SEARCH · PubMed Health

Results for “antisense targeting”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5Linked to original sources

PubMed2000

Masked antisense: a molecular configuration for discriminating similar RNA targets.

Antisense technology has great potential for the control of RNA expression, but there remain few successful applications of the technology. Expressed antisense RNA can effectively down-regulate expression of a gene over long periods, but cannot differentiate partly identical sequences, such as the mRNA of fusion genes or those with point mutants. We have designed a structured form of expressed antisense, which can discriminate between highly similar mRNA molecules. These 'masked' antisense RNAs have most of the antisense sequence sequestered within duplex elements, leaving a short single-stranded region to initiate binding to target RNA. After contacting the correct target, the structured RNA can unravel, releasing the masked antisense region to form a stable duplex with the mRNA. We demonstrate that suitable masked antisense RNA can discriminate between the two forms of BCR-ABL mRNA that result from the Philadelphia chromosomal translocations, as well as discriminating the normal BCR and ABL mRNA.

Autoradiography↗

PubMed1999

Differential knockdown of delta-opioid receptor subtypes in the rat brain by antisense oligodeoxynucleotides targeting mRNA.

Two antisense oligodeoxynucleotides (A-ODN), targeting delta-opioid receptor mRNA (DOR) and two mismatch ODN sequences (mODN) were continuously infused for 24 days into the lateral brain ventricles of Wistar rats. The density of delta-opioid receptors in rat brain homogenates was measured by saturation binding experiments using four selective ligands, two agonists ([D-Ala2, Glu4]-deltorphin and DPDPE) and two antagonists (Dmt-Tic-OH and naltrindole), and by immunoblotting SDS solubilized receptor protein. In brain membranes of mODN or saline-infused rats, the rank order of delta-opioid receptor density, calculated by Bmax values of the four delta-opioid receptor ligands, was: [D-Ala2, Glu4]deltorphin approximately Dmt-Tic-OH approximately naltrindole (86-118 fmo/mg protein) > DPDPE (73.6+/-6.3 fmol/mg protein). At the end of the 24 day infusion of A-ODN targeting DOR nucleotide sequence 280299 (A-ODN280-299), the Bmax of DPDPE (62.4+/-3.2 fmol/mg protein) was significantly higher than that of Dmt-Tic-OH (31.5+/-3.9 fmol/mg protein). Moreover, both the Kd value for DPDPE saturation binding and the Ki value for Dmt-Tic-OH displacement by DPDPE were halved. In contrast, an A-ODN treatment targeting exon 3 (A-ODN741-760) decreased the specific binding of [D-Ala2, Glu4]deltorphin and Dmt-Tic-OH significantly less (67%-81%) than the binding of DPDPE (53%), without changes in DPDPE Ki and KD values. No A-ODN treatment modified the specific binding of the micro-opioid agonist DAMGO and of the k-selective opioid receptor ligand U69593. On the Western blot of solubilized striatum proteins, A-ODN(280-299) and A-ODN(741-760) downregulated the levels of the DOR protein, whereas the corresponding mODN were inactive. The 24-day infusion of A-ODN(280-299) inhibited the rat locomotor response to [D-Ala2, Glu4]deltorphin but not to DPDPE. Intracerebroventricular (i.c.v.) infusion of A-ODN(741-760) reduced the locomotor responses to both delta-opioid receptor agonists, whereas mODN infusion never affected agonist potencies. In conclusion, these results demonstrate that 24-day continuous i.c.v. infusion of A-ODN targeting the nucleotide sequence 280-299 of DOR can differentially knockdown delta1 and delta2 binding sites in the rat brain.

