PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “AMYLASES”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5Linked to original sources

Complete nucleotide sequence of a thermophilic alpha-amylase gene: homology between prokaryotic and eukaryotic alpha-amylases at the active sites.

The nucleotide sequence of a thermophilic, liquefying alpha-amylase gene cloned from B. stearothermophilus was determined. The NH2-terminal amino acid sequence analysis of the B. stearothermophilus alpha-amylase confirmed that the reading frame of the gene consisted of 1,644 base pairs (548 amino acids). The B. stearothermophilus alpha-amylase had a signal sequence of 34 amino acids, which was cleaved at exactly the same site in E. coli. The mature enzyme contained two cysteine residues, which might play an important role in maintenance of a stable protein conformation. Comparison of the amino acid sequence inferred from the B. stearothermophilus alpha-amylase gene with those inferred from other bacterial liquefying alpha-amylase genes and with the amino acid sequences of eukaryotic alpha-amylases showed three homologous sequences in the enzymatically functional regions.

Amino Acid Sequence↗

A plant-seed inhibitor of two classes of alpha-amylases: X-ray analysis of Tenebrio molitor larvae alpha-amylase in complex with the bean Phaseolus vulgaris inhibitor.

The alpha-amylase from Tenebrio molitor larvae (TMA) has been crystallized in complex with the alpha-amylase inhibitor (alpha-AI) from the bean Phaseolus vulgaris. A molecular-replacement solution of the structure was obtained using the refined pig pancreatic alpha-amylase (PPA) and alpha-AI atomic coordinates as starting models. The structural analysis showed that although TMA has the typical structure common to alpha-amylases, large deviations from the mammalian alpha-amylase models occur in the loops. Despite these differences in the interacting loops, the bean inhibitor is still able to inhibit both the insect and mammalian alpha-amylase.

Animals↗

Alpha-amylase genes (amyR2 and amyE+) from an alpha-amylase-hyperproducing Bacillus subtilis strain: molecular cloning and nucleotide sequences.

amyR2, amyE+, and aroI+ alleles from an alpha-amylase-hyperproducing strain, Bacillus subtilis NA64, were cloned in temperate B. subtilis phage p11, and the amyR2 and amyE+ genes were then recloned in plasmid pUB110, which was designated pTUB4. The order of the restriction sites, ClaI-EcoRI-PstI-SalI-SmaI, found in the DNA fragment carrying amyR2 and amyE+ from the phage genome was also found in the 2.3-kilobase insert of pTUB4. Approximately 2,600 base pairs of the DNA nucleotide sequence of the amyR2 and amyE+ gene region in pTUB4 were determined. Starting from an ATG initiator codon, an open reading frame was composed of a total 1,776 base pairs (592 amino acids). Among the 1,776 base pairs, 1,674 (558 amino acids) were found in the cloned DNA fragment, and 102 base pairs (34 amino acids) were in the vector pUB110 DNA. The COOH terminal region of the alpha-amylase of pTUB4 was encoded in pUB110. The electrophoretic mobility in a 7.5% polyacrylamide gel of the alpha-amylase was slightly faster than that of the parental alpha-amylases. The NH2 termination portion of the gene encoded a 41-amino acid-long signal sequence (Ohmura et al., Biochem. Biophys. Res. Commun. 112:687-683, 1983). The DNA sequence of the mature extracellular alpha-amylase, a potential RNA polymerase recognition site and Pribnow box (TTGATAGAGTGATTGTGATAATTTAAAAT), and an AT-rich inverted repeat structure which has free energy of -8.2 kcal/mol (-34.3 kJ/mol) were identified. The AT-rich inverted repeat structure seemed to correspond to the hyperproducing character. The nucleotide sequence around the region was quite different from the promoter region of the B. subtilis 168 alpha-amylase gene which was cloned in the Escherichia coli vector systems.

Amino Acid Sequence↗

The hourly rate of urinary amylase excretion, serum amylase, and serum lipase. I. In control subjects and patients with renal disease.

The rates of urinary amylase excretion/hour and the levels of serum amylase and lipase were measured in 190 normal subjects and patients with no evidence of renal or gastrointestinal disorder. The hourly rate of urinary amylase excretion/hour was found to have an upper limit of normal of 69 IU. The upper limit of normal for the serum amylase was 251 IU/litre and for the serum lipase 1.6 units/ml. Raised levels of serum amylase and lipase with a normal rate of urinary amylase excretion/hour were found in chronic renal failure.

Adolescent↗

Changes of serum amylase, its isozyme fractions and amylase-creatinine clearance ratio in dogs with experimentally induced acute pancreatitis.

