SEARCH · PubMed Health

Results for “ANAPLASMA”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 937 records · Page 52Linked to original sources

PubMed2005

Oligo-chip based detection of tick-borne bacteria.

We have developed an oligonucleotide-chip based assay for detection of 16S ribosomal PCR products from tick-borne bacteria. This chip contains 14 specific probes, which target variable regions of 16S rDNA of tick-borne bacteria including Borrellia spp., Rickettsia spp., Anaplasma spp., Coxiella burnetii and Francisella tularensis. The specificity of these probes was tested by hybridization of the chip with fluorescently labeled PCR products amplified from the genomic DNA of selected tick-borne bacteria. The assay was also tested for detection of tick-borne bacteria in single ticks.

Anaplasma↗

PubMed2006

Human granulocytic anaplasmosis in Austria: epidemiological, clinical, and laboratory findings in five consecutive patients from Tyrol, Austria.

We report five consecutive cases of Anaplasma (A.) phagocytophilum infection (the causative agent of human granulocytic anaplasmosis (HGA)) from western Austria. All infections were acquired between June and August in 2003 and 2004 in the Inn valley (Tyrol, Austria). Four patients required hospitalisation, one patient was treated as an outpatient. During the acute stage of illness, laboratory findings included thrombocytopenia (5/5), elevated C-reactive protein (5/5), elevated neopterin (5/5), elevated lactate dehydrogenase (4/5), and elevation of liver enzymes (4/5). Leukopenia (3/5) and elevated procalcitonin (2/5) were less frequently observed. All patients were treated with tetracyclines, which led to prompt improvement of the clinical conditions. Anti-platelet antibodies were observed in one of four patients, but remained unchanged after complete covalescence.

Adult↗

PubMed2006

Serological evidence for tick-borne encephalitis, borreliosis, and human granulocytic anaplasmosis in Mongolia.

Five hundred and forty-five serum samples from donors from various parts of Mongolia were investigated for antibodies against the tick-borne encephalitis (TBE) virus, Borrelia burgdorferi, and Anaplasma phagocytophilum. Seroprevalence against TBE was 5.1% in the province of Selenge and 0.9% in Bulgan province, seroprevalence against B. burgdorferi was 1.9% in Selenge province and Bulgan province, 13.9% in Dornogov province, and 3.0% in Tov province and Ulaanbaatar. Seroprevalence against A. phagocytophilum was 2.3% in Selenge province, 5.6% in Bulgan province, 2.8% in Dornogov province, and 3.0% in Tov province and Ulaanbaatar. We conclude that all three pathogens are endemic in Mongolia.

Anaplasma phagocytophilum↗

PubMed2005

Spatial and management factors associated with exposure of smallholder dairy cattle in Tanzania to tick-borne pathogens.

A cross-sectional study of serum antibody responses of cattle to tick-borne pathogens (Theileria parva, Theileria mutans,Anaplasma marginale, Babesia bigemina and Babesia bovis) was conducted on smallholder dairy farms in Tanga and Iringa Regions of Tanzania. Seroprevalence was highest for T. parva (48% in Iringa and 23% in Tanga) and B. bigemina (43% in Iringa and 27% in Tanga) and lowest for B. bovis (12% in Iringa and 6% in Tanga). We use spatial and non-spatial models, fitted using classical and Bayesian methods, to explore risk factors associated with seroprevalence. These include both fixed effects (age, grazing history and breeding status) and random effects (farm and local spatial effects). In both regions, seroprevalence for all tick-borne pathogens increased significantly with age. Animals pasture grazed in the 3 months prior to the start of the sampling period were significantly more likely to be seropositive for Theileria spp. and Babesia spp. Pasture grazed animals were more likely to be seropositive than zero-grazed animals for A. marginale, but the relationship was weaker than that observed for the other four pathogens. This study did not detect any significant differences in seroprevalence associated with other management-related variables, including the method or frequency of acaricide application. After adjusting for age, there was weak evidence of localised (<5 km) spatial correlation in exposure to some of the tick borne diseases. However, this was small compared with the 'farm-effect', suggesting that risk factors specific to the farm were more important than those common to the local neighbourhood. Many animals were seropositive for more than one pathogen and the correlation between exposure to the different pathogens remained after adjusting for the identified risk factors. Identifying the determinants of exposure to multiple tick-borne pathogens and characterizing local variation in risk will assist in the development of more effective control strategies for smallholder dairy farms.