Animals↗

PubMed2001

Association of c-Raf expression with survival and its targeting with antisense oligonucleotides in ovarian cancer.

c-Raf is an essential component of the extracellular related kinase (ERK) signal transduction pathway. Immunohistochemical staining indicated that c-Raf was present in 49/53 ovarian adenocarcinomas investigated and high c-Raf expression correlated significantly with poor survival (P = 0.002). c-Raf protein was detected in 15 ovarian cancer cell lines. Antisense oligodeoxynucleotides (ODNs) (ISIS 5132 and ISIS 13650) reduced c-Raf protein levels and inhibited cell proliferation in vitro. Selectivity was demonstrated by the lack of effect of ISIS 5132 on A-Raf or ERK, while a random ODN produced only minor effects on growth and did not influence c-Raf expression. ISIS 5132 produced enhanced apoptosis and cells accumulated in S and G(2)/M phases of the cell cycle. In vivo, ISIS 5132 inhibited growth of the s.c. SKOV-3 xenograft while a mismatch ODN had no effect. These data indicate that high levels of c-Raf expression may be important in ovarian cancer and use of antisense ODNs targeted to c-Raf could provide a strategy for the treatment of this disease.

Animals↗

PubMed2006

Solution structure of a purine rich hexaloop hairpin belonging to PGY/MDR1 mRNA and targeted by antisense oligonucleotides.

A preferential target of antisense oligonucleotides directed against human PGY/MDR1 mRNA is a hairpin containing a stem with a G*U wobble pair, capped by the purine-rich 5'r(GGGAUG)3' hexaloop. This hairpin is studied by multidimensional NMR and restrained molecular dynamics, with special emphasis on the conformation of south sugars and non-standard phosphate linkages evidenced in both the stem and the loop. The hairpin is found to be highly structured. The G*U wobble pair, a strong counterion binding site, displays structural particularities that are characteristic of this type of mismatch. The upper part of the stem undergoes distortions that optimize its interactions with the beginning of the loop. The loop adopts a new fold in which the single-stranded GGGA purine tract is structured in A-like conformation stacked in continuity of the stem and displays an extensive hydrogen bonding surface for recognition. The remarkable hairpin stability results from classical inter- and intra-strand interactions reinforced by numerous hydrogen bonds involving unusual backbone conformations and ribose 2'-hydroxyl groups. Overall, this work emphasizes numerous features that account for the well-ordered structure of the whole hairpin and highlights the loop properties that facilitate interaction with antisense oligonucleotides.

ATP Binding Cassette Transporter, Subfamily B, Mem↗

PubMed2002

Selective binding of trisamine-modified phosphorothioate antisense DNA to target mRNA improves antisense activity and reduces toxicity.

Antisense activity in living cells has been thought to occur via a mechanism involving both DNA-mediated hybridization arrest of target mRNA and RNase H-mediated mRNA digestion. Therefore an ideal antisense agent should be permeable to the cell and possess capacities (1) to form a thermally stable duplex in vivo with its target, (2) to discriminate between mRNAs with different degrees of complementarity, and (3) to form antisense/RNA complexes that are susceptible to RNase H hydrolysis. A trisamine-modified deoxyuridine derivative of a novel phosphorothioate DNA 15-mer that meets all these criteria is described here. Compared with the unmodified phosphorothioate oligomer, the phosphorothioate derivative exhibits a higher antisense activity as well as reduced cytotoxicity in cells infected with HIV-1. Our data suggest that the melting temperature (T(m)) between antisense DNA and the target mRNA is not only one of the factors contributing to this derivative's improved antisense activity. Also important are an enhanced ability to discriminate between sequences and an increased susceptibility of the DNA/mRNA complex to RNase H hydrolysis. These results will be useful in designing more active, clinically useful antisense drugs.

Anti-HIV Agents↗

PubMed2004

Experimental study on induction of renal cell carcinoma apoptosis by antisense oligonucleotide targeting survivin.