To investigate the diagnostic application of amylase to canine pancreatic diseases, serum amylase activities, its isozyme fractions and amylase-creatinine clearance ratio (ACCR) were analyzed in normal intact dogs and dogs experimentally induced acute pancreatitis. There was no statistic difference between normal male and female dogs. Amylase specific activities in pancreatic tissue extracts were more than 2,300 times higher than that in serum, and were also higher than those in other tissues; parotid and mandibular salivary glands, lung, heart, liver, spleen, duodenum, jejunum, ileum and kidney. Following the chloroform injection into the pancreatic tissue, WBC increased from 6 to 240 hr and serum glucose significantly increased at 72 and 96 hr, and no urine glucose was detected. BUN as well as serum and urine creatinine showed normal levels. ACCR increased until 96 hr without statistic significance. Serum amylase activities increased significantly after 3 hr and its isozyme was separated into 4 fractions (Amy1-Amy4) in contrast to 3 fractions (Amy2-Amy4) in intact dogs. Since this extra Amy1 seen from 1 hr increasing after 6 hr similarly to other 3 fractions, the evaluation of serum amylase and its isozyme fractions was indicated to be useful for the diagnosis of acute pancreatitis in dogs.

Acute Disease↗

On the quantitation of Iso-amylases in serum and the diagnostic value of serum pancreatic type amylase in chronic pancreatitis.

The object of this study is to elucidate whether the quantitative determination of serum pancreatic type iso-amylase can be used as a diagnostic test for exocrine pancreatic insufficiency. We describe the normal appearance of serum amylase zymograms produced with an agarose electrophoresis technique and the reference values from studies of 142 normal subjects for salivary and pancreatic type amylases. The patient group comprises 95 cases assumed to be representative of a patient population in which verification or exclusion of a diagnosis of chronic pancreatitis is of importance. In this group exocrine pancreatic function has been assessed by means of the Lundh meal test. We find that a low serum pancreatic type amylase value indicates the presence of a reduced exocrine pancreatic function (p = 0.96), and that a normal or elevated serum pancreatic type amylase value excludes the presence of a severe exocrine pancreatic insufficiency (p = 0.91). We also describe the occurrence of an abnormal amylase fraction which may be of diagnostic significance in pancreatic disease.

Adult↗

Characterization of kintoki bean (Phaseolus vulgaris) alpha-amylase inhibitor: inhibitory activities against human salivary and porcine pancreatic alpha-amylases and activity changes by proteolytic digestion.

The effects of some experimental parameters on alpha-amylase inhibition by an alpha-amylase inhibitor from kintoki bean were examined. The rate of inhibition against pancreatic alpha-amylase increased with a rise in temperature to 50 degrees C, but the inhibition of salivary alpha-amylase reached a maximum above 35 degrees C. Although an increase in NaCl concentration to 1.5 M caused an increase in the inhibitory activities against both amylases, these inhibitory activities tended to decrease above 1.5 M NaCl. The effects of proteolytic digestion on the amylase inhibitory activity were also studied. The inhibitor was slightly inactivated by pepsin digestion for 2 h. Although the inhibitor rapidly lost the inhibitory activity by chymotrypsin digestion within 2 h, it was quite resistant to proteolytic digestion by trypsin.

Animals↗

Genetic analysis of amylase-producing cell lines: ectopic activation of the amylase gene by translocation.

Two amylase-producing cell lines have been established, KMK-2 from a patient with gastric cancer, and KHM-1B from a patient with IgA lambda-type multiple myeloma. Both patients exhibited extremely high levels of serum amylase. The production of S-type amylase m-RNA by KMK-2 and KHM-1B was demonstrated by Northern blot analysis. Chromosome analysis showed many qualitative and quantitative abnormalities in both cell lines. In KHM-1B, a translocation was found between 1p13 or 21, near the amylase genes locus, and 9q34, the abl oncogene locus. These findings suggest the amylase gene in KHM-1B to be activated by translocation. A rearranged amylase gene was demonstrated by Southern blot analysis with only one enzyme, Accl.

Amylases↗

Induction of digestive alpha-amylases in larvae of Zabrotes subfasciatus (Coleoptera: Bruchidae) in response to ingestion of common bean alpha-amylase inhibitor 1.

Zabrotes subfasciatus larvae possess three alpha-amylase isoforms determined by in gel assays following SDS-PAGE. Two minor isoforms present lower electrophoretic mobility than the major form. When developed inside Vigna unguiculata (cowpea) seeds, fourth instar larvae have minor quantities of the slow-migrating isoforms, but when reared on seeds of Phaseolus vulgaris (common bean), the two slow-migrating forms are expressed in higher amounts, whilst the quantity of the major constitutive form is independent of the host bean. Larvae at the beginning of the fourth instar were fed on flour or cotyledons of cowpea and common bean and it was observed that the larvae fed on the common bean expressed the two slow-migrating forms in higher amounts when compared to the control larvae fed on cowpea. In order to investigate the possible correlation between the induction of alpha-amylases and the ingestion of the common bean alpha-amylase inhibitor 1 (alphaAI-1), this inhibitor was incorporated into artificial diet. It was observed that larvae fed on diet containing chronic doses of alphaAI-1 during their development, produced the two slow-migrating forms in higher amounts than control larvae, however, fourth-instar larvae fed on the same diet presented less amylase activity than control larvae. The data suggested that alphaAI-1 is involved in amylase induction and that it has inhibitory activity against the constitutive amylase, when starch granules are used as substrate.