Anaplasma marginale↗

PubMed2006

Prevalence of selected infectious disease agents in cats from Arizona.

The objective of this study was to use polymerase chain reaction (PCR) assays to determine the prevalence of Ehrlichia species, Anaplasma phagocytophilum, Mycoplasma haemofelis, 'Candidatus Mycoplasma haemominutum' and Bartonella species from feral and relinquished cats in Phoenix and Nogales, Arizona. DNA from one or more of the organisms was amplified from 31 of 112 blood samples (27.7%). DNA consistent with Bartonella clarridgeiae 15 (13.4%), Bartonella henselae 14 (12.5%), 'Candidatus M haemominutum' 9 (8.0%), and M haemofelis 5 (4.5%) were detected. DNA of Ehrlichia species, Neorickettsia risticii, or A phagocytophilum was not amplified. Failure to amplify DNA of A phagocytophilum may relate to the absence of appropriate tick vectors. Failure to amplify Ehrlichia species DNA suggests that cats were not exposed, exposed but not infected, or infected but the DNA was not detected by the PCR assay used in this study. The Bartonella species and hemoplasma results suggest flea control should be maintained.

Anaplasma phagocytophilum↗

PubMed2006

Ehrlichia subversion of host innate responses.

Anaplasma (formerly Ehrlichia) phagocytophilum and Ehrlichia chaffeensis, upon infection of humans, replicate in host leukocyte granulocytes and monocytes/macrophages, respectively. These unusual Gram-negative bacteria lack genes for biosynthesis of the lipopolysaccharide and peptidoglycan that activate host leukocytes. Caveolae-mediated endocytosis directs A. phagocytophilum and E. chaffeensis to an intracellular compartment secluded from oxygen-dependent and -independent killing. Furthermore, these bacteria orchestrate a remarkable series of events that culminate in suppression of NADPH oxidase, phagocyte activation and differentiation pathways, apoptosis, and interferon-gamma signaling in host leukocytes. They offer a fascinating example of how pathogens employ intricate strategies to usurp and subvert host cell function.

Anaplasma↗

PubMed2006

Effect of agro-ecological zone and grazing system on incidence of East Coast Fever in calves in Mbale and Sironko Districts of Eastern Uganda.

Between May 2002 and February 2003 a longitudinal survey was carried out in Mbale and Sironko Districts of Eastern Uganda to determine the influence of agro-ecological zones (AEZ) and grazing systems on tick infestation patterns and incidence of East Coast Fever (ECF) in bovine calves. The study area was stratified into AEZ (lowland, midland and upland) and grazing systems {zero grazing (ZG), restricted-outdoor grazing (ROG) and communal grazing (CG)}, whose strata had previously been shown to influence the prevalence of ECF, babesiosis and anaplasmosis. One hundred and eighty-five smallholder dairy farms with a total of 198 calves of both sexes, between the ages of 1 day and 6 weeks, were purposively selected from the AEZ-grazing system strata. Nine dynamic cohorts (11-51 calves in each) of these calves were examined and sampled monthly. Ticks infesting the calves were counted from one side of the animal body and categorized into the different species, sex and feeding status. Sera were collected at recruitment and monthly thereafter and antibodies against Theileria parva, T. mutans, Babesia bigemina, B. bovis and Anaplasma marginale were measured using ELISA. Tick challenge (total and specific) varied with AEZ and grazing system. The risk of infection with T. parva was higher in the lowland zone compared to the upland zone (hazard ratio (HR)=2.59; 95% CI: 1.00-6.34). The risk of infection with T. parva was higher in the CG system than the ZG system (HR=10.00; 95% CI: 3.61-27.92). The incidence risk for sero-conversion, over the 10 months study period, was 62, 16 and 9% in the lowland, midland and upland zones, respectively. Ninety-eight percent of the calves in lowland-CG stratum sero-converted by the age of 6 months, while 56 and 8% did so in the lowland-ROG and the lowland-ZG stratum, respectively. The results of this study show the need to consider farm circumstances and the variation in ECF risk, both spatially and temporally when designing control strategies for ECF.

Age Factors↗

PubMed2006

Serological and molecular evidence of exposure to arthropod-borne organisms in cats from northeastern Spain.

