SEARCH · PubMed Health

Results for “shared variables”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5Linked to original sources

PubMed1999

Bacterioplankton Community Diversity in a Series of Thermally Stratified Lakes.

> Abstract The dominant members of the bacterioplankton community in a set of 10 small, thermally stratified lakes in northeastern Indiana were determined by denaturing gradient gel electrophoresis (DGGE) of a polymerase chain reaction amplified fragment of 16S rDNA. The variability in community composition was analyzed as function of vertical stratification (epilimnion vs metalimnion), time (July vs August samples), and geographical location. In 58 discrete samples, a range of 8-23 bands were detected (mean = 14, s.d. = 4). For all variables, sample pairs shared about 40-70% of bands. In comparisons between depth strata, pairs of oxic samples shared more bands than an oxic-anoxic pair. There was no obvious relationship between the geographical location of lakes (or their physical connection) and band sharing.http://link.springer-ny.com/link/service/journals/00248/bibs/38n2p126.html

Journal Article↗

PubMed1985

Pharmacology of calcium antagonists.

Although the calcium antagonists verapamil, nifedipine, diltiazem and bepridil are structurally diverse, they share, to a variable extent, several pharmacologic properties. These effects are presumably the result of dose-related inhibition of transmembrane calcium ion flux through the slow channel. In diseased tissue, other routes of calcium entry may also be inhibited, and intracellular sites of action also are now strongly suspected. The calcium antagonists tend to relax vascular smooth muscle in a dose-dependent and site-specific manner. Effective coronary vasodilation is found with each agent; peripheral vasodilation is most pronounced with nifedipine, followed, in descending order of potency, by verapamil, diltiazem and bepridil. Atrioventricular conduction is also inhibited by diltiazem, bepridil and verapamil, whereas nifedipine paradoxically has no effect at therapeutic doses. The calcium antagonists also reduce muscle contractile force, but again in variable degrees. Negative inotropy is significant with verapamil and minimal with diltiazem and bepridil. Nifedipine often causes a reflex increase in contractility and heart rate. At therapeutic doses, bepridil has additional properties: it appears to affect sodium and perhaps potassium channels, producing a quinidine-like effect, and it prolongs the refractory period. Experimentally, bepridil has also been found to extend the duration of the action potential, raise the ventricular fibrillation threshold and possess both class I and class IV antiarrhythmic activity at relatively small doses. If documented clinically, bepridil may prove to be an effective antiarrhythmic as well as antianginal agent.

Action Potentials↗

PubMed1993

Reconstitution of protein kinase C alpha function by the protein kinase C beta-I carboxy terminus.

The Ca(2+)- and phospholipid-dependent Ser/Thr kinase protein kinase C (PKC) plays important roles in the transduction of cellular signals. Various PKC isoforms exist in mammalian cells which share conserved and variable regions as defined by cDNA sequence comparisons. To test whether carboxyl (C) terminal sequences of distinct isoforms can complement each other to yield functional chimeric molecules, we have constructed a PKC chimera in which amino acids 595-672 at the C-terminus of bovine PKC alpha (a) were replaced with the corresponding C-terminal amino acids (598-671) of rat PKC beta-I (b) to yield the chimera alpha/beta-I (ab). The chimera was then characterized biochemically and functionally, and compared with the parental isoforms. Since structure/function analysis of PKC in mammalian experimental systems is complicated by multiple PKC isoforms and by cellular complexity, we stably introduced the PKC constructs into the yeast Saccharomyces cerevisiae, a simple, lower eukaryote with a short doubling time and well established molecular genetics. In yeast, the faithfully expressed PKCab chimera and normal PKC isoforms bound radiolabelled phorbol ester and were recognized on immunoblots by PKC-specific antibodies. The chimera phosphorylated substrate peptides in a PMA- and Ca(2+)-dependent manner, and, upon activation, increased the cell doubling time and the rate of Ca2+ uptake into cells. In addition, PKCab displayed characteristics distinct from normal PKCb, but virtually indistinguishable from normal PKCa. Our findings indicate the reconstitution of PKCa function by the PKCb carboxyl terminus.

