PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Chromosome Fragility”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5Linked to original sources
PubMed2006

Chromosomal fragile sites in schizophrenic patients.

Schizophrenia is a common and complex mental disorder. Cytogenetic and molecular studies have shown that genetic factors play an important role in the etiology of schizophrenia. As a preliminary step in the search for chromosomal location of a susceptible gene predisposing to schizophrenia, cytogenetic screening patients might be useful. Therefore, this report is aimed at studying the relationship between chromosomal fragile sites (FS: gaps, breaks, triradial figures, and several rearrangements) and the etiology of schizophrenia. Because of this, we were compared the frequencies of folate-sensitive FS from schizophrenic patients and normal individuals in short-term whole blood cultures. The rate of FS expression in the patients was considerably higher than in the controls. We determined 15 common FS (cFS) (1q21, 1q32, 2q21, 2q31, 3p14, 4q31, 5q31, 6q21, 6q26, 7q22, 7q32, 10q22, 13q32, Xp22 and Xq22), 6 rare FS (rFS) (6p21, 8q22, 11q23, 12q24, 16q22, and Xq26) and 2 previously unknown FS (3p25 and 5q22). Among these expressed FS, there was a significantly higher frequency of 12 FS at 2q31, 3p25, 3p14, 5q31, 6q21, 7q22, 7q32, 10q22, 11q23, 12q24, Xq22 and Xq26 in patient group than in controls by chi2 test (P = between 0.0001 to 0.036). Sites 3p14, 5q31 and 7q22 were also the most frequently observed cFS. Males exhibited twice as many FS as females, but no age effects were observed. The potential relationship between increased FS frequency and the occurrence of schizophrenia in these patients is discussed.

Adolescent↗
PubMed1988

Psychiatric disability in female carriers of the fragile X chromosome.

Fragile X syndrome, an X-linked genetic condition, is an important genetic cause of mental retardation in males. In addition to mental retardation, hemizygous males with fragile X syndrome appear to have a greater likelihood of displaying behaviors classified under the diagnostic category of pervasive developmental disorder than would be expected on the basis of mental retardation alone. Although the majority of female heterozygotes with the fragile X genetic defect are of normal intelligence, our clinical work with this population and a recent case report have suggested that females with fragile X syndrome have an increased rate of schizophrenia spectrum and affective disorders. In this study, the relationship of the fragile X genetic defect to psychopathology in female heterozygotes is investigated by psychiatric evaluation of 35 obligate female carriers of the fragile X chromosome and a comparison group of 24 fragile X-negative controls. Female fragile X carriers were found to have a greater frequency of psychopathology associated with schizophrenia spectrum diagnoses, particularly schizotypal features. A weaker association between the fragile X genetic defect and chronic affective disorders was detected. The specificity of the neuropsychiatric phenotype occurring in particular genetic conditions such as the fragile X syndrome adds a potentially valuable tool to the study of psychopathology in the general population.

Child Development Disorders, Pervasive↗
PubMed2002

Chromosomal fragility in a behavioral disorder.

Numerous studies have shown there is consistent evidence implicating genetic factors in the etiology of autism. In some cases chromosomal abnormalities have been identified. One type of these abnormalities is gaps and breaks nonrandomly located in chromosomes, denominated fragile sites (FS). We cytogenetically analyzed a group of autistic individuals and a normal population, and we examined the FS found in both samples with the aim of (1) comparing their FS expression, (2) ascertaining whether any FS could be associated with our autistic sample, and (3) examining if there are differences between individual and pooled-data analyses. Different statistical methods were used to analyse the FS of pooled and individual data. Our results show that there are statistically significant differences in the spontaneous expression of breakages between patients and controls, with a minimal sex difference. Using the method for pooled data, eight autosomal FS have preferential expression in patients and five patients were found to be positive at FS Xq27.3. With the method per-individual analysis, four FS emerged as specific in our autistic sample. Inferences of FS from pooled data were different from those of individual data. The findings suggest that although analysis of pooled data is necessitated by the problem of sparse data, analysis of single individuals is essential to know the significance of FS in autism.

Adult↗
PubMed1990

Chromosome fragile sites in Down syndrome patients.

