PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “structural phylogenetics”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 91 records · Page 5Linked to original sources

The unusually long small subunit ribosomal RNA gene found in amitochondriate amoeboflagellate Pelomyxa palustris: its rRNA predicted secondary structure and phylogenetic implication.

In order to ascertain a phylogenetic position of the freshwater amitochondriate amoeboflagellate Pelomyxa palustris its small subunit (SSU) rRNA gene was amplified and sequenced. It was shown to be 3502 bp long. The predicted secondary structure of its rRNA includes at least 16 separate expansion zones located in all the variable regions (V1-V9), as well as in some conservative gene regions. Most insertions are represented by sequences of low complexity that have presumably arisen by a slippage mechanism. Relatively conservative, uniformly positioned motifs contained in regions V4 and V7, as well as in some others, made it possible to perform folding. In maximum likelihood, maximum parsimony, and neighbor-joining trees, P. palustris tends to cluster with amitochondriate and secondary lost mitochondria amoebae and amoeboflagellates Entamoeba, Endolimax nana, and Phreatamoeba balamuthi, comprising together with them and aerobic lobose amoebae Vannella, Acanthamoeba, Balamuthia, and Hartmannella a monophyletic cluster. Another pelobiont, Mastigamoeba invertens, does not belong to this cluster. No specific similarity was discovered between the SSU rRNA of P. palustris and amitochondriate taxa of 'Archezoa': Diplomonada, Parabasalia, Microsporidia. Pelomyxa palustris SSU rRNA does not occupy a basal position in the phylogenetic trees and could be ascribed to the so-called eukaryotic 'crown' group if the composition of the latter were not so sensitive to the methods of tree building. Thus, molecular and morphological data suggest that P. palustris represents a secondarily modified eukaryotic lineage.

Amoeba↗

Ric c 1 and Ric c 3, the allergenic 2S albumin storage proteins of Ricinus communis: complete primary structures and phylogenetic relationships.

The 2S albumin storage protein of Ricinus communis consists of the two heterodimeric proteins Ric c 1 and Ric c 3 each of which is composed of a small and a large subunit linked together by disulphide bridges. The complete primary structures of both heterodimeric proteins were determined by enzymatic degradation and automated Edman degradation. The sequences of all four chains correspond to the known cDNA sequence of the gene of a presumed precursor molecule and to the previously determined partial sequences for Ric c 1 and Ric c 3. In addition, few differences in amino acid positions were found which seem to be related to different varieties of R. communis. Sequence comparisons with 2S albumin from other plant genera revealed high degrees of homology and support the view of a common genetic origin of this protein family. Ric c 1 and Ric c 3 which have 11,212 and 12,032 daltons, respectively, share a similar molecular size, biological function and allergenicity with the 2S albumins from Brassica juncea (Braj 1E) and Sinapis alba L (Sin a 1). Ric c 1 and Ric c 3 may be classified as isoallergens if, additionally, the high degree of similarity in the position of polar residues is taken into account.

2S Albumins, Plant↗

A phylogenetic and structural analysis of truncated hemoglobins.

Truncated hemoglobins (trHbs) are heme proteins found in bacteria, plants, and unicellular eukaryotes. They are distantly related to vertebrate hemoglobins and are typically shorter than these by 20-40 residues. The multiple amino acid deletions, insertions, and replacements result in distinctive alterations of the canonical globin fold and a wide range of chemical properties. An early phylogenetic analysis categorized trHbs into three groups, I (trHbN), II (trHbO), and III (trHbP). Here, we revisit this analysis with 111 trHbs. We find that trHbs are orthologous within each group and paralogous across the groups. Group I globins form the most disparate set and separate into two divergent subgroups. Group II is comparatively homogeneous, whereas Group III displays the highest level of overall conservation. In Group I and Group II globins, for which some ligand binding and structural data are available, an improved description of probable protein-ligand interactions is achieved. Other conservation trends are either confirmed (essential glycines in loops), refined (lining of ligand access tunnel), or newly identified (helix start signal). The Group III globins, so far uncharacterized, exhibit recognizable heme cavity residues while lacking some of the residues thought to be important to the trHb fold. An analysis of the phylogenetic trees of each group provides a plausible scenario for the emergence of trHbs, by which the Group II trHb gene was the original gene, and the Group I trHb and Group III trHb genes were obtained via duplication and transfer events.

