SEARCH · PubMed Health

Results for “polymorphisms”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 901 records · Page 50Linked to original sources

PubMed2006

Polymorphism of beta-adrenergic receptors and susceptibility to open-angle glaucoma.

PURPOSE: The human trabecular meshwork and ciliary body, which express beta-adrenergic receptors (ADRB1 and ADRB2), control aqueous humor dynamics. We investigated associations of ADRB polymorphisms with open-angle glaucoma (OAG), because ADRB gene polymorphisms alter receptor function. METHODS: We studied 240 Japanese controls and 505 Japanese OAG patients including 211 with primary open-angle glaucoma (POAG), and 294 with normal-tension glaucoma (NTG). Associations of four polymorphisms (Ser49Gly and Arg389Gly in the ADRB1 gene; Arg16Gly and Gln27Glu in the ADRB2 gene) were compared between patients and controls. Age, intraocular pressure (IOP), and visual field defects at diagnosis were examined for associations with polymorphisms. RESULTS: The Arg389Gly polymorphism in the ADRB1 gene showed significantly different allele and genotype frequencies in patients with NTG than in controls (p = 0.004 and 0.006, respectively). Other polymorphisms did not show a significant frequency difference. In POAG patients, carriers of Gly16 in the ADRB2 gene were significantly younger at diagnosis than noncarriers (p<0.001). The IOP at diagnosis was significantly higher in OAG patients carrying 27Glu in the ADRB2 gene than in patients without this allele (p<0.001). Clinical characteristics of OAG patients did not differ significantly in relation to other polymorphisms. CONCLUSIONS: Certain polymorphisms of the ADRB1 and ADRB2 genes influence the pathophysiology of OAG in Japanese patients.

Aged↗

PubMed2006

[An associated analysis of estrogen receptor 2 gene polymorphism linked with intrahepatic cholestasis of pregnancy].

OBJECTIVE: To investigate the relation ship of estrogen receptor 2 gene (ESR2) polymorphism associated with intrahepatic cholestasis of pregnancy (ICP) in Chengdu of China. METHODS: By polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method, the Rsa I polymorphism in exon 5 and the Alu I polymorphism in exon 8 of ESR2 were detected in 100 pregnant women with ICP (ICP group) and 100 normal pregnant women (control group) in Chengdu. RESULTS: (1) The frequency of the allele A of Alu I polymorphism in exon 8 was significantly higher in ICP group than in control group (P=0.031, OR=1.975), so did the frequency of the Aa+AA genotypes (P=0.028, OR=2.144). (2) The genotype distributions (rr, Rr and RR) and allele frequencies (r and R) of Rsa I polymorphism in exon 5 were not significantly different between the two groups (P>0.05). CONCLUSION: The Alu I polymorphism in exon 8 of ESR2 may be associated with the susceptibility of ICP in Chengdu. The Aa+AA genotype significantly elevated the risk suffering from the ICP. The Rsa I polymorphism in exon 5 of ESR2 is not associated with the risk getting the ICP in Chengdu.

Cholestasis, Intrahepatic↗

PubMed2000

No association between a presenilin 1 polymorphism and Alzheimer disease.