Animals↗

PubMed1999

Cross-cultural aspects of fears in African children and adolescents.

The purpose of this study was to compare level and type of fears in Nigerian and Kenyan children using the Fear Survey Schedule for Children, Revised (FSSC-R; [Ollendick, T.H. (1983). Reliability and validity of the Revised Fear Survey Schedule for Children (FSSC-R). Behaviour Research and Therapy, 21, 685-692]). A total of 852 males and females between the ages of 8 and 17 were surveyed. Results indicated that Nigerian children reported significantly higher total fear than Kenyan children and that scores from both countries were higher than those found in the United States, Australia and China. This suggests that the cultures of Kenya and Nigeria may share a common variable that makes reporting of fears greater than that reported by children of other world cultures. In addition, Christian children in both countries reported higher levels of fear on several factors than Muslim children, indicating that Islamic beliefs may encourage children to report less fear or to deal with their fears better than Christian beliefs. Finally, children between the ages of 8 and 12 reported greater fear of the unknown than children between 13 and 17 years of age. Overall, these findings suggest that important cultural, religious and age differences exist for levels of childhood fears reported in Nigeria and Kenya.

Adolescent↗

PubMed1996

A model for calculating the hospital costs for pediatric endoscopy.

BACKGROUND: Hospitals increasingly need, besides effectiveness data, accurate and reliable cost data to allocate their resources as efficiently as possible. In this article, a framework to calculate the hospital costs of setting up a new activity is presented and applied to pediatric endoscopy. METHODS: The cost calculations were based on a detailed registration of labor time, materials, space, and equipment needed to perform endoscopy in pediatric patients in a tertiary care hospital, the University Hospital in Leuven, Belgium. RESULTS: The initial investment expenses amount to 70,000 ECU ($91,000 in U.S. money), assuming that the facilities of the adult endoscopy unit can be shared. The additional variable cost for each procedure, including labor time and materials, varies between 100 and about 170 ECU ($130 and $221 U.S.), depending on the type of endoscopy (upper or lower, diagnostic or therapeutic). These basic data can be used to calculate the total costs for pediatric endoscopy under alternative scenarios (e.g., varying total number of procedures). CONCLUSIONS: The costing exercise has given the hospital better insights into the working procedures (and hence costs) of pediatric endoscopy. Other organizations will be able to apply this framework in their setting, since all included cost components, as well as volumes and unit prices, are reported separately.

Anesthesia Department, Hospital↗

PubMed1999

Mapping the specificity of an anti-feline immunodeficiency virus monoclonal antibody using a filamentous phage displayed peptide library.

Recent developments in peptide technology enable the use of random peptide libraries for identifying linear amino acid sequences (mimotopes) which can mimic conformational epitopes without necessarily exhibiting amino acid sequence homology with the native linear sequence. In this study a 15-mer random peptide library displayed on the surface of a filamentous phage has been used to characterise the conformational epitopes recognised by a monoclonal antibody raised against the envelope protein gp120 of feline immunodeficiency virus (FIV). Three mimotopes were identified that reacted with the selecting antibody in an immunoblot assay. Sequence analysis revealed that, whereas the three mimotopes had several amino acids in common, there was no significant homology with the primary amino acid sequence of gp120 although some amino acids were shared between the variable region (V3) and the three mimotopes. Petide mimtopes of complex retroviral glycoproteins may have potential uses as novel vaccines and for the serological diagnosis of FIV.

Amino Acid Sequence↗

PubMed1998

Relation of task switching to speed, age, and fluid intelligence.

Two studies were conducted to investigate whether a meaningful task-switching construct could be identified and, if so, to determine how it was related to measures of higher order cognition and to adult age. Both studies revealed that measures of task switching were moderately correlated across different combinations of tasks and that a switching construct could be distinguished from a construct reflecting processing speed. The results of the 2nd study revealed that although the task-switching construct was related to age and to measures of episodic memory, inductive reasoning, and spatial visualization, most of the relations between the switching construct and both age and other measures of cognition were shared with other variables.

