PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “pathogen detection”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 865 records · Page 48Linked to original sources
PubMed2005

Detection and identification of intestinal pathogenic bacteria by hybridization to oligonucleotide microarrays.

AIM: To detect the common intestinal pathogenic bacteria quickly and accurately. METHODS: A rapid (<3 h) experimental procedure was set up based upon the gene chip technology. Target genes were amplified and hybridized by oligonucleotide microarrays. RESULTS: One hundred and seventy strains of bacteria in pure culture belonging to 11 genera were successfully discriminated under comparatively same conditions, and a series of specific hybridization maps corresponding to each kind of bacteria were obtained. When this method was applied to 26 divided cultures, 25 (96.2%) were identified. CONCLUSION: Salmonella sp., Escherichia coli, Shigella sp., Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, Proteus sp., Bacillus cereus, Vibrio cholerae, Enterococcus faecalis, Yersinia enterocolitica, and Campylobacter jejuni can be detected and identified by our microarrays. The accuracy, range, and discrimination power of this assay can be continually improved by adding further oligonucleotides to the arrays without any significant increase of complexity or cost.

Bacteria↗
PubMed2002

Increased stool sampling during a waterborne outbreak of cryptosporidiosis does not increase the detection of other faecal pathogens.

AIMS: To ascertain the effect of enhanced surveillance following an outbreak of waterborne cryptosporidiosis on the number of faecal specimens submitted to the local microbiology laboratory and the number positive for common enteric pathogens. The outbreak provided an opportunity to estimate the extent of routine under ascertainment of common enteric pathogens. METHOD: Retrospective search of the computerised microbiology system database for details of faecal examination requests for the period 26 April to 6 June in 1998 and 1999 (period of outbreak). RESULTS: Specimens were received from 378 community patients during the six week period 26 April to 6 June 1999. This was double that for the same period in 1998 (a non-outbreak year). Oocysts of Cryptosporidium parvum were detected in 59 patients, an eightfold increase compared with the same period in 1998. Despite the greater number of patients tested, the detection of other pathogens in patients with gastroenteritis was not altered when compared with the same period in the previous year. CONCLUSION: This study found no evidence of under ascertainment of gastrointestinal infection (common bacterial pathogens and rotavirus) by local general practitioners.

Adolescent↗
PubMed2004

A study on detecting and identifying enteric pathogens with PCR.

OBJECTIVE: To develop a rapid and definite diagnostic test of bacterial enteritis caused by pathogenic enterobacteria, the most frequent etiologic agent of infectious enteritis in the world. METHODS: A set of conventional PCR assays were applied to detect and identify salmonella, shigella, and E. coli O157:H7 directly from pure culture and fecal samples. The general primers of pathogenic enterobacteria were located on the uidA gene, which were found not only in E. coli nuclear acid, but also in shigella and salmonella genes. Shigella primer was from ipaH gene whose coded invasive plasmid relative antigen existed both in plasmid and in genome. The primers of salmonella were designed from the 16SrRNA sequence. The primer of E. coli O157:H7 was taken from eaeA gene. Five random primers were selected for RAPD. The detection system included common PCR, semi-nested PCR and RAPD. RESULTS: This method was more sensitive, specific and efficient and its processing was rapid and simple. For example, the method could be used to specifically detect and identify salmonella, shigella, and E. coli O157:H7, and its sensitivity ranged from 3 to 50 CFU, and its detection time was 4 hours. CONCLUSION: This PCR method, therefore, can serve as a routine and practical protocol for detecting and identifying pathogenic microorganisms from clinical samples.

DNA Primers↗
PubMedDate not supplied

[Food-borne human pathogenic viruses and their molecular detection with special consideration of noroviruses and hepatitis A virus in mussels].

Viruses are increasingly important as etiological agents of gastrointestinal infections. Because of improved diagnostic methods, in particular, because of molecular biological techniques, viruses can be detected much more frequently as pathogens of foodborne diseases. Apart from the hepatitis A virus (HAV) the Norovirus (NLV) is becoming more significant. On an international level methods are developed to detect the amount of viruses which minimise PCR inhibitors and which are applicable in routine diagnostic. There are numerous routines available in the field of virus diagnostic in shellfish and oysters which are, however, not yet standardised and applicable in the whole of Europe. This review highlights viral agents their characteristics as well as food contaminated with viruses. While most of the detection methods are cited from the literature, own preliminary results of virus detection in mussels are discussed in addition.