The effect of antisense oligonucleotide (ASODN) targeting survivin on renal cell carcinoma (RCC) apoptosis, proliferation and sensitivity to chemotherapeutic drugs was investigated. Antisense oligonucleotide targeting survivin was designed and composed. The cDNA of survivin was transfected into RCC cell lines ACHN and 769-P, respectively. They were both cultured in normal condition. After transfection, ACHN and 769-P cell lines were cultured in a 6-well culture plate. The cultured cells were divided into 6 groups. Twenty-four h after transfection, survivin protein expression was detected by Western blot. Apoptotic index (AI) and proliferative index (PI) were examined by flow cytometry. Rate of inhibition (IR) by chemotherapeutic drugs was determined by the colorimetric MTT cell viability/proliferation assay. The results showed AI and IR of chemotherapeutic drugs in ASODN groups were significantly higher than those in the groups without ASODN. There were statistical differences between ASODN groups and control groups (P< 0.05), but there was no difference among control groups (P>0.05). The PI in the ASODN groups was significantly lower than that in the control groups with the difference being statistically significant (P<0.05). In addition, there were no differences among control groups. It was concluded that the expression of survivin could be down-regulated in 2 cell lines after ASODN transfection. Antisense oligonucleotide targeting survivin could induce RCC apoptosis, inhibit cell proliferation and sensitize RCC to chemotherapy.

Apoptosis↗

PubMed1997

Specific inhibition of in vitro reverse transcription using antisense oligonucleotides targeted to the TAR regions of HIV-1 and HIV-2.

Antisense oligonucleotides (ODNs) overlapping the stem-loop structure of the trans-activating responsive (TAR) element at the 5' end of HIV-1 and HIV-2 viral RNAs were tested for their inhibitory effect on cDNA synthesis by HIV-1 and HIV-2 reverse transcriptases (RT). Inhibition of reverse transcription is sequence-specific and enhanced by the presence of the RT-associated RNase H activity. The degree of inhibition obtained with the anti-TAR antisense is significantly higher than with other HIV-1 targeted antisense ODNs used before [1]. Gel retardation showed a stable specific complex between the 16- and 25-mer anti-TAR HIV-1 selected ODNs and the target region. No complex was observed with a non-inhibitor 22-mer anti-TAR ODN and with the corresponding control sequences. Targeting of the first stem-loop in the 5' region of HIV-2 RNA by anti-TAR ODNs inhibited very strongly reverse transcription by HIV-2 RT. The structure of the antisense and the target sequence affect annealing efficiency and hence the degree of inhibition of reverse transcription.

Base Sequence↗

PubMed2003

[Design of antisense oligodeoxynucleotide targeting at bcl-2 mRNA and observation on its effect on the sensitivity of leukemia cells to arabinosyl cytosine].

The effective target sites for antisense oligodeoxynucleotides (AS-ODN) on bcl-2 mRNA, except its start region, were looked for and their effects on the sensitivity of HL-60 and K562 leukemia cells to arabinosyl cytosine (Ara-C) were observed. The secondary structure of bcl-2 mRNA was simulated with RNAstructure microsoftware, and AS-ODNs, targeting at some sites, were designed and synthesizd with phosphorothioate modifying. The median inhibitory concentration (IC(50)) of Ara-C for HL-60 and K562 cells was determined with MTT method; the apoptosis rate and bcl-2 protein expression level were assayed by flow cytometry. The results showed that 10 micro mol/L bcl-2 AS-ODN combined with Ara-C inhibited the expression of bcl-2 protein, increased apoptosis in HL-60 and K562 cells and decresed IC(50) of Ara-C significantly. The AS-ODN targeting the coding region of bcl-2 mRNA had stronger effect than AS-ODN targeting the translation initiation region. In conclusion, the much more effective sites for antisense oligodeoxynucleotides to target, except translation start region, might provide a new useful way for antisense drug design.

Antimetabolites, Antineoplastic↗

PubMed1999

Safety, pharmacokinetics, and tissue distribution of liposomal P-ethoxy antisense oligonucleotides targeted to Bcl-2.