One hundred sixty-eight cat sera from Spain were tested for IgG antibodies to Rickettsia conorii (Rc), Ehrlichia canis (Ec), Anaplasma phagocytophilum (Ap) and Bartonella henselae (Bh) antigens using IFA and for FeLV antigen and FIV antibody by ELISA. For 47 whole blood samples, PCR testing was performed for Rickettsia, Ehrlichia and Bartonella. Seroprevalences were: Bh (71.4%), Rc (44%), Ec (11.3%), FeLV (8.5%), FIV (7.4%) and Ap (1.8%). Bh antibodies were associated with seroreactivity to both Ec and Rc antigens. FIV antibodies were associated with illness and cats older than 2 years. Bartonella henselae and B. clarridgeiae (Bcl) DNA was amplified from seven and one sample, respectively.

Anaplasma phagocytophilum↗

PubMed2005

A longitudinal study of sero-conversion to tick-borne pathogens in smallholder dairy youngstock in Tanzania.

A longitudinal study of sero-conversion of youngstock to the tick-borne pathogens Theileria parva, T. mutans, Anaplasma marginale, Babesia bigemina and B. bovis was conducted over two years on smallholder dairy farms in Tanga region, Tanzania. There was evidence of maternal antibodies to all tick-borne pathogens in animals less than 18 weeks of age. Seroprevalence increased as expected with age in animals older than this but seroprevalence profiles underestimated the force of infection due to waning antibody levels between samplings. By the end of the 2-year study, less than 50% of study animals had seroconverted to each of the tick-borne pathogens investigated, consistent with the low levels of tick attachment observed on the study animals. Some associations between seroconversion to tick-borne pathogens, and counts of their known tick vectors on the animals, were identified as expected. However, some were not, suggesting that counts of some tick species may act as an index of rates of attachment of other vector species. Variation in acaricide treatment frequencies was not associated with variations in tick-borne pathogen seroprevalence suggesting that acaricides may be used more frequently than necessary on many farms. Most animals were zero-grazed, a management system associated with a significantly lower likelihood that animals seroconverted to any tick-borne pathogen except A. marginale. Seroprevalence varied locally with farm location (particularly for Babesia spp.) but was not well predicted by indices of ecological conditions. Our findings suggest that attempts to achieve a state of 'endemic stability' for tick-borne pathogens may be unreasonable on the smallholder dairy farms studied but reductions in the frequency of use of acaricides may be possible following prospective studies of effects on mortality and morbidity due to tick-borne pathogens.

Age Factors↗

PubMed2005

Ticks and tick-borne disease in Guatemalan cattle and horses.

Blood samples and ticks were collected from 48 cattle and 74 horses from seven sites in the Peten region of Guatemala. Data on body condition, mucous membrane capillary refill time and tick infestation levels were recorded for each animal in the study. Horses had significantly higher levels of tick infestation than cattle, as well as poorer body condition scores. Seroprevalence of Babesia spp. was 95.8% for B. bovis in cattle, 89.6% for B. bigemina in cattle, and 92.7% for B. equi in horses. Seroprevalence of Anaplasma marginale in cattle was 87.5%, similar to reports in animals from other regions of Central America. This is the first time that A. phagocytophilum has been reported in animals from this region, with overall PCR-prevalence of 27.6% in cattle and horses, and seroprevalence of 28.4% (52% in cattle and 13% in horses). An agent was identified with serological cross-reactivity and close genetic relatedness to Ehrlichia ruminantium, but further testing confirmed that the agent in Guatemalan cows was not the agent of heartwater. Ticks were identified to species with the predominant species identified on cattle as Boophilus microplus and Amblyomma cajennense, while Anocentor nitens and A. cajennense were most commonly found on horses. Prevalence of infection, tick infestation levels, host factors and environmental data were analyzed for association; A. nitens was significantly associated with A. phagocytophilum prevalence by village.

Anaplasma↗

PubMed1996

Prospects for subunit vaccines against tick-borne diseases.