Amino Acid Sequence↗

Sequence, secondary structure and phylogenetic analyses of the ribosomal internal transcribed spacer 2 (ITS2) in the Timarcha leaf beetles (Coleoptera: Chrysomelidae).

Internal transcribed spacer 2 (ITS2) sequences of the nuclear rDNA in forty-seven specimens (thirty-four species) of the leaf beetle genus Timarcha have been studied. Timarcha ITS2 (523 bp on average) share some sequence features with other Chrysomeloidea relatives (Chrysolina, Diabrotica and Bruchus) but have no clear similarity with any other arthropod ITS2 sequences. Interspecific divergences are in the range 0.002-0.166, and 0.124-0.206 in the comparisons between subgenera. No evidence of intragenomic divergent ITS2 sequences has been found. Secondary structures are concordant with the four-domain model proposed for vertebrates and yeast, but differs from those proposed for dipterans. Phylogenetic analysis of the ITS2 data confirms the results of a previous study based on mitochondrial sequences, as the basality of the Metallotimarcha subgenus and the absence of phylogenetic support for the Timarchostoma subgenus.

Animals↗

DNA sequence, structure, and phylogenetic relationship of the small subunit rRNA coding region of mitochondrial DNA from Podospora anserina.

DNA sequence analysis and the localization of the 5' and 3' termini by S1 mapping have shown that the mitochondrial (mt) small subunit rRNA coding region from Podospora anserina is 1980 bp in length. The analogous coding region for mt rRNA is 1962 bp in maize, 1686 bp in Saccharomyces cerevisiae, and 956 bp in mammals, whereas its counterpart in Escherichia coli is 1542 bp. The P. anserina mt 16S-like rRNA is 400 bases longer than that from E. coli, but can be folded into a similar secondary structure. The additional bases appear to be clustered at specific locations, including extensions at the 5' and 3' termini. Comparison with secondary structure diagrams of 16S-like RNAs from several organisms allowed us to specify highly conserved and variable regions of this gene. Phylogenetic tree construction indicated that this gene is grouped with other mitochondrial genes, but most closely, as expected, with the fungal mitochondrial genes.

Ascomycota↗

Structural and phylogenetic analysis of the MHC class I-like Fc receptor gene.

The intestinal epithelium of neonatal mice and rats expresses an Fc receptor that mediates selective uptake of IgG in mothers' milk. This receptor (FcRn), which helps newborn animals to acquire passive immunity, is an MHC class I-like heterodimer made up of a heavy chain and beta 2-microglobulin. In the present study, we determined the genomic structure of a mouse gene (Fcrn) encoding the heavy chain of FcRn. The overall exon-intron organization of the Fcrn gene was similar to that of the MHC class I gene, thus providing structural evidence that Fcrn is a bona fide class I gene. The 5'-flanking region of the Fcrn gene contained the binding motifs for two cytokine-inducible transcription factors, NF-IL6 and NF1. However, regulatory elements found in MHC class I genes (enhancer A, enhancer B, and the IFN response element) were absent. Phylogenetic tree analysis suggested that, like the MICA, AZGP1, and CD1 genes, the Fcrn gene diverged from MHC class I genes after the emergence of amphibians but before the split of placental and marsupial mammals. Consistent with this result, Southern blot analysis with a mouse Fcrn cDNA probe detected cross-hybridizing bands in various mammalian species and chickens. Sequence analysis of the Fcrn gene isolated from eight mouse strains showed that the membrane-distal domain of FcRn has at least three amino acid variants. The fact that Fcrn is a single copy gene indicates that it is expressed in both the neonatal intestine and the fetal yolk sac.

Amino Acid Sequence↗

Extreme intraspecific mitochondrial DNA sequence divergence in Galaxias maculatus (Osteichthys: Galaxiidae), one of the world's most widespread freshwater fish.