Journal Article↗

Cloning in Bacillus subtilis of an extremely thermostable alpha amylase: comparison with other cloned heatstable alpha amylases.

A heatstable alpha amylase gene was shotgun cloned from Bacillus licheniformis RPO1 into Bacillus subtilis. Restriction endonuclease analysis of the recombinant plasmid revealed a map which was identical to a previously cloned alpha amylase from B. licheniformis FDO2 and very similar to the restriction map of a high temperature amylase from Bacillus coagulans. The thermostability and temperature optimum of the cloned alpha amylase was measureably different from those of the previously reported cloned alpha amylases.

Bacillus subtilis↗

Beta-amylase-resistant amylose. Effect of urea on the limited hydrolysis of amylose by beta-amylase.

Amylose prepared from starch dispersed in 10M-urea, pH6.2, was found to be resistant to the action of beta-amylase and phosphorylase, though it was degraded by alpha-amylase. Amylose isolated by conventional methods was similarly refractory after urea treatment, and was hydrolysed by beta-amylase to the extent of 32-35%; it had no inhibitory effect towards beta-amylase. The physical and chemical properties of the modified amylose were in general comparable with those of normal amylose with a beta-amylolysis limit of 94-98%. Starch and amylopectin were unaffected by urea treatment, i.e. the presence of amylopectin protected amylose against changes induced in it by urea. It is speculated that urea treatment "freezes" amylose molecules in a conformation that renders non-reducing termini inaccessible to the active site of the exo-enzymes. Such changes may limit the degradative action of beta-amylase and phosphorylase.

Amylases↗

Arginine is essential for the alpha-amylase inhibitory activity of the alpha-amylase/subtilisin inhibitor (BASI) from barley seeds.

Treatment of barley alpha-amylase/subtilisin inhibitor (BASI) with reagents specific for arginine, histidine, methionine and tyrosine residues and amino and carboxyl groups indicates that an arginine residue(s) is essential for its action on the target enzyme barley alpha-amylase 2. Phenylglyoxal modified eight out of 12 arginine residues in BASI. Kinetic analysis shows that the inactivation of BASI follows a pseudo-first-order reaction and is due to reaction with one molecule of phenylglyoxal; the second-order rate constant is determined to be 2.95 M-1.min-1. At pH 8.0, BASI and barley alpha-amylase 2 form an inactive 1:1 complex. The Ki value of this association is 2.2 x 10(-10) M. The alpha-amylase protects four arginine residues and also the alpha-amylase inhibitory activity of BASI against phenylglyoxal. When BASI from the phenylglyoxal-modified target enzyme-inhibitor complex is isolated and subjected to a second treatment with phenylglyoxal, four additional arginine residues are modified, with concomitant loss of the inhibitory activity. These results are discussed in relation to a three-dimensional model of BASI based on the known structure of the corresponding inhibitor from wheat.

Arginine↗

A chimera-like alpha-amylase inhibitor suggesting the evolution of Phaseolus vulgaris alpha-amylase inhibitor.

White kidney bean (Phaseolus vulgaris) contains two kinds of alpha-amylase inhibitors, one heat-stable (alpha AI-s) and one heat-labile (alpha AI-u). alpha AI-s has recently been revealed to be a tetrameric complex, alpha(2)beta(2), with two active sites [Kasahara et al. (1996) J. Biochem. 120, 177-183]. The present study was undertaken to reveal the molecular features of alpha AI-u, which is composed of three kinds of subunits, alpha, beta, and gamma. The gamma-subunit, in contrast to the alpha- and beta-subunits that are indistinguishable from the alpha- and beta-subunits of alpha AI-s, was found to correspond to a subunit of an alpha-amylase inhibitor-like protein, which has been identified as an inactive, evolutionary intermediate between arcelin and the alpha-amylase inhibitor in a P. vulgaris defense protein family. The polypeptide molecular weight of alpha AI-u determined by the light-scattering technique, together with the polypeptide molecular weights of the subunits, suggests that alpha AI-u is a trimeric complex, alpha beta gamma. The inhibition of alpha AI-u by increasing amounts of porcine pancreatic alpha-amylase (PPA) indicates that an inactive 1:1 complex is formed between alpha AI-u and PPA. Molecular weight estimation of the complex by the light-scattering technique confirmed that it is a complex of alpha AI-u with one PPA molecule. Thus it seems probable that alpha AI-u is an evolutionary intermediate of the P. vulgaris alpha-amylase inhibitor.