Tick-borne parasites are a serious impediment to the improvement of live-stock production in the developing world. The major parasites affecting cattle include Theileria parva, T. annulata, Babesia bigemina, B. bovis, Anaplasma marginale and Cowdria ruminantium. The control of these infections is dependent on the use of acaricides to decrease transmission by the tick vectors, and immunization of susceptible animals with live vaccines. The use of acaricide is hampered by the development of resistance, and live vaccines require cold chain facilities, which are generally unreliable in developing countries. There is therefore a need for improved vaccines that can circumvent these problems. There is a subunit vaccine being developed for T. parva based on the major surface antigen of the sporozoite (p67). A similar antigen, SPAG 1, has been identified as a candidate for T. annulata. Although several candidate antigens have been identified for Babesia spp., progress towards development of a subunit vaccine based on these antigens has been hampered by polymorphism among isolates and between species, and lack of knowledge of the immune effector mechanisms responsible for protection. The search for protective antigens of A. marginale has focused on outer membrane proteins; immunization with a variety of these antigens alone or in combination, has yielded promising results. As with Babesia, further definition of immune effector mechanisms is needed to optimize immunization strategies. The work on identifying the protective antigens of C. ruminantium is in its embryonic stages; however, two antigens have been identified and are currently being evaluated. There is high expectancy for subunit vaccines for all these diseases; however there is need for further work to elucidate the immune mechanisms in order to select appropriate antigen delivery systems.

Anaplasma↗

PubMed1997

The prevalence of serum antibodies to tick-borne infections in cattle in smallholder dairy farms in Murang'a District, Kenya; a cross-sectional study.

The most important tick-borne disease of cattle in eastern, central and southern Africa is East Coast fever (ECF) caused by Theileria parva and transmitted by the tick Rhipicephalus appendiculatus. Other less-important tick-borne diseases in cattle are benign theileriosis caused by Theileria mutans, babesiosis caused by Babesia bigemina, anaplasmosis caused by Anaplasma marginale and cowdriosis caused by Cowdria ruminatum. In Murang's District, Central Province of Kenya, five agroecological zones (AEZs) are defined according to climate, altitude and agricultural activities. A cross-sectional serological study was conducted on 750 smallholder dairy farms in Murang's District, selected in a stratified random sampling method. The farms had a total of 362 calves. One hundred and fifty farms were studied from three administrative sublocations in each of the five AEZs. Prevalence of serum antibodies to three tick-borne parasites, that is T. parva, T. mutans and B. bigemina, were determined using the enzyme-linked immunosorbent assay (ELISA) technique. Antibody prevalence values differed across the AEZs. The ranges of means for the prevalences were: T. parva (18-72%), T. mutans (1.5-28%) and B. bigemina (12-49%). The above results serve as indicators of the possible existence of endemic stability in some AEZs for some parasites.

Anaplasma↗

PubMed1997

Bovine anaplasmosis prevalence in northern Veracruz state, Mexico.

In order to learn more about the presence of bovine anaplasmosis in northern Veracruz state, México, paired blood and serum samples from 368 cattle were subjected to polymerase chain reaction (PCR) and complement-fixation test (CFt). The overall prevalence of Anaplasma marginale by PCR was 69.2% and seroprevalence by CFt 54.6%. Age-specific prevalence was calculated for each test. Sixty-eight percent of animals from 0 to 3 months of age already were infected (PCR-positive), compared to only 42.4% positive by serology. CFt results suggested that presence of antibody increases with age up to 18 to 36 months, decreasing thereafter. Presence of the rickettsia seems to follow the same early pattern but with a new increase in animals 36 months or older. Serology results provided a biased picture of the true prevalence of anaplasmosis. Calculated specificity and sensitivity (63.5% and 68.2%) for CFt using PCR values as true values, appear very low and unreliable. The data generated by DNA-based surveys seem more appropriate to help design and implement control or eradication programs for bovine anaplasmosis.

Anaplasma↗

PubMed2003

CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum.

Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.

Adjuvants, Immunologic↗

PubMed2003

Overcoming constraints to meeting increased demand for Babesia bigemina vaccine in Australia.

Demand for live trivalent tick fever vaccine containing Babesia bovis, Babesia bigemina and Anaplasma centrale produced by the Department of Primary Industries, Queensland, has increased from less than 10,000 doses in 1988 to 500,000 doses in 2001. This paper describes a series of trials aimed at overcoming certain constraints to obtain B. bigemina parasitised erythrocytes (PEs) on a large enough scale from infected splenectomised calves to meet the demand. Passage through a series of splenectomised calves failed to increase the yield per calf but we showed that the dose rate of infected cells could be reduced from the long-time standard of 1x10(7) to 2.5x10(6) without affecting immunogenicity and still leaving a safety margin of at least 50-fold for infectivity. This change quadrupled the potential yield of doses per calf and allowed the DPI to meet the increased demand for B bigemina in vaccine. Due to the high cost and limited availability of suitable, health tested donors, calves previously infected with B. bovis or A. centrale were used to provide B. bigemina organisms but the practice resulted in red cell agglutination in some batches of prepared vaccine. A trial is described where B. bigemina-infected red cells were washed by centrifugation to remove agglutinating antibodies. Washing had no effect on parasite viability and this method is now in routine use in the production of trivalent vaccine.