BACKGROUND: Homozygosity of allele 1 of a presenilin 1 intron 8 polymorphism (PS1-1) has been associated with doubling of the risk of sporadic late-onset Alzheimer disease (LOAD), in some, but not all studies. OBJECTIVE: To genotype the PS1 intron 8 polymorphism in predominantly Hispanic families with LOAD to test for association and for linkage between this polymorphism and LOAD. DESIGN: A family-based, case-control, genetic-linkage study. SETTING: Predominantly Hispanic families were selected from probands who were part of a random sample of 2128 Medicare beneficiaries aged 65 years or older who were residing in the community of Washington Heights, which is located in the northern part of Manhattan, NY. PARTICIPANTS: Fifty-one families with 103 affected family members, 67 unaffected family members, and 7 family members with other diagnoses were genotyped for the PS1 polymorphism. All patients met National Institute of Neurological and Communicative Disorders and Stroke-Alzheimer's Disease and Related Disorders Association criteria for either probable or possible Alzheimer disease. Age was truncated at 55 years or older. MAIN OUTCOME MEASURES: Association analyses, conditional logistic regression, and traditional linkage methods were applied to the families for the PS1 polymorphism and for the presence of the gene for apolipoprotein E (APOE). Results of the association and conditional logistic regression analyses of PS1 intron 8 polymorphism were subsequently adjusted for the effect of APOE-epsilon4, sex, age, and education of each sibling. RESULTS: No association between the PS1 intron 8 polymorphism and LOAD was observed (relative risk, 0.99; 95% confidence interval, 0.3-3.4). An association between presence of the APOE-epsilon4 allele and LOAD (relative risk 4.05; 95% confidence interval, 1.3-12.5) was observed. CONCLUSION: We could not confirm the relationship between the PS1 intron 8 polymorphism and LOAD in this collection of families.

Aged↗

PubMed2004

Association of the serotonin transporter and receptor gene polymorphisms in neuropsychiatric symptoms in Alzheimer disease.

BACKGROUND: Serotonin has been linked to neuropsychiatric symptoms in Alzheimer disease, mainly agitation/aggression, depression, and psychosis. Neuropsychiatric symptoms have been associated with polymorphisms of the promoter region (5-HTTPR ) and intron 2 of the serotonin transporter gene (5-HTTVNTR) or the 5-HT2A and 5-HT2C receptor genes in some but not all studies. OBJECTIVE: To examine the association of the serotonin promoter, transporter, and receptor genes with neuropsychiatric symptoms in patients with Alzheimer disease. METHODS: The sample included 96 patients with Alzheimer disease from the outpatient clinic of the University of California Los Angeles Alzheimer's Disease Research Center, Los Angeles. The Neuropsychiatric Inventory was used to measure neuropsychiatric symptoms, and blood samples were available for genetic analysis. Based on the literature, we hypothesized that the 5-HT2A and 5-HT2C receptor polymorphisms would be associated with agitation/aggression and psychosis and the 5-HTTPR or 5-HTTVNTR polymorphisms, with agitation/aggression or depression and anxiety. One-way analyses of variance were performed with age, ethnicity, sex, or education as covariates. RESULTS: The 102T genotype of the 5-HT2A receptor was significantly associated with delusions (P =.045) and agitation/aggression (P =.002). We did not replicate previous associations of the 5-HT2C receptor polymorphism with psychosis or of the 5-HTTPR polymorphism with agitation/aggression, psychosis, or depression. We did not find any associations with the 5-HTTVNTR polymorphism and agitation/aggression, depression, or anxiety. CONCLUSIONS: The 5-HT2A receptor polymorphism may contribute to the expression of psychosis and agitation/aggression in patients with Alzheimer disease. Absence of other positive associations may be due to the relatively small sample size and/or potentially small effect size of the polymorphisms and requires further study.

Aged↗

PubMed2005

Presenilin 1 Glu318Gly polymorphism: interpret with caution.

BACKGROUND: The significance of the presenilin 1 (PSEN1) Glu318Gly polymorphism has been described as either a causal mutation with reduced penetrance or a benign polymorphism. When this polymorphism is found in a symptomatic person with a family history of dementia, counseling on recurrence risk becomes very problematic. OBJECTIVE: To demonstrate that the PSEN1 Glu318Gly polymorphism should be interpreted cautiously. DESIGN: Case histories of 2 patients with presenile dementia and family histories of dementia are described. The PSEN1 gene was sequenced in the patients and in 11 family members of patient 1. RESULTS: Two patients with presenile dementia and personality change were found to carry the PSEN1 Glu318Gly polymorphism. The presence of the polymorphism was confirmed in several family members of patient 1 but was absent in 1 symptomatic relative. CONCLUSIONS: The Glu318Gly polymorphism may be associated with risk for neurodegenerative disease; however, in the cases described here, it did not appear to be a risk factor. Until there is consensus on whether it is associated with disease, families should be informed that the clinical significance of the polymorphism is uncertain.