Amino Acid Sequence↗

In situ localization of amylase mRNA and protein. An investigation of amylase gene activity in normal human parotid gland.

The distribution of human salivary amylase mRNA was studied by in situ hybridization to a [32P]-labeled amylase cDNA probe. Amylase mRNA was localized to the apical portion of acinar cells in frozen sections of human parotid salivary gland. No hybridization was noted in ductal cells, skeletal muscle, or in connective tissue. These results were consistent with immunohistochemical localization of amylase. The technique of in situ hybridization was modified to permit localization of amylase mRNA in variously fixed, paraffin-embedded parotid glands. Although the hybridization signal decreased with all fixatives, the pattern of localization paralleled that obtained with frozen sections. No advantage was noted in fixation with ethanol-acetic acid or Bouin solution over routine fixation with formalin. These results have important implications for researchers interested in studies of gene expression. We have demonstrated that routinely fixed paraffin blocks of human tissue can be used for cellular localization of specific mRNA. In coordination with immunocytochemistry, in situ hybridization offers a powerful tool for studies of mRNA and protein expression in individual cells.

Amylases↗

A prospective study of amylase-rich pleural effusions with special reference to amylase isoenzyme analysis.

By analysis of pleural effusions from 200 patients, 25 cases of amylase-rich effusions were identified, for an overall incidence of 13 percent. Four of the 25 patients (16 percent) had evidence of pancreatitis. These patients had higher mean ratios of pleural fluid to serum amylase levels (18 +/- 6.3 [SEM] vs 4.8 +/- 1.3) compared to patients with nonpancreatic diseases (p = 0.003); all four exhibited a predominant pancreatic isoenzyme profile. Of the 21 patients with nonpancreatic amylase-rich effusions, lung cancer was the most commonly associated condition (8 patients). In 14 of the 21 patients in whom an isoenzyme profile was obtained, salivary-type amylase was predominant. Amylase-rich pleural effusions occur frequently, and pleural fluid isoamylase determination is specific for pancreatitis-associated effusions. The finding of a pleural effusion rich in salivary isoamylase should prompt an evaluation for carcinoma (particularly of lung primary), but may also be seen in other pleural inflammatory conditions.

Amylases↗

The primary structure of alpha-amylase inhibitor Z-2685 from Streptomyces parvullus FH-1641. Sequence homology between inhibitor and alpha-amylase.

The native and oxidized alpha-amylase inhibitor Z-2685, isolated from the culture medium of Streptomyces parvullus FH-1641, and its overlapping cleavage products were degraded by the automatic Edman technique. Digestion was carried out with pepsin, thermolysin and trypsin. The alpha-amylase inhibitor is a polypeptide consisting of 76 amino acids with a molecular mass of 8 129 Da. With the exception of methionine and lysine, all naturally occurring amino acids are present. It is interesting that identical regions exist, in particular the sequence Trp-Arg-Tyr common to all four known microbial inhibitor sequences. We believe that the side chains of these three amino acids are important for interacting with the alpha-amylase molecule. Computer alignment enabled us to show a possible binding region in the alpha-amylase molecule which might react with the inhibitors. Furthermore, homology exists to mammalian alpha-amylases. This result is explained by the assumption that the inhibitor evolved from a duplication of the original gene of the enzyme.

Amino Acid Sequence↗

Electrophoretic behavior of amylase in mouse: the parotid gland is major source of serum amylase.

Amylase activity in the saliva, salivary glands, serum, liver (perfused and non perfused) and pancreas was assayed and isoamylases were separated by electrophoresis in these organs using C57BR/cdJ and M. m. molossinus (Kor) mice. Amylase isozymes in the saliva, parotid gland, serum and liver were identical in both strains, respectively. Amylase activity in the liver was lower than that in the serum and liver amylase disappeared almost by perfusion. Major serum amylase was released from the parotid gland in intact animals.

Amylases↗

The inhibition of human salivary alpha-amylase by type II alpha-amylase inhibitor from Triticum aestivum is competitive, slow and tight-binding.

A kinetic analysis of the inhibition of human salivary alpha-amylase (EC 3.2.1.1) by wheat seed (Triticum aestivum) type II alpha-amylase inhibitor revealed the inhibition was slow and tight-binding. The inhibition was competitive with an inhibition binding constant of the alpha-amylase inhibitor for alpha-amylase of 0.29 nM. The KM of alpha-amylase for soluble starch (calculated per mole of alpha-1,4 linked maltose residues) was 5.87 mM.

Binding, Competitive↗