Antisense oligonucleotides (oligos) have the ability to selectively block disease-causing genes, thereby inhibiting production of disease-associated proteins. However, their effectiveness has been limited by their low intracellular delivery. We had previously demonstrated that liposomes could increase the intracellular uptake of P-ethoxy oligos, hydrophobic analogs of phosphodiesters, and that liposomal Bcl-2 P-ethoxy antisense oligos (L-Bcl-2) could selectively inhibit Bcl-2 protein production, thereby inducing growth inhibition in Follicular Lymphoma cell lines. To understand the in vivo behavior of L-Bcl-2, we conducted a series of studies to evaluate the safety, pharmacokinetics, and tissue distribution of i.v. injections of L-Bcl-2 in normal rodents. Daily administration of 20 mg of L-Bcl-2/kg of body weight in 5 consecutive days had no adverse effects on renal or hepatic functions, nor on hematological parameters. Histopathology also did not reveal any significant changes in the morphology of the organs studied. In rats, the area under the curve of L-Bcl-2 reflects a two-compartment model of distribution with a biphasic plasma clearance. The T(1/2alpha) and T(1/2beta) were approximately 8 min and 4.2 h, respectively, and the V(d) was 79 ml, indicating a broad body distribution. The highest concentrations of L-Bcl-2 were found in spleen > liver > kidneys. These studies showed that in the schedules studied no significant toxicity associated with L-Bcl-2 was observed over 6 weeks, and that L-Bcl-2 could be widely distributed in the body.

Animals↗

PubMed1994

In vitro selection of antisense oligonucleotides targeted to a hairpin structure.

Antisense oligonucleotides are widely used to selectively prevent pre-RNA splicing, mRNA translation or cDNA synthesis from a retroviral RNA template. However, intramolecular folding of the RNA chain can sequester the target sequence into a stable structure. Consequently, the antisense effect can be greatly reduced or even abolished. Hydrogen donor and acceptor sites are still available on nucleic acid bases involved in secondary structures. However, the rational design of antisense sequences able to recognize the three dimensional array of these sites is not available. We used an in vitro selection procedure to fish out aptastrucs, i.e., oligomers able ("apte") to bind to a structure. A population of randomly synthesized oligonucleotides was mixed with the structure of interest and oligodeoxynucleotide sequences bound to the target were selected and amplified. The selection involves the destruction of the unbound candidates by a restriction enzyme. This procedure can be used both for RNA and DNA target structures and does not require the purification of the bound oligonucleotides at each cycle of selection. Several cycles of selection-amplification, followed by cloning and sequencing, allowed us to identify three oligonucleotides able to form a complex with a DNA hairpin. Due to the sequence of the selected candidates, these aptastruc-hairpin complexes involve very likely non-canonical interactions between the two partners.

DNA↗

PubMed2004

[Influence of antisense oligonucleotide targeting Chk1/2 on apoptosis of K562 cell induced by DDP].

In order to investigate the change of cell-cycle of K562 cells induced by cisplatin (DDP) and role of antisense oligonucleotide targeting Chk1/2 on apoptosis of K562 cell induced by DDP, the change of cell-cycle was observed by means of flow cytometry after different intervals in which the K562 cell were treated by DDP. Chk1/2 protein expression was investigated by Western blot and confocal microscopy in best condition of transfection of antisense oligonucleotide targeting Chk1/2 by lipofection. Apoptosis of K562 induced by DDP was investigated by flow cytometry after transfection of antisense oligonucleotide targeting Chk1/2. The results showed that K562 cells were arrested at S phase at 10 micromol/L of DDP. Transfection with antisense oligonucleotide targeting Chk1/2 could inhibit expression of Chk1/2 at different levels. The frequency of apoptosis induced by DDP was increased when transfected with antisense oligonucleotide targeting Chk1 and/or Chk2. The effect of antisense oligonucleotide targeting Chk1 and Chk2 synchronously exceeded that of antisense oligonucleotide targeting either Chk1 or Chk2 alone. In conclusion, Chk1 and Chk2 may be regarded as targets of therapy for leukemia.