Alzheimer Disease↗

PubMed1999

Novel genetic polymorphisms in DNA repair genes: O(6)-methylguanine-DNA methyltransferase (MGMT) and N-methylpurine-DNA glycosylase (MPG) in lung cancer patients from Poland.

Individuals with a decreased DNA repair capacity are at increased cancer risk. The aim of our investigation was to detect genetic polymorphisms in DNA repair genes. Two genes, MPG and MGMT, involved in repair of alkylated purines, have been selected. The genetic polymorphisms in the coding exons 2, 3 and 4 of MPG and in the enhancer region of MGMT were searched for in DNA samples from a group of 33 non-small-cell lung cancer (NSCLC) patients from Poland. The PCR products were sequenced with fluorescently labeled terminators and separated on automatic sequencer. Two polymorphisms in MPG were found: in exon 2: CGC-->TGC, (8603C>T, Genbank Accession Z69720) and in exon 3: CCG-->CCA, (12235G>A, Genbank Accession Z69720). The polymorphism in exon 2 results in amino acid substitution (Arg>Cys). Three polymorphisms within or around 59 bp enhancer of MGMT were detected: 1) 1034A>G (Genbank Accession X61657), 2) 1099C>T (Genbank Accession X61657), 3) 79G>T (Genbank Accession U95038). Polymorphism 2 is located in the 59-bp enhancer sequence, within a palindrome GGTGCGCACC. Polymorphism 3 destroys an inverted repeat GGGTGGGGGGCCGCCCTGACCCCCACCC that contains two PuF binding sequences GGGTGGG separated by Sp1 site. The nature and location of these polymorphisms is consistent with the hypothesis that they may have functional significance.

Carcinoma, Non-Small-Cell Lung↗

PubMed2000

TNF-alpha gene polymorphism: clinical and biological implications.

TNF-alpha is a proinflammatory cytokine that has been implicated in the severity of different immune-regulated diseases including autoimmune diseases and transplantation. The gene for TNF-alpha is located within the MHC region on chromosome 6p21.3. This is a highly polymorphic region, and the TNF-alpha itself contains a large number of polymorphisms. Some of these polymorphisms form extended haplotypes with the HLA class I and II alleles. TNF polymorphisms have been investigated in different diseases and most often whenever there is an HLA association with the disease (for example IDDM and RA) association(s) with TNF polymorphisms has been described. There are many studies on the function of the TNF polymorphisms showing the influence of the different alleles on the in vitro and in vivo levels of TNF production. However, recent studies in animal models suggest that not only polymorphisms within the TNF cluster are important in the regulation of TNF production but also the receptors as well (TNF R). This suggests that investigating polymorphisms within the TNF cluster and TNF receptors will be important in understanding the role of TNF regulation in a given disease.

Animals↗

PubMed2000

Extensive association analysis between the CETP gene and coronary heart disease phenotypes reveals several putative functional polymorphisms and gene-environment interaction.

An extensive association analysis of a candidate gene for coronary heart disease, Cholesteryl Ester Transfer Protein (CETP) gene, was performed. Ten polymorphisms, out of which three were newly identified in regulatory regions, were investigated for association with myocardial infarction (MI) and 2 MI endophenotypes (CETP mass and HDL-cholesterol level) in 568 MI patients and 668 controls. The polymorphisms affecting codon 405 (Ile(405)Val) and the nucleotide 524 downstream from the stop codon (G(+524)T) were almost completely concordant and associated with plasma CETP mass (P < 0.001). The polymorphisms -629 (located in promoter), intron1 (Taq1B) and intron7 were almost completely concordant and associated with plasma CETP mass (P < 0.0001) and HDL-cholesterol levels (P < 0.0001). This latter association was not found in teetotalers and increased with the quantity of alcohol consumed. Heavy drinkers (>75g/day) homozygous for the (-628)A allele had a reduced risk of MI (OR = 0. 33, P < 0.02). Subjects both homozygous for (451)Arg and heterozygous for (373)Pro had decreased plasma HDL-cholesterol levels and this effect increased with alcohol consumption. The results illustrate the complexity of polymorphism-phenotype associations. They suggest that the CETP gene may carry several functional polymorphisms. Observed interactions between alcohol consumption and polymorphisms associated with HDL-cholesterol level constitute concrete examples of gene-environment interactions. Furthermore, the pattern of association between HDL-cholesterol levels and the polymorphisms at codons 373 and 451 illustrated how two polymorphisms may be confounders (in the usual epidemiological sense) one for the other: their marginal effects are neutralized because of linkage disequilibrium and thus are not detectable by standard univariate association analysis.