Adolescent↗

PubMed1989

Immunoglobulin lambda light-chain-related genes 14.1 and 16.1 are expressed in pre-B cells and may encode the human immunoglobulin omega light-chain protein.

Human pre-B cells, which produce immunoglobulin heavy chain but do not produce immunoglobulin light chain, are shown to contain a 1-kilobase transcript homologous to immunoglobulin lambda light-chain genes. Detailed analysis of RNA and cDNA clones derived from these transcripts reveals that they originate from the distinct immunoglobulin lambda-like genes 14.1/16.1. Sequence analysis of these clones reveals a long open reading frame, beginning with an ATG, capable of encoding a protein of 214 amino acids with an unprocessed molecular weight of 22,944. The C-terminal half of this predicted protein is highly homologous to immunoglobulin lambda light-chain joining and constant region protein sequence, while the amino-terminal end does not share homology with variable regions. Unlike immunoglobulin genes, these genes do not undergo rearrangement prior to expression. Analysis of a panel of 26 hematopoietic cell lines reveals that expression of 14.1/16.1 is limited to pre-B cells and one B-cell line, which, like the pre-B cells, is surface immunoglobulin negative. Antisera raised against a peptide whose sequence was predicted from the 14.1 cDNA sequence identifies a 22-kDa protein in human pre-B cells. Immunoprecipitation of immunoglobulin mu-chain from these pre-B cells with anti-immunoglobulin mu antibody coprecipitates a 22-kDa protein, which is a candidate for the human immunoglobulin omega light-chain protein and may be the protein product of the 14.1/16.1 genes.

Amino Acid Sequence↗

PubMed1998

Alternative splicing of rearranged T cell receptor delta sequences to the constant region of the alpha locus.

The T cell receptor (TCR) alpha/delta locus is composed of a common, shared set of variable (V) and distinct diversity (D), joining (J), and constant (C) genes. It has been recognized for several years that transcripts of the rearranged VDJdelta or VJalpha genes are spliced to the Cdelta or Calpha genes, respectively, encoding distinct TCR delta and alpha proteins. Herein, we describe the discovery of a splicing variation that allows the assembled VDJdelta genes to be fused with the Calpha gene. This variation is prominent in TCRdelta gene-deficient mice but is also detectable in wild-type mice. Furthermore, we show that several in-frame VDJdelta rearrangements in TCRdelta gene-deficient mice are strikingly underrepresented, suggesting that the alternative transcripts, with protein coding capacity, influence the development of alphabeta thymocytes. In-frame TCRgamma gene rearrangements do not appear underrepresented, indicating that the effect is not mediated by the gamma chain. Instead, indirect evidence supports the hypothesis that the delta/alpha chimeric protein acts in conjunction with the TCRbeta chain. These results have implications for the transcriptional control of the TCRalpha/delta locus and provide a novel insight into the distinct functional capacities of the TCR alpha and delta proteins during thymocyte development.

Alternative Splicing↗

PubMed1989

Production of sterile transcripts of C gamma genes in an IgM-producing human neoplastic B cell line that switches to IgG-producing cells.

A human neoplastic B cell line SSK41 that expresses IgM on its surface switches spontaneously to IgG-producing cells. The SSK41 line contains a single immunoglobulin heavy-chain locus, the constant region (C) genes of which retain the germline configuration. The IgG-producing SSK41 line was purified by sorting, and shown to have undergone S-S recombination with deletion of the C mu gene. This line produced secretory and membrane-bound forms of gamma-chain mRNA. From cDNA libraries of a mixed population of IgM+/IgG+ SSK41 cells, we have isolated cDNA clones encoding the mature membrane-bound and secretory forms of the mu and gamma 1 heavy chains, all of which share the same variable region sequence. cDNA clones containing the mature gamma 3 chain were identified as well. We also isolated cDNA clones containing C gamma 1 and C gamma 3 sterile transcripts from the SSK41 line. These sterile transcripts contained additional exon sequences designated 'I' which were localized upstream of the C gamma 1 and C gamma 3 switch regions and homologous to murine counterparts. The I sequences were precisely spliced to the 5' ends of the corresponding C gamma exon sequences. These features of germline CH transcripts, i.e. the isotype specificity to class switching, location of exons, and sequences per se, are highly conserved between man and mouse.