Anaplasma↗

PubMed1997

Babesial antibody dynamics after cattle immunisation with live vaccines, measured with an indirect immunofluorescence test.

The efficacy of vaccination of Argentinean cattle against babesiosis and anaplasmosis using live immunogens was tested to detect specific antibodies in samples obtained about 60 days after vaccination. Under these conditions a higher than expected proportion of cattle failed to show antibodies against Babesia bigemina. Therefore, a study was designed to evaluate if this failure was due to insensitivity of the routine test to detect antibodies to B. bigemina or to lack of infectivity of the live vaccine. Four groups (G) of cattle were each inoculated subcutaneously with 10 million Babesia bovis (vaccinal strain R1A), 10 million B. bigemina (vaccinal strain S1A) and 10 million Anaplasma centrale (strain M1). G1 and G2 consisted of ten Angus bulls 20-24 months old and ten Angus bulls 15-18 months old, respectively; G3 and G4 consisted of ten and 16 Holstein 1-month-old male calves, respectively. Blood samples were obtained on days 0, 10, 20, 30, 40, 50 and 60 after vaccination and the sera were analysed with an indirect immunofluorescent (IFA) test to detect antibodies to B. bovis (baseline dilution for a positive result 1:60) and B. bigemina (baseline dilution 1:120). Positive IFA titres were considered as evidence of the infectivity of the Babesia vaccinal strains contained in the vaccine. All Angus bulls were found positive to antibodies against both Babesia species, by day 20 (B. bovis) and day 30 (B. bigemina), whereas 10-25% of Holstein calves were negative throughout. The partial lack of vaccine infectivity in the calves was considered to be a consequence of innate resistance of young calves to Babesia. Antibody titres to B. bovis and B. bigemina declined by day 60 after vaccination. However, all cattle that were positive to B. bovis antibodies on day 50 were still positive to the IFA test 10 days later while 10%, 30% and 12% of cattle of G1, G2 and G3 that were positive to B. bigemina antibodies on day 50 after vaccination were found negative to the IFA test on day 60. In future, samples taken on days 40-50 will be used for detection of B. bigemina antibodies in vaccinated cattle, on day 60 for A. centrale and on either occasion for B. bovis. The reaction to the inoculation of B. bigemina S1A strain appears to lag behind the reaction to B. bovis R1A strain. It is not certain if this is a normal reaction to this B. bigemina strain or the result of interaction with the B. bovis strain.

Anaplasma↗

PubMed1998

The safety and efficacy of Australian tick-borne disease vaccine strains in cattle in Paraguay.

Glycerol preserved, frozen tick-borne disease vaccine strains developed in Australia were imported into Paraguay to test their safety in pregnant Holando heifers and their efficacy against challenge from inoculated local field strains of Babesia bigemina, B. bovis and Anaplasma marginale in Hereford X Criolla heifers. The two Babesia strains proved to be safe and the B. bovis K strain was very effective in providing immunity to a local field strain of B. bovis. The B. bigemina efficacy trial was inconclusive, possibly due to the avirulent nature of the local field strain used in challenge. The A. centrale strain did not prove to be as safe as would be desirable in safety trials, neither did it provide as good protection as the Babesia strains in the efficacy trial. It was concluded that the Babesia strains provided good protection against field challenge in Paraguay and were safe to use in highly susceptible cattle, however an alternative to A. centrale should be sought to provide protection against local strains of A. marginale.

Anaplasma↗

PubMed2000

Prevalence of blood parasites among cattle at the central area of Saudi Arabia.

The present study aimed to investigate the parasites infecting cattle blood at Al-Qassim region. Examination of 307 blood samples revealed that 235 (76.5%) and 3 (0.98%) of cattle were infected with Theileria annulata and Anaplasma marginale, respectively. T. annulata was the prevalent blood parasite among cattle while A. marginale was scarcely encountered. The monthly incidence of T. annulata ranged from 38.5% in March to 94.7% in October. Also, the infection rate reached a maximum (84.3%) in both autumn and summer seasons, while it decreased to reach (59.4%) in spring. It has been found that there was no difference between the infection rate of the laboratory and the abattoir collected samples. However, the intensity of infection was different between the two groups.

Abattoirs↗