Adult↗

PubMed2007

Platelet functional implications of glycoprotein Ibalpha polymorphisms in African Americans.

The platelet glycoprotein Ibalpha is crucial in the binding of platelets to Von Willebrand Factor within areas of high stress. A single nucleotide polymorphism of GP Ibalpha gives rise to the Ko(a) (HPA-2b) and the -5C Kozak polymorphism. The presence of these polymorphisms has been associated with an increased risk for atherothrombotic disease. The Ko(a) polymorphism has been shown to have a higher prevalence in African Americans compared to American Caucasians. However, very little is known regarding any functional consequences of these platelet polymorphisms in African Americans. We assessed the prevalence of the Ko and -5C Kozak polymorphisms in a population of both African American and American Caucasian patients with and without CAD and determined whether there were platelet functional consequences in both groups. We studied 99 patients of which 22 were African American and 77 were American Caucasian. Aggregations were performed and shear induced platelet plug formation was tested using a platelet function analyzer. The HPA-2b allele was significantly higher in African Americans when compared to Caucasians (P = 0.001). Genotype frequencies of the -5C Kozak polymorphism were not significantly different between the two groups. We found no differences in platelet aggregation in African Americans who were either heterozygous or homozygous for the HPA-2b allele or the -5C Kozak allele when compared to American Caucasians of the same category. We found no significant differences in PFA-100 testing. We conclude from our study that these polymorphisms do not lead to altered platelet function in African Americans.

Black or African American↗

PubMed2001

Common polymorphisms in LRP and A2M do not affect genetic risk for Alzheimer disease in Northern Ireland.

Genetic variation in one of the major APOE receptors in the brain has been associated with increased risk for Alzheimer disease (AD). A C/T polymorphism in exon 3 and a tetranucleotide repeat polymorphism in the 5' region of the low-density lipoprotein receptor-related protein gene have been reported to increase risk in some studies but these reports have not been universally replicated. In addition, genetic variation in another ligand of LRP, alpha-2 macroglobulin (A2M), has also been associated with increased AD risk. However, these reports also remain controversial. We have genotyped both LRP polymorphisms and two polymorphisms in the A2M gene in a large group of clinically well-defined AD cases and controls from the relatively genetically homogeneous Northern Ireland population. Comparison of genotype and allele frequencies for polymorphisms in LRP revealed no significant differences between cases and controls. Multiple logistic regression analysis performed to assess any possible interaction between LRP and APOE revealed little evidence for genetic interaction despite the obvious biological interaction. Genotype and allele comparisons between the groups for the A2M polymorphisms also gave no evidence that either polymorphism increased risk for disease. The results from this study indicate that polymorphisms in LRP and A2M are not associated with increased risk for AD in Northern Ireland.

Aged↗

PubMed2006

Gene for the serotonin transporter and ADHD: no association with two functional polymorphisms.