Animals↗
PubMed2003

Development of a 5' nuclease-based real-time PCR assay for quantitative detection of cariogenic dental pathogens Streptococcus mutans and Streptococcus sobrinus.

A 5' nuclease TaqMan PCR assay was developed for the quantitative detection of the major cariogenic bacteria Streptococcus mutans and Streptococcus sobrinus. The absolute and relative numbers of bacteria were measured by this method. This assay will be useful for quantifying these organisms in oral specimens and for analyzing biofilm formation.

Biofilms↗
PubMed1994

Detection of microcin production by pathogenic Escherichia coli isolates from children with acute diarrhoea.

Production of low molecular weight antibiotic substances was detected among pathogenic Escherichia coli isolates from diarrhoeal children's feces during evaluation of a rotavirus vaccine in Caracas city. One of these products, microcin V627a, was partially purified and characterized. Microcin synthesis and immunity system appears not to be plasmid determined and the antibiotic was produced to a high level in minimal medium during the stationary phase. This microcin has many features in common with the mccA15 family.

Anti-Bacterial Agents↗
PubMed2002

Molecular detection and genotyping of pathogens: more accurate and rapid answers.

Rapid molecular methods have enhanced the capabilities of laboratories to identify and characterize microbial pathogens in greater detail. Nucleic acid amplification strategies and advances in amplicon detection have been key aspects in the progress of molecular microbiology. Sophisticated new amplification-detection combinations are resulting in many applications in laboratory testing for infectious diseases. These applications include qualitative detection, sub-species-level DNA fingerprinting, molecular resistance testing and genotyping, and quantitative (viral load) testing. When applied selectively in the laboratory, these applications can enhance diagnostic approaches and clinical management and will probably evolve into standard laboratory and point-of-care testing protocols.

Bacteria↗
PubMed2005

Increased intrauterine frequency of Ureaplasma urealyticum in women with preterm labor and preterm premature rupture of the membranes and subsequent cesarean delivery.

OBJECTIVE: The purpose of this study was to evaluate the prevalence of microbial invasion of the amniotic cavity at the time of preterm cesarean delivery for therapy-resistant preterm labor or preterm premature rupture of membranes, which are events that commonly are induced by infection, and to compare this group of patients with a group of patients who underwent preterm cesarean delivery for indications other than preterm labor or preterm premature rupture of membranes. STUDY DESIGN: We studied 207 consecutive women between 23 and 34 weeks of gestation who underwent cesarean delivery. These patients were divided into 3 groups according to the indication for cesarean delivery: patients with preterm labor (group 1), patients with preterm premature rupture of membranes (group 2), and patients with other indications (group 3). In the course of the surgical procedure, amniotic fluid, amniotic membrane, and placental tissue specimens were collected for the detection of pathogens. RESULTS: Ureaplasma urealyticum was detected in 43.9% (58/132) of the patients of groups 1 and 2, with no significant difference between these 2 subgroups. In group 3, which served as the comparison group, Ureaplasma urealyticum was isolated in only 2.7% (2/75) of the patients. Ureaplasma urealyticum as a single pathogen was more frequent than all obligate pathogens together (43.9% vs 39.3%). CONCLUSION: Our results provide evidence for an association between intrauterine colonization with Ureaplasma urealyticum and both therapy-resistant preterm labor and preterm premature rupture of membranes.

Adult↗
PubMed1993

Evaluation of the Vitek EPS enteric pathogen screen card for detecting Salmonella, Shigella, and Yersinia spp.

We evaluated the Vitek EPS card as a screen for the enteric pathogens Salmonella spp., Shigella spp., and Yersinia enterocolitica. Salmonella spp., Shigella spp., and Y. enterocolitica (125, 54, and 5 isolates, respectively) and 81 nonenteric pathogens that might be selected for screening from primary plates (non-lactose fermenters) were tested. The EPS card correctly identified 183 of 184 pathogens tested (sensitivity, 99.5%). Of 81 nonenteric pathogens screened with the EPS card, 8 were identified as possible enteric pathogens (specificity, 90.1%). We reviewed our stool culture records over the past 1.5 years and analyzed the specificities of TSI-urea screens for 300 stool cultures that had suspicious colonies. From 55 of 300 stool cultures, either Salmonella spp. or Shigella spp. were isolated, and from 245 stool cultures, no pathogen was isolated. Of the 245 negative cultures, 166 gave false-positive screening-test results that resulted in further biochemical identification procedures (Analytab Products or Vitek identification). Thus, the specificity of the TSI-urea screen in our experience was 32.2%. The Vitek EPS card was shown to be a more cost-effective screening procedure than the TSI-urea screen.