Amino Acid Sequence↗

PubMed1984

Supply dependency of oxygen uptake in ARDS: myth or reality?

Several reports state that oxygen uptake changed in direct correlation with changes in total oxygen delivery to the tissues in the adult respiratory distress syndrome (ARDS). Oxygen uptake appeared to be limited by oxygen delivery even at normally adequate levels so that uptake was abnormally dependent on supply. These reports are discussed with respect to whether or not such a result could have been due to errors in measurement or to mathematical coupling by relating two quantities that shared a common variable. Having rejected that proposition, animal experiments are cited in which abnormal oxygen supply dependency was produced by microembolization. The accompanying loss of reactive hyperemia and inability to extract oxygen were consistent with a progressive loss of recruitable capillaries. Evidence is presented that the potential for embolization in ARDS is greatly enhanced by activation of the complement and arachidonic acid cascades as well as by the xanthine oxidase system. The resultant use of molecular oxygen by non-ATP producing oxidase systems might also account for the increase of supply dependent oxygen demand in ARDS.

Animals↗

PubMed1989

Substitution between prescribed and over-the-counter medications.

Using data from the Health Insurance Experiment (HIE), this article examines use of over-the-counter drugs (OTC) in a general, nonelderly population. Families from six areas of the country were assigned to health insurance plans that varied in the amount of medical care cost sharing. Thus, the out-of-pocket prices of OTC relative to prescription drugs were experimentally varied. The sites were chosen to represent markets with differing access to physician services. Multivariate methods were used to relate OTC use (collected from bi-weekly health diaries) to cost sharing and demographic variables. The empirical results do not support the expectation that people assigned less generous insurance for prescription drugs substitute OTC for prescriptions. People with complete insurance coverage purchased more of both types of drugs, suggesting OTC are an adjunct to formal medical care, rather than a substitute for it. Better educated and more knowledgeable consumers used more OTC drugs and spent more of their drug budget on OTC products. That there was greater OTC drug use in HIE sites with poorer access to formal medical care suggests there was some substitution between formal care and self-care with OTC drugs. Overall, however, better financial access to formal care promotes rather than substitutes for OTC use.

Adolescent↗

PubMed1990

Cross-reactive idiotypes in sera from patients with leprosy, lupus and Lyme disease and from healthy individuals.

Monoclonal IgM autoantibodies have previously been generated from a patient with lepromatous leprosy. Polyclonal anti-idiotypes raised against two of these monoclonal antibodies (8E7 and TH9) were used in an immunoassay to detect the presence of idiotype in human serum. The anti-idiotypes recognize different but overlapping sets of idiotypic determinants, some of which are present on antibodies which bind to Mycobacterium leprae. Sera were tested from 16 individuals with leprosy, 45 with systemic lupus erythematosus, 20 with Lyme disease, and 80 healthy subjects. Positive sera were detected in all groups (seven, two, three, and four, respectively). In most cases the serum bound to both anti-idiotypes, the idiotype being present in the IgM and/or IgG fraction. Levels of the two idiotypes varied independently of total serum IgG concentration and, in serial samples from one patient, independently of each other. The results indicate that 8E7 and TH9 may be representative of serum antibodies which are commonly expressed in leprosy, but may also be expressed in other diseases and in health; and they suggest that such serum antibodies are encoded by a widely shared set of variable region genes.

Cross Reactions↗

PubMed1995

Direct production of the Fab fragment derived from the sperm immobilizing antibody using polymerase chain reaction and cDNA expression vectors.