Biogeographic controversies surrounding the widespread freshwater fish, Galaxias maculatus, were addressed with DNA sequence data. Mitochondrial cytochrome b and 16S rRNA sequences were obtained from representatives of six populations of this species. Substantial levels of cytochrome b (maximum 14.6%) and 16S rRNA sequence divergence (maximum 6.0%) were detected between western Pacific (Tasmania-New Zealand) and South American (Chile-Falkland Islands) haplotypes. A considerable level of divergence was also detected between Tasmanian and New Zealand haplotypes (maximum 5.1%) and within and among Chilean and Falkland Island G. maculatus (maximum 3. 8%). The phylogenetic structure of haplotypes conflicts with the accepted pattern of continental fragmentation. Molecular clock calibrations suggest that haplotype divergences postdate the fragmentation of Gondwana. These findings point to marine dispersal rather than ancient vicariance as an explanation for the wide distribution. The phylogenetic structure of South American haplotypes was not consistent with their geographic distribution. We consider factors such as population divergence, population size, dispersal, secondary contact, and philopatry as potential causes of the high level of mtDNA nucleotide diversity in this species.

Amino Acid Sequence↗

Identification, structure, and phylogenetic relationships of a mitogen-activated protein kinase homologue from the parasitic protist Entamoeba histolytica.

A gene encoding mitogen-activated protein kinase (MAPK) from the human enteric parasite, Entamoeba histolytica has been identified. Sequence analyses of the polymerase chain reaction (PCR) and reverse transcription PCR (RT-PCR) products reveal that the EhMAPK gene is intronless and encodes a protein of 352 amino acids. EhMAPK shows significant homology with other MAPKs and contains the 11 subdomains including the invariant residues characteristic of serine/threonine protein kinases. The MAPK signature residues and motifs are also present in EhMAPK. The atomic model of EhMAPK built with rat ERK2 as template exhibits the conservation of all major secondary structural features. However, a deletion in close proximity to the dual phosphorylation/activation site is of particular interest as it may have functional implications. Phylogenetic analysis indicates that EhMAPK is tightly clustered with Giardia intestinalis ERK2 and Dictyostelium discoideum ERK2. Detailed sequence analysis and phylogenetic study aided us to postulate that EhMAPK belongs to the extracellular signal-regulated kinase (ERK) family. Although EhMAPK bears good homology and phylogenetic closeness with human ERK8 and rat ERK7, sequence analysis indicates that they may be functionally different. The significant differences such as the deletions in the vicinity of the phosphorylation lip, variations in the P+1 specificity pocket, presence of additional acidic amino acids in the common docking domain provide a ground for postulations that activators and substrates for EhMAPK may be to some extent divergent from that of the ERKs of the mammalian host. Although functional characterization of EhMAPK remains to be done, this is the first study of any member of the MAPK signaling system in this organism.

Amino Acid Sequence↗

Phylogenetic and structural relationships of the PR5 gene family reveal an ancient multigene family conserved in plants and select animal taxa.

Pathogenesis-related group 5 (PR5) plant proteins include thaumatin, osmotin, and related proteins, many of which have antimicrobial activity. The recent discovery of PR5-like (PR5-L) sequences in nematodes and insects raises questions about their evolutionary relationships. Using complete plant genome data and discovery of multiple insect PR5-L sequences, phylogenetic comparisons among plants and animals were performed. All PR5/PR5-L protein sequences were mined from genome data of a member of each of two main angiosperm groups-the eudicots (Arabidoposis thaliana) and the monocots (Oryza sativa)-and from the Caenorhabditis nematode (C. elegans and C. briggsase). Insect PR5-L sequences were mined from EST databases and GenBank submissions from four insect orders: Coleoptera (Diaprepes abbreviatus and Biphyllus lunatus), Orthoptera (Schistocerca gregaria), Hymenoptera (Lysiphlebus testaceipes), and Hemiptera (Toxoptera citricida). Parsimony and Bayesian phylogenetic analyses showed that the PR5 family is paraphyletic in plants, likely arising from 10 genes in a common ancestor to monocots and eudicots. After evolutionary divergence of monocots and eudicots, PR5 genes increased asymmetrically among the 10 clades. Insects and nematodes contain multiple sequences (seven PR5-Ls in nematodes and at least three in some insects) all related to the same plant clade, with nematode and insect sequences separating as two clades. Protein structural homology modeling showed strong similarity among animal and plant PR5/PR5-Ls, with divergence only in surface-exposed loops. Sequence and structural conservation among PR5/PR5-Ls suggests an important and conserved role throughout the evolutionary divergence of the diverse organisms from which they reside.