Bacteriological Techniques↗
PubMed1996

[Molecular basis for detection of infectious agents].

Elimination of foreign pathogens requires detection of the presence of such microorganisms somewhere in the body. This task relies on specialized cells, among which specific lymphocytes permanently circulate throughout the body searching for signals indicative of the presence of invasive microorganisms. In contrast to B lymphocytes, T lymphocytes are unable to recognize bacteria or viruses in their native form. The structure of their antigen receptor only allows them to bind to small peptidic fragments that have to be stably presented by specific molecules at the surface of specific cells. These professional "antigen presenting cells" capture antigens and alert the immune system by expressing at their surface molecular complexes formed by their own major histocompatibility molecules (MHC) and fragments of the infectious agent. Extracellular microorganisms are captured by phagocytosis and digested into small peptides in the endosomal compartment of antigen presenting cells. The peptides able to bind to MHC class II molecules are transported to the cell surface. These antigen-MHC complexes are recognized by antigen specific CD4+ T lymphocytes, thus leading to the enhancement of antibody formation and of inflammatory responses which eliminate extracellular bacterial. In contrast, viruses or bacteria able to survive within the cytoplasm of the antigen presenting cells are digested by a specific multicatalytic enzymatic complex (the proteasome). The antigenic peptides released into the cytosol will be transported into the endoplasmic reticulum by an active peptide pump. The peptides able to bind to the groove of MHC class I molecules are transported to the cell surface. Their recognition by specific cytotoxic CD8+ lymphocytes leads to the destruction of the cells identified as infected. Thus, the mechanisms of antigen processing and presentation are able to generate a wide variety of antigenic fragments. Depending on the initial extra- or intracellular localization of the microorganism, some antigenic peptides will appear on the surface of antigen presenting cells on either MHC class I or class II molecules which are specifically recognized by either CD4+ or CD8+ lymphocytes. Only the antigenic peptides that are generated by this process and able to bind to MHC molecules of antigen presenting cells will be recognized by circulating lymphocytes and thus induce antigen specific immune response. Their identification therefore forms the basis of the defense mechanisms against infectious diseases and of novel immunization strategies.

Antigen-Presenting Cells↗
PubMedDate not supplied

Rapid detection and differentiation of pathogenic Campylobacter jejuni and Campylobacter coli by real-time PCR.

A two-tube real-time assay, developed in a LightCycler, was used to detect, identify and differentiate Campylobacter jejuni and Campylobacter coli from all other pathogenic members of the family Campylobacteriaceae. In the first assay, continuous monitoring of the fluorescence resonance energy transfer (FRET) signal acquired from the hybridisation of two adjacent fluoroprobes, a specific FITC probe 5'-GTGCTAGCTTGCTAGAACTTAGAGA-FITC-3') and a universal downstream probe Cy5 (5'-Cy5-AGGTGITGCATGGITGTCGTTGTCG-PO(4)-3'), to the 681-base pair 16S rRNA gene amplicon target (Escherichia coli position 1024-1048 and 1050-1075, respectively) produced by the primer pair, F2 (ATCTAATGGCTTAACCATTAAAC, E. coli position 783) and Cam-Rev (AATACTAAACTAGTTACCGTC, E. coli position 1464), detected C. coli, C. lari and C. jejuni. As expected, a Tm of 65 degrees C was derived from the temperature-dependent probe DNA strand disassociation. In the second assay, an increase in fluorescence due to binding of the intercalating dye SYBR Green I to the DNA amplicons of the hippuricase gene (hipO) (produced by the primer pair hip2214F and hip2474R) was observed for C. jejuni but not for C. coli which lacks the hipO gene. A Tm of 85+/-0.5 and 56 degrees C determined from temperature-dependent dye-DNA disassociation identified C. jejuni and the non-specific PCR products, respectively, in line with our expectation. The two-tube assay was subsequently used to identify and differentiate the 169 Campylobacteriaceae isolates of animal, human, plant and bird origin held in our culture collection into C. coli (74 isolates), C. jejuni (86 isolates) and non-C. coli-C. jejuni (9 isolates). In addition, the method successfully detected C. jejuni, C. coli and C. lari from 24-h enrichment cultures initiated from 30 commercial chicken samples.

Amidohydrolases↗
PubMed2001

Bacterial pathogens of otitis media and sinusitis: detection in the nasopharynx with selective agar media.