Evidence from both human and animal studies implicates the serotonergic system in the development of attention-deficit hyperactivity disorder (ADHD) including positive association studies for several key serotonergic genes. The serotonin transporter (HTT) regulates the availability of serotonin by reuptake of the neurotransmitter from the synaptic cleft. Several studies have reported an association of this gene to ADHD, specifically the long variant of a common insertion/deletion polymorphism located in the promoter of this gene that results in increased transcription and higher HTT expression. An additional study found no evidence for an association with this polymorphism. Recently, an A/G single nucleotide polymorphism (SNP) was found within the promoter polymorphism with functional studies indicating that the long variant containing the G allele at this site behaves like the short variant. This previously unidentified functional change may have confounded earlier association studies. We investigated the relationship of several variants to ADHD: the promoter polymorphisms, SNP in the 3' untranslated region (3'UTR) with a reported association to ADHD and a rare, non-synonymous coding SNP. These polymorphisms were genotyped in 209 ADHD families identified through an affected proband. We did not find evidence for an association of these polymorphisms, or haplotypes of these polymorphisms, to ADHD in this sample.

Adolescent↗

PubMed2002

Fcgamma receptor gene polymorphisms in Japanese patients with systemic lupus erythematosus: contribution of FCGR2B to genetic susceptibility.

OBJECTIVE: Human low-affinity Fcgamma receptors (FcgammaR) constitute a clustered gene family located on chromosome 1q23, that consists of FcgammaRIIA, IIB, IIC, IIIA, and IIIB genes. FcgammaRIIB is unique in its ability to transmit inhibitory signals, and recent animal studies demonstrated a role for FcgammaRIIB deficiency in the development of autoimmunity. Genetic variants of FcgammaRIIA, IIIA, and IIIB and their association with systemic lupus erythematosus (SLE) have been extensively studied in various populations, but the results were inconsistent. To examine the possibility that another susceptibility gene of primary significance exists within the FcgammaR region, we screened for polymorphisms of the human FCGR2B gene, and examined whether these polymorphisms are associated with SLE. METHODS: Variation screening of FCGR2B was performed by direct sequencing and polymerase chain reaction (PCR)-single-strand conformation polymorphism methods using complementary DNA samples. Genotyping of the detected polymorphism was done using genomic DNA, with a specific genotyping system based on nested PCR and hybridization probing. Association with SLE was analyzed in 193 Japanese patients with SLE and 303 healthy individuals. In addition, the same groups of patients and controls were genotyped for the previously known polymorphisms of FCGR2A, FCGR3A, and FCGR3B. RESULTS: We detected a single-nucleotide polymorphism in FCGR2B, (c.695T>C), coding for a nonsynonymous substitution, Ile232Thr (I232T), within the transmembrane domain. The frequency of the 232T/T genotype was significantly increased in SLE patients compared with healthy individuals. When the same patients and controls were also genotyped for FCGR2A-131R/H, FCGR3A-176V/F, and FCGR3B-NA1/2 polymorphisms, FCGR3A-176F/F showed significant association. Two-locus analyses suggested that both FCGR2B and FCGR3A may contribute to SLE susceptibility, while the previously reported association of FCGR3B was considered to be secondary and derived from strong linkage disequilibrium with FCGR2B. CONCLUSION: These results demonstrate the association of a new polymorphism of FCGR2B (I232T) with susceptibility to SLE in the Japanese.

Adolescent↗

PubMed2005

Polymorphisms in DNA repair genes and epithelial ovarian cancer risk.

DNA repair gene polymorphisms and mutations are known to influence cancer risk. We studied whether polymorphisms in DNA double strand break (DSB) repair genes are associated with epithelial ovarian cancer (EOC) risk. Up to 1,600 cases and 4,241 controls from 4 separate genetic association studies from 3 countries were genotyped for 13 single nucleotide polymorphisms (SNP) in 6 genes (BRCA1, NBS1, RAD51, RAD52, XRCC2 and XRCC3) involved in homologous recombination of DNA double strand breaks. Genotype specific risks were estimated as odds ratios (OR) by unconditional logistic regression. No association was detected between EOC risk and BRCA1 Q356R, BRCA1 P871L, RAD51 g135c, RAD51 g172t, RAD52 c2259t, NBS1 L34L, NBS1 E185Q, NBS1 A399A, NBS1 P672P, XRCC2 g4324c, XRCC2 c41657t and XRCC3 T241M. The XRCC2 R188H polymorphism was associated with a modest reduction in EOC risk: OR for heterozygotes was 0.8 (95% confidence interval [CI] = 0.7-1.0) and for rare homozygotes 0.3 (0.1-0.9). The XRCC3 a4541g polymorphism, situated in the 5'UTR, and the intronic XRCC3 a17893g polymorphism were not associated with EOC risk in general, but when the serous EOC subset only was analysed, the OR for heterozygotes for a4541g was 1.0 (0.9-1.2) and for the rare homozygotes 0.5 (0.3-0.9). For the XRCC3 a17893g polymorphism, the OR for the heterozygotes and the rare homozygotes were 0.8 (0.7-0.9) and 0.9 (0.7-1.2), respectively. In our study, some polymorphisms in XRCC2 and XRCC3 genes were associated with EOC risk. Further research on the role of these genes on epithelial ovarian cancer is warranted.

