical staging of tumors in this region.

Aged↗

PubMed1989

Costal pleura: appearances at high-resolution CT.

The appearance of the costal pleura at high-resolution computed tomography (CT) was evaluated with a cadaver and 25 normal subjects. This was contrasted with the high-resolution CT appearance of the costal pleura in 15 patients with mild pleural thickening, 13 of whom had been exposed to asbestos. On high-resolution CT scans in the normal subjects, a 1-2-mm-thick line of soft-tissue attenuation at the point of contact between lung and chest wall represents the visceral and parietal pleura, pleural contents, endothoracic fascia, and innermost intercostal muscle. In a paravertebral location, the innermost intercostal muscle is lacking, and a thin line seen on high-resolution CT scans reflects pleura and endothoracic fascia. Transverse thoracic and subcostal muscles and extrapleural fat pads can be seen as tissue internal to a rib and may be confused with pleural thickening. In 13 of the 15 patients with mild pleural thickening, the 1-3-mm-thick pleura was separable from the underlying normal intercostal muscle by a layer of extrapleural fat. High-resolution CT was more sensitive than CT with 1-cm collimation in depicting this degree of pleural abnormality.

Aged↗

PubMed1993

Evaluation of resolution and sensitometric characteristics of an asymmetric screen-film imaging system.

The authors compared asymmetric and conventional screen-film systems for chest radiography. The new imaging system, with asymmetric construction of the screens and film, has image quality characteristics substantially different from those of available screen-film combinations. This asymmetric screen-film system consists of a thin (high-resolution) front screen and a high-contrast emulsion, a thick (lower-resolution) back screen and a low-contrast emulsion, and technology that reduces the crossover exposure and prevents light from the front screen from exposing the back emulsion and vice versa. With this system, density, contrast, and resolution can be increased in selected regions while maintaining density and contrast in the rest of the image. Also, the resolution of this system varies as a function of density. Preliminary image quality and sensitometric studies indicate the new system is superior for chest radiography because it provides better visualization of mediastinal, retrocardiac, and diaphragmatic regions while yielding better contrast and resolution in lung parenchyma.

Humans↗

PubMed2001

High-spatial-resolution contrast-enhanced MR angiography of the renal arteries: a prospective comparison with digital subtraction angiography.

PURPOSE: To evaluate a high-spatial-resolution three-dimensional (3D) contrast material-enhanced magnetic resonance (MR) angiographic technique for detecting proximal and distal renal arterial stenosis. MATERIALS AND METHODS: Twenty-five patients underwent high-spatial-resolution small-field-of-view (FOV) 3D contrast-enhanced MR angiography of the renal arteries, which was followed several minutes later by more standard, large-FOV 3D contrast-enhanced MR angiography that included the distal aorta and iliac arteries. For both acquisitions, MR fluoroscopic triggering and an elliptic centric view order were used. Two readers evaluated the MR angiograms for grade and hemodynamic significance of renal arterial stenosis, diagnostic quality, and presence of artifacts. MR imaging results for each patient were compared with those of digital subtraction angiograms. RESULTS: The high-spatial-resolution small-FOV technique provided high sensitivity (97%) and specificity (92%) for the detection of renal arterial stenosis, including all four distal stenoses encountered. The portrayal of the segmental renal arteries was adequate for diagnosis in 19 (76%) of 25 patients. In 12% of the patients, impaired depiction of the segmental arteries was linked to motion. CONCLUSION: The combined high-spatial-resolution small-FOV and large-FOV MR angiographic examination provides improved spatial resolution in the region of the renal arteries while maintaining coverage of the abdominal aorta and iliac arteries.

Aged↗

PubMed1993

Imaging of reconstituted biological channels at molecular resolution by atomic force microscopy.

Using atomic force microscopy (AFM), we obtained high-resolution surface images of the bacterial outer membrane channels Escherichia coli OmpF porin and Bordetella pertussis porin that were reconstituted in artificial bilayer membranes as two-dimensional crystalline arrays. These porins were chosen because they are among the most extensively studied proteins of this type and are known for their well-defined crystalline nature in the native membrane. Such reconstituted membrane proteins are ideal specimens to assess the suitability and resolution of AFM for imaging biomembranes and associated proteins. Although OmpF porin often showed a mixed pattern of rectangular and hexagonal arrays with approximately 8.4 x 9.8- and approximately 7.2-nm-spacings, respectively, B. pertussis porin showed mostly a rectangular pattern with an approximately 7.9 x 13.8-nm spacing. The packing patterns of the E. coli OmpF porin in the membrane are very close to those found in electron-microscopic studies. When B. pertussis porin was imaged in a buffer solution, its trimeric subunits were apparently resolved, and the surface of each monomer revealed beadlike structures. This is the first report of such a high-resolution structural analysis of B. pertussis porin by any imaging method. We also imaged the lipid bilayer itself as an internal control for imaging and to further ascertain the resolution. Individual polar head groups of bilayer lipid molecules were resolved, suggesting the intrinsic resolution of AFM for bioimaging.

Bordetella pertussis↗

PubMed2005

Sleeve sensor versus high-resolution manometry for the detection of transient lower esophageal sphincter relaxations.