Amino Acid Sequence↗

Sequence, proposed secondary structure, and phylogenetic analysis of the chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm.

The chloroplast 5S rRNA gene of the brown alga Pylaiella littoralis (L.) Kjellm has been cloned and sequenced. The gene is located 23 bp downstream from the 3' end of the 23S rRNA gene. The sequence of the gene is as follows: GGTCTTG GTGTTTAAAGGATAGTGGAACCACATTGAT CCATATCGAACTCAATGGTGAAACATTATT ACAGTAACAATACTTAAGGAGGAGTCCTTTGGGAAGATAGCTTATGCCTAAGAC. A secondary structure model is proposed, and compared to those for the chloroplast 5S rRNAs of spinach and the red alga Porphyra umbilicalis. Cladograms based on chloroplast and bacterial 5S rRNA and rRNA gene sequences were constructed using the MacClade program with a user-defined character transformation in which transitions and transversions were assigned unequal step values. The topology of the resulting cladogram indicates a polyphyletic origin for photosynthetic organelles.

Amino Acid Sequence↗

Structural and phylogenetic analysis of adenovirus hexons by use of high-resolution x-ray crystallographic, molecular modeling, and sequence-based methods.

A major impediment to the use of adenovirus as a gene therapy vector and for vaccine applications is the host immune response to adenovirus hexon-the major protein component of the icosahedral capsid. A solution may lie in novel vectors with modified or chimeric hexons designed to evade the immune response. To facilitate this approach, we have distinguished the portion of hexon that all serotypes have in common from the hypervariable regions that are responsible for capsid diversity and type-specific immunogenicity. The common hexon core-conserved because it forms the viral capsid-sets boundaries to the regions where modifications can be made to produce nonnative hexons. The core has been defined from the large and diverse set of known hexon sequences by an accurate alignment based on the newly refined crystal structures of human adenovirus types 2 (Ad2) and Ad5 hexon. Comparison of the two hexon models, which are the most accurate so far, reveals that over 90% of the residues in each have three-dimensional positions that closely match. Structures for more distant hexons were predicted by building molecular models of human Ad4, chimpanzee adenovirus (AdC68), and fowl adenovirus 1 (FAV1 or CELO). The five structures were then used to guide the alignment of the 40 full-length (>900 residues) hexon sequences in public databases. Distance- and parsimony-based phylogenetic trees are consistent and reveal evolutionary relationships between adenovirus types that parallel those of their animal hosts. The combination of crystallography, molecular modeling, and phylogenetic analysis defines a conserved molecular core that can serve as the armature for the directed design of novel hexons.

Adenoviruses, Human↗

A structural and phylogenetic analysis of the group IC1 introns in the order Bangiales (Rhodophyta).