Carriage rates for the bacterial pathogens associated with otitis media (Streptococcus pneumoniae [SP], Hemophilus influenzae [HI], and Moraxella catarrhalis [MC]) are of interest. Culture on three selective agars was compared with culture on two standard agars to determine the more accurate method for detection of these species in the nasopharynx of healthy children. Weekly samples were obtained in winter from 18 healthy children (ages 1 through 9 years) as part of a longitudinal study. A 0.1-mL sample of 116 nasopharyngeal aspirate/washes was inoculated onto each of five agars. Two were standard (sheep blood and chocolate), and three were selective (blood with gentamicin for SP; chocolate with vancomycin, bacitracin, and clindamycin for HI; blood with amphotericin B, vancomycin, trimethoprim, and acetazolamide for MC). One technician read the standard plates and another the selective; both were blinded to the results of the other. SP was found in 44% of samples with selective agar versus 25% with standard agar; HI was found in 31% with selective versus 9% with standard; MC was found in 56% with selective versus 37% with standard. Overall, 80% of samples had one or more pathogens detected with selective agars as compared with 58% with standard agars (P =.0004). Selective agars were more accurate than standard agars for detecting otitis pathogens in the nasopharynx, where they are a common part of normal flora in healthy children.

Agar↗
PubMed2004

Recent progress in the characterization of molecular determinants in the Xanthomonas axonopodis pv. manihotis-cassava interaction.

Cassava bacterial blight, caused by Xanthomonas axonopodis pv. manihotis (Xam), is a widespread disease that affects cassava (Manihot esculenta Crantz). Studies on the pathogen population structure, pathogen diagnosis, identification and expression of plant genes involved in resistance have been carried out. Different molecular techniques were developed to assess the genetic diversity among the Xampopulations. Characterization of Xam population dynamics over time had enable us to determine the different factors that are associated with resistance breakdown and those that influence the genetic structure or virulence phenotypes of the pathogen's population. Methods for detecting the pathogen in vegetative planting materials and true seeds were developed and contributed to reduce the impact of the disease. To better understand the genetics of resistance a quantitative trait loci (QTLs) approach was developed. Using a PCR-based strategy with degenerate primers we isolated two resistance gene candidates in cassava. We also characterized a region of a chromosome rich in R-gene like sequence. In this review we also report the main results obtained by transcript profiling methodologies, cDNA-AFLP and ESTs developed by the authors to characterize the genes involved in disease resistance. All together these techniques allowed the identification of molecular markers either associated to CBB resistance or that may represent putative genes involved in disease resistance. This article reviews current knowledge on the molecular cassava-Xam interactions.

Chromosome Mapping↗
PubMed2005

Proteomic analysis of Bacillus anthracis Sterne vegetative cells.

Mass spectrometry and proteomics have found increasing use as tools for the rapid detection of pathogenic bacteria, even when they are in a mixture of non-pathogenic relatives. The success of this technique is greatly augmented by the availability of publicly accessible proteomic databases for specific pathogenic bacteria. To aid proteomic detection analyses for the causative agent of anthrax, we have constructed a comprehensive proteomic catalogue of vegetative Bacillus anthracis Sterne cells using liquid chromatography tandem-mass spectrometry. Proteins were separated by molecular weight or isoelectric point prior to tryptic digestion. Alternatively, the whole protein extract was digested and tryptic peptides were separated by cation exchange chromatography prior to Reverse Phase-LC-MS/MS. The use of three complementary, pre-analytical separation techniques resulted in the identification of 1048 unique proteins, including 694 cytosolic, 153 membrane (including 27 cell wall), and 30 secreted proteins, accounting for 19% of the total predicted proteome. Each identified protein was functionally categorized using the gene attribute database from TIGR CMR. These results provide a large proteomic catalogue of vegetative B. anthracis cells and, coupled with the recent proteomic catalogue of B. anthracis spore proteins, form a thorough summary of proteins expressed in the active and dormant stages of this organism.

Bacillus anthracis↗
PubMed2006

A multiplex real-time PCR assay for detection of Xanthomonas campestris from brassicas.