Transient lower esophageal sphincter relaxations (TLESRs) are the most important mechanism by which gastroesophageal reflux occurs, and sleeve sensor manometry is the gold standard for detection of TLESRs. The aim of this study was to evaluate manometry with closely spaced sideholes (high-resolution manometry) for the detection of TLESRs as an alternative. In 12 patients with gastroesophageal reflux disease, a 90-min postprandial manometry was performed by using a catheter incorporating both a sleeve sensor and closely spaced sideholes in the esophagogastric junction. TLESRs recorded with both techniques were scored. Reflux during TLESRs was detected by using manometry (common cavity), intraluminal impedance, and pH monitoring. A total of 145 TLESRs were detected by using both techniques, 117 with high-resolution manometry and 108 with sleeve sensor manometry [not significant (NS)]. Manometric signs of reflux during TLESRs detected with high-resolution and sleeve sensor manometry were found in 62.4 and 56.5%, NS, respectively, versus 38.5 and 35.2%, NS on pH-metry and 70.1 and 60.2%, NS on impedance monitoring. TLESRs recognized only with high-resolution manometry were more often accompanied by reflux, as detected with manometry (59.5%) and impedance monitoring (67.6%), than TLESRs recognized only with sleeve sensor manometry (32.1 and 28.6%). High-resolution manometry is at least as accurate as sleeve sensor manometry for the detection of TLESRs.

Adolescent↗

PubMed2006

Spectral resolution of monkey primary auditory cortex (A1) revealed with two-noise masking.

An important function of the auditory nervous system is to analyze the frequency content of environmental sounds. The neural structures involved in determining psychophysical frequency resolution remain unclear. Using a two-noise masking paradigm, the present study investigates the spectral resolution of neural populations in primary auditory cortex (A1) of awake macaques and the degree to which it matches psychophysical frequency resolution. Neural ensemble responses (auditory evoked potentials, multiunit activity, and current source density) evoked by a pulsed 60-dB SPL pure-tone signal fixed at the best frequency (BF) of the recorded neural populations were examined as a function of the frequency separation (DeltaF) between the tone and two symmetrically flanking continuous 80-dB SPL, 50-Hz-wide bands of noise. DeltaFs ranged from 0 to 50% of the BF, encompassing the range typically examined in psychoacoustic experiments. Responses to the signal were minimal for DeltaF = 0% and progressively increased with DeltaF, reaching a maximum at DeltaF = 50%. Rounded exponential functions, used to model auditory filter shapes in psychoacoustic studies of frequency resolution, provided excellent fits to neural masking functions. Goodness-of-fit was greatest for response components in lamina 4 and lower lamina 3 and least for components recorded in more superficial cortical laminae. Physiological equivalent rectangular bandwidths (ERBs) increased with BF, measuring nearly 15% of the BF. These findings parallel results of psychoacoustic studies in both monkeys and humans, and thus indicate that a representation of perceptual frequency resolution is available at the level of A1.

Acoustic Stimulation↗

PubMed1999

Temporal properties of chronic cochlear electrical stimulation determine temporal resolution of neurons in cat inferior colliculus.

As cochlear implants have become increasingly successful in the rehabilitation of adults with profound hearing impairment, the number of pediatric implant subjects has increased. We have developed an animal model of congenital deafness and investigated the effect of electrical stimulus frequency on the temporal resolution of central neurons in the developing auditory system of deaf cats. Maximum following frequencies (Fmax) and response latencies of isolated single neurons to intracochlear electrical pulse trains (charge balanced, constant current biphasic pulses) were recorded in the contralateral inferior colliculus (IC) of two groups of neonatally deafened, barbiturate-anesthetized cats: animals chronically stimulated with low-frequency signals (< or = 80 Hz) and animals receiving chronic high-frequency stimulation (> or = 300 pps). The results were compared with data from unstimulated, acutely deafened and implanted adult cats with previously normal hearing (controls). Characteristic differences were seen between the temporal response properties of neurons in the external nucleus (ICX; approximately 16% of the recordings) and neurons in the central nucleus (ICC; approximately 81% of all recordings) of the IC: 1) in all three experimental groups, neurons in the ICX had significantly lower Fmax and longer response latencies than those in the ICC. 2) Chronic electrical stimulation in neonatally deafened cats altered the temporal resolution of neurons exclusively in the ICC but not in the ICX. The magnitude of this effect was dependent on the frequency of the chronic stimulation. Specifically, low-frequency signals (30 pps, 80 pps) maintained the temporal resolution of ICC neurons, whereas higher-frequency stimuli significantly improved temporal resolution of ICC neurons (i.e., higher Fmax and shorter response latencies) compared with neurons in control cats. Furthermore, Fmax and latencies to electrical stimuli were not correlated with the tonotopic gradient of the ICC, and changes in temporal resolution following chronic electrical stimulation occurred uniformly throughout the entire ICC. In all three experimental groups, increasing Fmax was correlated with shorter response latencies. The results indicate that the temporal features of the chronically applied electrical signals critically influence temporal processing of neurons in the cochleotopically organized ICC. We suggest that such plastic changes in temporal processing of central auditory neurons may contribute to the intersubject variability and gradual improvements in speech recognition performance observed in clinical studies of deaf children using cochlear implants.

Acoustic Stimulation↗