Our previous study of the North American biogeography of Bangia revealed the presence of two introns inserted at positions 516 and 1506 in the nuclear-encoded SSU rRNA gene. We subsequently sequenced nuclear SSU rRNA in additional representatives of this genus and the sister genus Porphyra in order to examine the distribution, phylogeny, and structural characteristics of these group I introns. The lengths of these introns varied considerably, ranging from 467 to 997 nt for intron 516 and from 509 to 1,082 nt for intron 1506. The larger introns contained large insertions in the P2 domain of intron 516 and the P1 domain of intron 1506 that correspond to open reading frames (ORFs) with His-Cys box homing endonuclease motifs. These ORFs were found on the complementary strand of the 1506 intron in Porphyra fucicola and P. umbilicalis (HG), unlike the 516 intron in P. abbottae, P. kanakaensis, P. tenera (SK), Bangia fuscopurpurea (Helgoland), and B. fuscopurpurea (MA). Frameshifts were noted in the ORFs of the 516 introns in P. kanakaensis and B. fuscopurpurea (HL), and all ORFs terminated prematurely relative to the amino acid sequence for the homing endonuclease I-Ppo I. This raises the possibility that these sequences are pseudogenes. Phylogenies generated using sequences of both introns and the 18S rRNA gene were congruent, which indicated long-term immobility and vertical inheritance of the introns followed by subsequent loss in more derived lineages. The introns within the florideophyte species Hildenbrandia rubra (position 1506) were included to determine relationships with those in the Bangiales. The two sequences of intron 1506 analyzed in Hildenbrandia were positioned on a well-supported branch associated with members of the Bangiales, indicating possible common ancestry. Structural analysis of the intron sequences revealed a signature structural feature in the P5b domain of intron 516 that is unique to all Bangialean introns in this position and not seen in intron 1506 or other group IC1 introns.

Amino Acid Sequence↗

Metacommunity process rather than continental tectonic history better explains geographically structured phylogenies in legumes.

Penalized likelihood estimated ages of both densely sampled intracontinental and sparsely sampled transcontinental crown clades in the legume family show a mostly Quaternary to Neogene age distribution. The mode ages of the intracontinental crown clades range from 4-6 Myr ago, whereas those of the transcontinental crown clades range from 8-16 Myr ago. Both of these young age estimates are detected despite methodological approaches that bias results toward older ages. Hypotheses that resort to vicariance or continental history to explain continental disjunct distributions are dismissed because they require mostly Palaeogene and older tectonic events. An alternative explanation centring on dispersal that may well explain the geographical as well as the ecological phylogenetic structure of legume phylogenies is Hubbell's unified neutral theory of biodiversity and biogeography. This is the only dispersalist theory that encompasses evolutionary time and makes predictions about phylogenetic structure.

Demography↗

Dissimilatory sulfite reductase from Archaeoglobus profundus and Desulfotomaculum thermocisternum: phylogenetic and structural implications from gene sequences.

The genes encoding the alpha- and beta-subunits of dissimilatory sulfite reductase, dsrAB, from the hyperthermophilic archaeon Archaeoglobus profundus and the thermophilic gram-positive bacterium Desulfotomaculum thermocisternum were cloned and sequenced. The dsrAB genes are contiguous, and most probably comprise an operon also including a dsrD homolog, a conserved gene of unknown function located downstream of dsrAB in all four sulfate reducers so far sequenced. Sequence comparison confirms that dissimilatory sulfite reductase, Dsr, is a highly conserved enzyme. A phylogenetic analysis using the available Dsr sequences, including Dsr-like proteins from nonsulfate reducers, suggests a paralogous origin of the alpha- and beta-subunits. Furthermore, the Dsr from sulfate reducers forms a separate cluster, with Dsr from the bacterial sulfate reducers Desulfotomaculum thermocisternum and Desulfovibrio vulgaris branching together, next to Dsr from Archaeoglobus profundus and Archaeoglobus fulgidus. Based on an alignment with the assimilatory sulfite reductase from Escherichia coli, the amino acid residues involved in binding of sulfite, siroheme, and [Fe4S4]-clusters have been tentatively identified, which is consistent with the binding of two sirohemes and four [Fe4S4]-clusters per alpha2beta2 structure. The evolution of Dsr and the structural basis for the binding of substrate and cofactors are discussed.

Amino Acid Sequence↗

Structural and phylogenetic analysis of TRAS, telomeric repeat-specific non-LTR retrotransposon families in Lepidopteran insects.