AIMS: To develop a sensitive real-time PCR-based protocol for the detection of Xanthomonas campestris pathovars from Brassica seed. METHODS AND RESULTS: A 5' nuclease real-time PCR assay was developed to screen Brassica spp. seed for the presence of X. campestris pathovars that cause black rot. The assay amplifies a 78-bp segment of the X. campestris hrpF gene and a 100-bp segment of the Brassica spp. 18S-25S internal transcribed spacer region. The Brassica spp. target provides an internal control for the amplification process to prevent false negatives that may arise from inhibitors that are often present in extracts from plant material. Whilst the primers were compatible with SYBR Green I assays, the use of fluorescently labelled probes in a 5' nuclease assay afforded greatest sensitivity and specificity. Seed batches carrying one artificially infected seed among 10,000 were readily detected using the assay. The multiplex real-time PCR assay permitted the rapid detection of pathogenic strains of X. campestris from bacterial colonies, Brassica seed and plants. CONCLUSIONS: Strains of X. campestris pathogenic to brassicas were readily detected from seed via a multiplex 5' nuclease real-time PCR assay. The real-time assay offers an improvement in sensitivity and a reduced turn-around time over the conventional multiplex PCR. SIGNIFICANCE AND IMPACT OF THE STUDY: Real-time PCR can be used to rapidly screen Brassica spp. seed batches for the presence of X. campestris pathovars. This assay provides a means for growers and the seed industry to be aware of the black rot status of their planting material, so that they may more effectively employ disease control measures or seed disinfection.

Brassica↗
PubMed1989

Detection of Neisseria meningitidis and Yersinia pestis with a novel silicon-based sensor.

A light-addressable potentiometric (silicon) sensor was used in an immunofiltration procedure for the detection of pathogenic bacteria. Yersinia pestis was detected by filtering the cells onto nitrocellulose membranes and then filtering anti-Y. pestis mouse monoclonal antibody and anti-mouse immunoglobulin G-horseradish peroxidase conjugate. For Neisseria meningitidis detection, mouse monoclonal antibody to the major outer membrane protein of this bacterium was coupled directly to horseradish peroxidase. N. meningitidis cell suspensions were filtered onto polycarbonate membranes, and the enzyme conjugate was allowed to react with the filtered bacteria. The presence of both enzyme conjugates was determined potentiometrically with the silicon sensor. The sensitivity of this technique relative to that of an enzyme-linked immunosorbent assay for N. meningitidis was determined. Fewer than 1,000 bacterial cells could be detected with the silicon sensor in a 20-min assay, whereas a 2.5-h enzyme-linked immunosorbent assay with the same antigen and antibody preparations was significantly less sensitive.

Antigens, Bacterial↗
PubMed1999

Etiology of community-acquired pneumonia: impact of age, comorbidity, and severity.

The aim of this study was to determine the etiology of community-acquired pneumonia (CAP) and the impact of age, comorbidity, and severity on microbial etiologies of such pneumonia. Overall, 395 consecutive patients with CAP were studied prospectively during a 15-mo period. Regular microbial investigation included examination of sputum, blood culture, and serology. Sampling of pleural fluid, transthoracic puncture, tracheobronchial aspiration, and protected specimen brush (PSB) sampling were performed in selected patients. The microbial etiology was determined in 182 of 395 (46%) cases, and 227 pathogens were detected. The five most frequent pathogens were Streptococcus pneumoniae (65 patients [29%]), Haemophilus influenzae (25 patients [11%]), Influenza virus A and B (23 patients [10%]), Legionella sp. (17 patients [8%]), and Chlamydia pneumoniae (15 patients [7%]). Gram-negative enteric bacilli (GNEB) accounted for 13 cases (6%) and Pseudomonas aeruginosa for 12 cases of pneumonia (5%). Patients aged < 60 yr were at risk for an "atypical" bacterial etiology (odds ratio [OR]: 2.3; 95% confidence interval [CI]: 1.2 to 4.5), especially Mycoplasma pneumoniae (OR: 5.3; 95% CI: 1.7 to 16.8). Comorbid pulmonary, hepatic, and central nervous illnesses, as well as current cigarette smoking and alcohol abuse, were all associated with distinct etiologic patterns. Pneumonia requiring admission to the intensive care unit was independently associated with the pathogens S. pneumoniae (OR: 2.5; 95% CI: 1.3 to 4.7), gram-negative enteric bacilli, and P. aeruginosa (OR: 2.5; 95% CI: 0.99 to 6.5). Clinical and radiographic features of "typical" pneumonia were neither sensitive nor specific for the differentiation of pneumococcal and nonpneumococcal etiologies. These results support a management approach based on the associations between etiology and age, comorbidity, and severity, instead of the traditional syndromic approach to CAP.

Adult↗