Antineoplastic Agents↗

PubMedDate not supplied

Evidence of antisense tumor targeting in mice.

Even though increased accumulations of radiolabeled antisense DNAs compared to control DNAs are becoming a routine observation in cultured tumor cells, trustworthy evidence of tumor targeting in vivo by an antisense mechanism remains elusive. The goal of this study was to obtain convincing evidence of antisense tumor targeting in nude mice by using two different tumors and both intratumoral (i.t.) and intravenous (i.v.) administration of radiolabeled antisense and control sense DNAs. Both the MDR++ cell line KB-G2 and its parent MDR+ cell line KB-31 were used in this study. The antisense (AS) DNA was directed against the AUG start codon of the MDR1 mRNA and, along with the sense (S) control DNA, was a uniform phosphorothioate administered naked. In previous cell culture studies from our laboratories, the accumulation of this AS DNA was strikingly high in KB-G2 cells and only average in KB-31 cells, a fact we attribute to the 1000-fold higher expression by RT-PCR of MDR1 mRNA in the former cell line. In this study, both DNAs were radiolabeled with (99m)Tc via MAG3 and administered i.t. or i.v. at 1 microg (100 microCi) per animal 24 h prior to sacrifice and dissection in mice bearing thigh tumors of about 1 g. Following i.t. administration, no statistically significant differences (Student's t test, p < 0.05, N = 4) between the AS and S DNA biodistributions in normal tissues were observed except in the KB-G2 mice in which muscle levels were lower for the S control. In contrast, tumor levels in the KB-G2 animals were significantly higher for the AS DNA vs S DNA (14.7 vs 8.5% ID/g) while this difference (8.6 vs 4.3% ID/g) was insignificant in the KB-31 animals. The whole body images obtained just prior to sacrifice clearly show improved targeting of AS DNA vs S DNA in the KB-G2 but not the KB-31 animals. Calculations based on these results show that about 60 000 AS DNAs accumulated specifically (i.e. AS DNA - S DNA) per KB-G2 tumor cell following i.t. administration. When administered i.v. rather than i.t., higher tumor levels in KB-G2 animals compared to KB-31 were not observed, most likely because of the lower dosage reaching the tumors. When the KB-G2 and KB-31 results are combined, no statistically significant differences between the AS and S DNA biodistributions in normal tissues were observed except in blood in which S DNA levels were higher and in spleen in which they were lower. In contrast, tumor levels were significantly higher for the AS DNA vs S DNA (0.100 vs 0.063% ID/g). Calculations based on these results show that about 400 AS DNAs accumulated specifically per tumor cell following i.v. administration. Therefore evidence for tumor targeting in vivo by an antisense mechanism has been obtained in that statistically higher tumor accumulations of the (99m)Tc-AS DNA were observed compared to the control (99m)Tc-S DNA both following i.t. and i.v. administrations. The successful localization of AS DNA in tumor demonstrates that in vivo AS targeting of tumor is feasible although improvements in tumor delivery and normal tissue clearance are needed for practical antisense imaging.

Animals↗

PubMed2006

[Antisense oligonucleotide targeting endostatin enhances hematopoiesis reconstitution in BMT mice].