TRAS1 is a non-LTR retrotransposon inserted specifically into the telomeric repeat (TTAGG)(n) in the silkworm, Bombyx mori. To characterize the evolutionary origin of TRAS-like elements, we identified seven TRAS families (TRAS3, TRAS4, TRAS5, TRAS6, TRASY, TRASZ, and TRASW) from B. mori and four elements from two Lepidoptera, Dictyoploca japonica (TRASDJ) and Samia cynthia ricini (TRASSC3, TRASSC4, and TRASSC9). More than 2,000 copies of various Bombyx TRAS elements accumulated within (TTAGG)(n) sequences as unusual but orderly tandem repeats. The 5' and 3' regions were highly conserved within each class of Bombyx TRAS elements without truncation. This suggests that distinct classes of TRAS have been maintained independently by retrotransposition into (TTAGG)(n). The phylogenetic tree of site-specific retroelements showed that nine TRAS families in Lepidoptera constitute a single phylogenetic group that is closely related to the R1 family that inserts specifically into arthropod 28S rDNA. The higher amino acid sequence identity from endonuclease (EN) to reverse transcriptase (RT) domains between TRAS groups (about 37%-70%) than among TRAS elements and R1Bm (about 25%-30%), may reflect the presence of some DNA structure responsible for their target specificity. Sequence comparison from EN to RT domains among non-LTR elements revealed several regions conserved only within TRAS elements. We found a highly conserved region that resembles the Myb-like DNA-binding structure, between the EN and RT domains. These regions may be involved in site-specific integration of TRAS elements into the (TTAGG)(n) telomeric repeats.

Amino Acid Sequence↗

The two manganese peroxidases Pr-MnP2 and Pr-MnP3 of Phlebia radiata, a lignin-degrading basidiomycete, are phylogenetically and structurally divergent.

Two new, at primary sequence and protein structure levels different, manganese peroxidase encoding genes from the white rot basidiomycete Phlebia radiata are described. Both genes are expressed in liquid cultures of P. radiata containing milled alder wood or glucose as carbon source, and high Mn(2+) concentration. The gene Pr-mnp2 contains 7 introns and codes for a 390 amino-acid polypeptide, whereas Pr-mnp3 presents 11 introns and codes for a 362 amino-acid protein. The 3-D molecular models confirm this diversity; the predicted Pr-MnP2 with a long C-terminal extension has the highest structural similarity with the crystal structure of Phanerochaete chrysosporium MnP1, whereas the shorter Pr-MnP3 protein is structurally more related to lignin peroxidases (P. chrysosporium LiPH8/H2). In Pr-MnP3, however, an alanine replaces the exposed tryptophan present in LiP and versatile peroxidases, and both Pr-MnPs include the conserved Mn(2+)-binding amino-acid ligands. This is the first occasion when two enzymes of similar function and origin fall into phylogenetically distinct subfamilies within the expanding dendrogram of the class II fungal secretory heme peroxidases.

Amino Acid Sequence↗

Rapoport effect in South American Carnivora (Mammalia): null models under geometric and phylogenetic constraints.

Rapoport effect predicts that species geographic range sizes will increase toward higher latitudes, probably reflecting adaptations to extreme climatic conditions that increase species tolerance. Recently, studies about spatial patterns in species richness and geographic range size may be associated with the geometry of species' ranges. In this context, null models can be used to search for the causal mechanisms associated with these patterns. In this paper, we analyzed Rapoport effect using a null model to evaluate how phylogenetic structure and geometric constraints simultaneously affect latitudinal extents of 40 species of South American terrestrial Carnivora. The latitudinal extents of Carnivora tended to decrease toward Southern latitudes, in the opposite direction expected under a simple Rapoport effect, but in accordance to geometric expectations of position of midpoints in the continent. Using 5000 simulations, it was possible to show that the null regression coefficients of latitudinal extents against midpoints are positively biased, reflecting the geometric constraints in the latitudinal extents. The results were equivalent in phylogenetic and non-phylogenetic analyses. The observed regression coefficient was significantly smaller (line is less inclined) than expected by chance alone, demonstrating that the geometric constraints in the latitudinal extents exist even after controlling for phylogenetic structure in data using eigenvector regressions. This suggests that the "spirit" of Rapoport effect (sensu Lyons & Willig, 1997) could be maintained, i.e., that latitudinal extents in Southern region of the continent are relatively larger than those in Northern regions, even after controlling for phylogenetic effects.

Adaptation, Physiological↗