PROBLEM: Sperm immobilizing antibodies cause infertility mainly through complement dependent sperm immobilization. To analyze any effect of sperm immobilizing antibody on fertilization, we had already established cell lines that secrete IgM monoclonal antibody (MAb H6-3C4) and IgG monoclonal antibody (MAb EnBCMGS). The latter was a class-switched recombinant IgG antibody that shares the same variable region as MAb H6-3C4. The biological effects of the IgG antibody were also reported previously to eliminate sperm immobilizing or sperm agglutinating activities. However, the method of chemical digestion of IgG had some disadvantage to prepare the purified Fab fragment stably and in large quantities. This time we report a unique method to obtain the recombinant Fab fragments (Fab EnBCMGS) using polymerase chain reaction (PCR) and cDNA expression vectors. METHOD: Two kinds of PCR primers were designed to make a truncated heavy chain (Fd) gene of MAb EnBCMGS. The amplified Fd gene and light chain gene were ligated into cDNA expression vectors and then transfected into mammalian cells. RESULTS: Expression of the Fd gene and light chain gene were confirmed by Northern blotting. Secretion of the recombinant Fab fragment from mammalian cells was also confirmed by Western blotting. The Fab fragment showed biological activity as is expected by FACS analysis. CONCLUSION: This method enables the stable production of genuine Fab fragments of IgG in mammalian cells without any chemical treatment that may be time consuming and affect the quality of the Fab fragments.

Amino Acid Sequence↗

PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗

PubMed1994

Average case analysis of an Hebb-type rule that finds the network connectivity.

We describe an Hebb-type algorithm for learning unions of nonoverlapping perceptrons with binary weights. Two perceptrons are said to be nonoverlapping if they do not share any input variables. The learning algorithm is able to find both the network architecture and the weight values necessary to represent the target function. Moreover, the algorithm is local, homogeneous, and simple enough to be biologically plausible. We investigate the average behavior of this algorithm as a function of the size of the training set. We find that, as the size of the training set increases, the hypothesis network built by the algorithm "converges" to the target network, both in terms of the number of perceptrons and the connectivity. Moreover, the generalization rate converges exponentially to perfect generalization as a function of the number of training examples. The analytic expressions are in excellent agreement with the numerical simulations. To our knowledge, this is the first average case analysis of an algorithm that finds both the weight values and the network connectivity.

Algorithms↗

PubMed1992

Modification of oxygen extraction ratio by change in oxygen transport in septic shock.

To help clarify the oxygen uptake/transport (VO2/TO2) relationship and because the oxygen extraction ratio (OER) and TO2 share no common variable such as cardiac index, we examined the changes in OER when TO2 was decreased in 12 patients with sepsis in whom a PEEP trial was performed. From zero end-expiratory pressure (ZEEP) to PEEP (12 +/- 3 cm H2O), a significant increase in OER from 30 +/- 10 percent to 38 +/- 12 percent (p less than 0.005) was observed, and individual percentage changes in OER were well correlated with individual percentage changes in TO2. The VO2 measured (VO2m) by respiratory gas analysis was unchanged, while VO2 calculated by the Fick equation (VO2f) decreased, suggesting a mathematical coupling between VO2f and TO2. Patients with hyperlactacidemia (n = 5) exhibited the same relationships between OER, VO2m, and TO2 as those without hyperlactacidemia. Our results suggest an adaptive response in the OER when TO2 is decreased in patients with established septic shock.

Adult↗

PubMedDate not supplied

The syndrome of idiopathic CD4+ lymphocytopenia.

The syndrome of idiopathic CD4+ lymphocytopenia has recently been recognized and referred to as the persistent depletion of peripheral blood CD4+ T lymphocytes below 300 cells per cubic millimeter or less than 20% of total lymphocytes in the absence of either HIV infection or other known causes of immunodeficiency. The available literature indicates that neither human retroviruses (HIV-1, HIV-2, HTLV-I, HTLV-II) nor other transmissible agents play any clear-cut role in the pathogenesis. Furthermore, the epidemiologic, immunologic and clinical features of this syndrome differ substantially from those of HIV infection. The heterogeneity of both immunologic abnormalities, in addition to CD4+ depletion, and clinical course in patients with this disorder points out no common cause although in at least a subset of patients the pathogenetic pathways could be shared with common variable immunodeficiency.

Humans↗