OBJECTIVE: To explore the effect of antisense oligonucleotide targeting endostatin (endostatin-ASON) transfecting bone marrow stromal cells ( BMSC) on hematopoiesis reconstitution in BMT mice. METHODS: Inhibition of endostatin / VCAM-1 protein and mRNA expression was investigated by transfection of antisense oligonucleotide targeting endostatin with confocal microscopy, Western blot and RT-PCR. Bone marrow stromal cells were cultured and divided into 4 groups: group (1) without any treatment; group (2) BMT only; group (3) BMT + endostatin-ASON transfection; group (4) BMT + endostatin scrambled sequence transfection. RESULTS: (1) Endostatin-ASON was successfully introduced into BMSC in vitro, and the transfecting rate was 86% ;(2) After Endostatin-ASON transfected into BMSC, the expression of Endostatin mRNA and its protein on the BMSC was signficantly inhibited at different time point after BMT [the grey value of Endostatin was (0.09 +/- 0.03) - (1.44 +/- 1.19) and (0.02 + 0.02) - (0.14 +/- 0.05), respectively] (P < 0.01 and P < 0.05); (3) Transfecting with Endostatin-ASON effectively promoted the expression of VCAM-1 mRNA and its protein on the BMSC [the gray value of VCAM-1 was (1.60 +/- 0. 92) - (8.05 +/- 0.87) and (0.07 +/- 0.02) - (0.67 +/- 0.09) , respectively] (P <0.01 and P <0.05) ; (4) There was no effects of transfecting Endostatin scrambled sequence on the expression of Endostatin and VCAM-1 on the BMSC (P > 0.05). CONCLUSION: Endostatin-ASON could inhibit Endostatin expression and enhance VCAM-1 expression in BMSC after syngeneic-BMT in mice, which might be one of the mechanisms underlying the endostatin-ASON accelerating hematopoiesis reconstitution after allogeneic-BMT.

Animals↗

PubMed1999

Homologous human and murine antisense oligonucleotides targeting stat6. Functional effects on germline cepsilon transcript.

Interleukin (IL)-4 and (IL)-13 induce immunoglobulin (Ig)E synthesis via activation of the transcription factor signal transducer and activator of transcription (Stat)6. The present study describes the identification and characterization of antisense oligonucleotides to Stat6 as an approach to interrupt IL-4 and IL-13 signaling and thereby to attenuate germline Cepsilon transcription, a prerequisite to IgE synthesis. A limited gene-walk was performed with chemically modified oligonucleotides to identify sequences capable of downregulating both human and murine Stat6. A chimeric oligonucleotide (9b, base sequence GTGAGGTCCTGTTCAGTGGG) demonstrated high levels of antisense activity in both species. Further characterization of 9b showed a dose-dependent Stat6 messenger RNA (mRNA) and protein downregulation (concentration that produces 50% inhibition of effect = 168 and 215 nM, respectively) through a ribonuclease H-dependent antisense mechanism with no effect on closely related members of the Stat family. Further, pretreatment of DND39 cells (human Burkitt lymphoma cell line) with oligonucleotide 9b before IL-4 stimulation successfully downregulated germline Cepsilon transcription. Because Stat6 represents an attractive but technically challenging drug discovery target, antisense oligonucleotides may provide an alternative approach to low molecular-weight compounds for inhibiting IL-4 and IL-13 signaling.

Animals↗

PubMed1995

Rational design of point mutation-selective antisense DNA targeted to codon 12 of Ha-ras mRNA in human cells.

Antisense oligodeoxynucleotides targeted to Ha-ras mRNA have been designed to discriminate between the codon 12-mutated oncogene and the normal proto-oncogene. An in vitro assay using two different sources of RNase H (rabbit reticulocyte lysates and nuclear extract from HeLa cells) was used to characterize oligonucleotide binding to normal and mutated Ha-ras mRNA. Short oligonucleotides (12- or 13mers) centered on the mutation had a very high discriminatory efficiency. Longer oligonucleotides (16mers) did not discriminate efficiently between the mutated and the normal mRNA. We have tested the efficacy of dodecanucleotides to induce RNase H cleavage of the full-length mRNA, moving the target sequence from the loop to the stem region which is formed in the vicinity of mutated codon 12. The most selective oligonucleotides were centered on the mutation which is located near the junction between the loop and stem regions even though they were less efficient at inducing RNase H cleavage than those targeted to the loop region. The 12mer antisense oligonucleotide with the highest discriminatory power was selected for cell culture studies. This oligonucleotide inhibited the proliferation of a human cell line which had been transformed with the mutated Ha-ras gene (HBL100ras1) but had no effect on the parental cell line which was transfected with the vector DNA (HBL 100neo) and expressed only the normal Ha-ras gene. Growth inhibition of HBL100ras1 cells was associated with specific ablation of targeted Ha-ras mRNA as shown by RT-PCR. These results show that 'in vitro' evaluation using an RNase H assay allowed us to select an antisense oligonucleotide which elicited a selectivity towards point-mutated Ha-ras mRNA when added at 10 microM concentration to the culture medium of cells expressing wild type and mutated Ha-ras mRNA.