Adult↗

PubMed2006

The thymidylate synthase tandem repeat promoter polymorphism: A predictor for tumor-related survival in neoadjuvant treated locally advanced gastric cancer.

We evaluated DNA polymorphisms in the thymidylate synthase (TS) and 5,10-methylene-tetrahydrofolate reductase (MTHFR) genes for an association with response and survival in locally advanced gastric cancer treated with 5-FU based preoperative chemotherapy (CTx). DNA of 238 patients (CTx-group: total n = 135, completely resected (R0) n = 102; without CTx: R0 n = 103) was isolated from blood or from nontumorous tissues. In the CTx-group, genotyping of the tandem repeat and the G/C polymorphism in the triple repeat in the promoter region of the TS gene and of the C677T polymorphism of the MTHFR gene was performed. None of the TS or MTHFR genotypes were associated with histopathological response and only the TS tandem repeat polymorphism was significantly related to survival (all patients n = 135, p = 0.002; R0 resected patients n = 102, p = 0.007; log-rank test). Multivariate analysis revealed ypN (p < 0.001) and the TS tandem repeat polymorphism as independent prognostic factors in the CTx-R0-group (p = 0.003). Analyzing the prognostic significance of the TS polymorphisms in the R0-group without CTx, TS genotypes were not significantly associated with survival. Comparing survival between R0 patients with and without CTx in the respective TS genotype groups of the tandem repeat polymorphism, a significant survival benefit for the patients with CTx was found for the 2rpt/2rpt (n = 49; p = 0.002) and 2rpt/3rpt genotypes (n = 99; p = 0.004), but not for the 3rpt/3rpt genotype (n = 57; p = 0.93). Patients' survival after CTx was associated with the TS tandem repeat polymorphism. CTx did not improve survival of patients with the 3rpt/3rpt genotype. Thus, a different therapy might be more appropriate for these patients.

Adult↗

PubMed2000

Identification of polymorphisms within the vascular endothelial growth factor (VEGF) gene: correlation with variation in VEGF protein production.

Dysregulated vascular endothelial growth factor (VEGF) expression has been implicated as a major contributor to the development of a number of common disease pathologies. The aim of this study was to establish the extent of genetic variability within the VEGF gene and to determine whether this genetic variation influenced levels of VEGF protein expression. The promoter region and exon 1 of the VEGF gene were screened for polymorphisms using single-stranded conformation (SSCP) polymorphism analysis and direct PCR-sequencing. We identified 15 novel sequence polymorphisms most of which were rare. Eleven of these polymorphisms were single base substitutions, three were single base insertions and one was a two base deletion. Thirteen of the polymorphisms were located within the promoter and two in the 5' untranslated region (5'UTR) of the gene. We established PCR-RFLP typing systems for ten of the polymorphisms. For the two common polymorphisms at -460 and +405, we developed a combined sequence specific priming (SSP) PCR typing system to determine the cis/trans orientation of each allele and hence, ascertain haplotypes. A significant correlation was observed between lipopolysaccharide (LPS) stimulated peripheral blood mononuclear cell (PBMC) VEGF protein production and genotype for the +405 polymorphism.