We report on the fragile site expression in lymphocytes from 16 Down syndrome (DS) men aged 24 to 52 years. Among rare fragile sites, 16q22 has been reported to be induced or enhanced by alpha-interferon. Since DS cells have three copies of the receptor for alpha-interferon, we hypothesized a possible enhancement of 16q22 expression. This fragile site has also been related to a specific rearrangement in M4 acute nonlymphocytic leukemia. In view of the high incidence of acute leukemia in DS subjects, we studied the expression of 16q22 in lymphocyte cultures treated with 5-bromodeoxyuridine or alpha-interferon. We also studied whether the repair deficiency of DS cells could affect the expression of aphidicolin-induced fragile sites. The level of chromosomal aberrations was compared with that found in aphidicolin-treated cultures from 12 normal subjects of the same age. We found neither spontaneous or BrdU-induced fragility at 16q22 nor induction by alpha-interferon. Chromosomal breakage rate was increased in alpha-interferon-treated cultures in comparison with control cultures of the same subjects. Aphidicolin-induced fragile sites expression in DS patients did not differ significantly from that found in the lymphocyte cultures from control subjects.

Adult↗
PubMed2006

Loss of Ubr2, an E3 ubiquitin ligase, leads to chromosome fragility and impaired homologous recombinational repair.

The N-end rule pathway of protein degradation targets proteins with destabilizing N-terminal residues. Ubr2 is one of the E3 ubiquitin ligases of the mouse N-end rule pathway. We have previously shown that Ubr2-/- male mice are infertile, owing to the arrest of spermatocytes between the leptotene/zygotene and pachytene of meiosis I, the failure of chromosome pairing, and subsequent apoptosis. Here, we report that mouse fibroblast cells derived from Ubr2-/- embryos display genome instability. The frequency of chromosomal bridges and micronuclei were much higher in Ubr2-/- fibroblasts than in +/+ controls. Metaphase chromosome spreads from Ubr2-/- cells revealed a high incidence of spontaneous chromosomal gaps, indicating chromosomal fragility. These fragile sites were generally replicated late in S phase. Ubr2-/- cells were hypersensitive to mitomycin C, a DNA cross-linking agent, but displayed normal sensitivity to gamma-irradiation. A reporter assay showed that Ubr2-/- cells are significantly impaired in the homologous recombination repair of a double strand break. In contrast, Ubr2-/- cells appeared normal in an assay for non-homologous end joining. Our results therefore unveil the role of the ubiquitin ligase Ubr2 in maintaining genome integrity and in homologous recombination repair.

Animals↗
PubMed1998

Chromosomal fragility may be indicative of altered higher-order DNA organization as the underlying genetic diathesis in complex neurobehavioral disorders.

Preliminary observations concerning increased chromosomal fragility in association with behavioural disorders in humans allow an opportunity to suggest a cohesive theory regarding the possible importance of higher-order DNA modifications in the coordination of gene function in brain evolution and during development. Visible or submicroscopic acentric chromosomal fragments are formed as an accompaniment to chromosomal breakage and are associated with sequence amplification. During genomic reintegration of extrachromosomally amplified repeat sequence elements, functional consequences could include unequal crossing over with gain-of-function, and/or deletion with loss-of-function. This process could result in regulatory changes in gene function in association with normal coding regions, since fragile sites appear to be located at or near upstream DNaseI-hypersensitive areas. Earlier research on chromosomal breakage in relation to transposon behaviour in maize has set a precedent by which many elements in a network could be coordinately controlled, a principle which may allow transcriptional control over multiple areas in the genome simultaneously. The hypothesis proposed in this paper implies that a small number of fundamental higher-order changes may be responsible for influencing a wide range of genetic alterations leading to complex phenotypes, sometimes segregating as distinct entities within pedigrees, or alternatively, and perhaps more commonly, presenting with several overlapping phenotypes in some other families. Studying only pure multiplex families in psychiatric genetics may not be sufficient for an understanding of the underlying genetic diathesis in this group of disorders. Validation of the fragile site hypothesis for complex neurobehavioural disorders may offer additional avenues for gene therapy based either on preferential integration of exogenous DNA at fragile sites, or utilizing the acentric fragments to modify sequence amplification extrachromosomally.

Chromosome Breakage↗
PubMed1997

Human chromosomal fragile site FRA16B is an amplified AT-rich minisatellite repeat.

Fragile sites are nonstaining gaps in chromosomes induced by specific tissue culture conditions. They vary both in population frequency and in the culture conditions required for induction. Folate-sensitive fragile sites are due to expansion of p(CCG)n trinucleotide repeats; however, the relationship between sequence composition and the chemistry of induction of fragile sites is unclear. To clarify this relationship, the distamycin A-sensitive fragile site FRA16B was isolated by positional cloning and found to be an expanded 33 bp AT-rich minisatellite repeat, p(ATATA TTATATATTATATCTAATAATATATC/ATA)n (consistent with DNA sequence binding preferences of chemicals that induce its cytogenetic expression). Therefore the mutation mechanism associated with trinucleotide repeats is also a property of minisatellite repeats (variable number tandem repeats).