Base Sequence↗

PubMed1994

Targeted nuclear antisense RNA mimics natural antisense-induced degradation of polyoma virus early RNA.

We describe a general antisense strategy to inhibit target gene expression. The substitution of a cis-acting ribozyme for a polyadenylylation signal in an antisense expression vector results in the nuclear retention of RNAs and the efficient degradation of their targets. We demonstrate the utility of this system in polyoma virus, where early-strand RNA levels are downregulated in the nucleus by antisense late-strand counterparts. We show that mutations destabilizing these naturally occurring antisense transcripts lead to increased levels of early-strand RNAs. Furthermore, expression in trans of nuclear antisense transcripts lowers early-strand RNA levels and quantitatively mimics the natural regulation.

3T3 Cells↗

PubMed2001

Real time kinetic studies of the interaction between folded antisense and target RNAs using surface plasmon resonance.

Antisense RNAs interact with their complementary target RNAs as folded structures. The formation of early binding intermediates is the most important step in determining the overall rates of stable complex formation in vitro and the efficiency of control in vivo. In the case of CopA and CopT (antisense/target RNA pair of plasmid R1), recent studies have identified a four-way junction structure as the major binding intermediate. Previously, the kinetics of antisense/target RNA interaction was studied by indirect methods. Here we have used surface plasmon resonance to follow the binding of CopI (a truncated variant of CopA) to CopT in real time. A protocol was developed that permitted the determination of association and dissociation rate constants for wild-type and mutant CopI-CopT pairs. The K(D)-values calculated from these rate constants were in good agreement with the results obtained by indirect methods. In comparison to earlier model studies of interactions between simple complementary nucleic acids, we observe a different temperature dependence for dissociation rate constants. This may be indicative of the complexity of the steps required for interacting folded RNAs; intramolecular structure competes with intermolecular helix progression during complex formation. The association rate constants were not significantly dependent on temperature. The analysis presented shows that the stability of a kissing complex is not the primary determinant of the rate of stable CopA/CopT complex formation.

Base Pairing↗

PubMed2005

Morpholino antisense oligomer targeting human midkine: its application for cancer therapy.

Overexpression of a heparin-binding growth factor, midkine (MK), has been observed in many malignancies, making it an attractive therapeutic target. We used morpholino antisense oligomers to downregulate human MK expression in human prostate (PC-3) and colon carcinoma (SW620) cells, and determined the practical advantages of this anticancer therapeutic. Morpholino antisense oligomers directed against MK caused a dramatic and sequence-specific decrease of the target protein level, resulting in the inhibition of growth and anchorage-independent growth of the transfected cells. Furthermore, MK morpholino antisense oligomers exhibited a significant anticancer effect in the PC-3- and SW620-xenograft models. In comparison with phosphorothioate-modified oligodeoxynucleotide, morpholino oligomers showed 2 major advantages, stability and non-toxicity. MALDI-TOF mass spectrometric analysis showed that morpholino antisense oligomers were completely stable in the presence of serum nuclease(s). Serological examinations demonstrated no toxicity of MK morpholino antisense oligomers. Our study indicates that inhibition of MK expression by morpholino antisense oligomer is a promising novel and safe therapeutic strategy for cancers.

Animals↗