5' Untranslated Regions↗

PubMed2000

Balance of fitnesses maintaining polymorphisms in two-locus genetic systems.

Maintenance of a stable two-locus polymorphism is analyzed statistically by fitting a logistic regression with a quadratic function of genotypic fitnesses to the probability for a fitness set to maintain a polymorphism. The regression is fitted using a data set containing information on stable equilibria maintained by 32,00 randomly generated fitness sets with three recombination values (0. 005, 0.05, 0.5). Fitted logistic regressions discriminate with 88 to 90% accuracy between fitness sets maintaining and not maintaining a stable internal equilibrium, which implies the existence of a fitness structure (balance of fitnesses) maintaining a two-locus polymorphism. Aspects of the balance of fitnesses revealed by logistic regressions are discussed. It is demonstrated that logistic regression also discriminates between types of a stable polymorphism: globally stable polymorphism, several simultaneously stable polymorphisms, and stable equilibria in addition to a polymorphic one, which implies that different balances of fitnesses are responsible for the maintenance of different types of polymorphism.

Alleles↗

PubMed2004

Cholecystokinin- and cholecystokinin-B-receptor gene polymorphisms in panic disorder.

Panic disorder like other neuropsychiatric disorders is believed to be caused by multiple psychosocial and biological factors. Several lines of evidence point to a role for the peptide neurotransmitter cholecystokinin in the pathogenesis of panic disorder. We therefore determined the allele and genotype frequencies of a single nucleotide polymorphism in the CCK gene (-36C>T) and one CT repeat polymorphism in the CCK-B-receptor gene in a German panic disorder sample (n = 115 for CCK gene polymorphism, n = 111 for CCK-B-receptor polymorphism) and compared them with gender and age matched controls. The length of the polymorphic CT repeat alleles varies between 146 bp and 180 bp. We first analysed the results by a permutation test which provided evidence for heterogeneity between patients and controls (p=0.002). We then analysed the data as a di-allelic polymorphism with a short (146-162bp) and a long (164-180bp) allele and as a tetra-allelic polymorphism with 4 alleles (146-154bp, 156-162bp, 164-170bp, 172-180bp). In the di-allelic analysis as well as in the tetra-allelic analysis there was an excess of the longer allele (p = 0.001) or the two longer alleles (p = 0.041) respectively in patients with panic disorder. No difference between groups was observed for the -36C > T polymorphism. Our findings are consistent with the notion that genetic variation in the CCK neurotransmitter system contributes to the pathogenesis of panic disorder.

Adult↗

PubMed1994

Polymorphism detection and sequence analysis of human T-cell receptor V alpha-chain-encoding gene segments.

The T-cell receptor (Tcr) provides specificity for antigen recognition by its variable domain, primarily consisting of two germline encoded variable (V) region gene segments. Thus it has been suggested that inherited polymorphisms in the TCRV gene segments could contribute to differential immune responsiveness (e.g., autoimmunity) in human populations. In the present study, we have sought potentially functional polymorphisms in the germline TCRAV gene segments. Using denaturing gradient gel electrophoresis on polymerase chain reaction (PCR)-amplified products from the pooled DNA of many individuals, we identified polymorphisms in the TCRAV2S1, AV4S1, AV7S1, and AV8S1 gene segments. A complete DNA sequence analysis of these PCR products identified polymorphisms that affected amino acids in the predicted antigen-binding regions of the Tcr alpha chain, as well as polymorphisms in the introns. Genotype analysis of all nine DNA point mutations showed a 5%-50% range (averaging 35%) of minor allele frequencies, often resulting in individuals homozygous for the alternate allele forms. All possible haplotype combinations of the amino acid-affecting polymorphisms were found, indicating that in human populations there are a large number of different germline haplotypes encoding V gene segment alleles. These TCRAV coding region polymorphisms provide the rationale for, and allow the direct testing of, hypotheses concerning inherited polymorphisms within the T-cell receptor genes that may contribute to autoimmune susceptibility.

Base Sequence↗