Base Composition↗
PubMed2005

[A study of chromosomal fragility in peripheral blood lymphocytes in patients with lymphomas].

Patients with lymphomas were shown to have authentically a higher frequency of fragile sites, both spontaneous and induced by aphidikoline expression, in comparison with the control group. Differential sensitivity of chromosomes caused by the action of aphidikolin was revealed. The fragility of chromosomes 9 and 11 in patients with lymphomas on sites 9q31-32 and 11p13-14 was authentically higher (alpha = 0.05) than that in healthy individuals. Site 9q31-32 appeared to be strictly specific for lymphoma disease.

Adolescent↗
PubMed2005

Chromosomal fragility, structural rearrangements and mobile element activity may reflect dynamic epigenetic mechanisms of importance in neurobehavioural genetics.

Advances in human genome analyses have not yet allowed identification of specific genetic mechanisms underlying the expression of human neurobehavioural disorders. There is an increasing awareness that several genes may contribute to behavioural phenotypes and these genes appear to interact in as yet undetermined ways. It has been suggested that the problem needs elucidation from an epigenetic, gene expression perspective. Cytogenetic instability manifesting as chromosomal fragile sites, translocations, duplications, deletions and inversions, when co-occurring with neurobehavioural disorders, may offer a doorway to the investigation of such chromatin level, regulatory region, epigenetic processes. Due to earlier indications of non-specificity of chromosomal aberrations, poor phenotype:genotype correlations and a shift to analysing candidate coding regions on high resolution map level, the only utility of chromosomal breakpoints came to be seen as harbouring possible candidate genes of interest when segregating together with particular neurobehavioural disorders. More recent findings of the expression of highly specific subsets of fragile sites in association with Tourette and Rett syndromes need to be extended to other neurobehavioural disorders to ascertain whether observed patterns can be considered representative of 'chromatin endophenotypes' correlating with discrete sets of neurobehavioural symptoms. Environmental/epigenetic factors could affect the chromatin characteristics of the genome arising through DNA strand breakage, mobile element activity and retroinsertion, establishing new architectural features of regulatory control networks very rapidly in comparison to coding region evolution rates. Microarray-based techniques for the genome-wide mapping of in vivo protein-DNA interactions offer increasingly comprehensive views of genetic and epigenetic regulatory networks. It may be informative to include functionally significant chromatin structural variation analyses when considering candidate genes for neurobehavioural disorders.

Cell Cycle↗
PubMedDate not supplied

Chromosome fragility and predisposition to childhood malignancies.

In order to clarify the possible connection between autosomal folate sensitive Fragile Sites (FS) and genetic susceptibility to haemopoetic disease in children we investigated the frequency and distribution of FS in the Peripheral Blood Lymphocytes (PBL) of 56 children with newly diagnosed and untreated haematologic malignancies and their parents. The incidence was compared with that of 146 normal controls (children and adults). In all patients the Bone Marrow (BM) karyotype was also determined. Heritable FS were detected in 49 patients (87.5%). 20 children had more than one FS and in all cases it was inherited from one of their parents, although there was a significant excess of transmitting mothers. 19 different FS were identified: 14 common, 4 rare and one, 22q11, which has not been previously reported, but it is considered as important as it coincides with the cancer breakpoint resulting in the formation of the Philadelphia (Ph) chromosome. The frequency of FS in the PBL of the patients was significantly higher than in the controls and this increase was independent of any abnormality detected in the malignant cells of the BM. However, patients with an abnormal BM karyotype displayed increased frequency of FS induction as compared to patients with a normal karyotype. In three cases the heritable FS was found to be at or near the breakpoints of the chromosomal rearrangements detected in the malignant cells. The findings are discussed with regard to cancer specific breakpoints, oncogene loci and sites where viral DNA can be inserted to the genome. The results of this study suggest that autosomal folate sensitive FS may increase the risk for haematologic malignancies through a complex mechanism which remains to be clarified.

Adult↗
PubMed1983

Protease inhibitor (PI) phenotype of individuals with chromosomal fragile sites.

One hundred and four fragile sites were ascertained from 95 unrelated families. In each family the ancestry of the fragile site was traced as far as possible and the PI phenotype of the carrier in the earliest generation determined. Mildly deficient PI phenotypes were more prevalent than expected among earliest carriers of folate sensitive fragile sites, but not for BrdU dependent fragile sites. The significance of this finding is unclear and is based upon relatively small numbers. Another series of fragile site carriers would need to be studied and similar results found before the question of any relationship between PI phenotype and mutagenesis to fragile sites could be raised.

Chromosome Fragile Sites↗