SEARCH · PubMed Health

Results for “insertion sequence”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 955 records · Page 53Linked to original sources

PubMed1993

Alternative splicing in the first nucleotide binding fold of CFTR.

CFTR mRNA transcripts were analyzed from freshly isolated nasal epithelial cells and lymphocytes (six individuals) and from lymphocytes alone from 14 further individuals. In four of these 20 individuals alternative splicing was observed within the region coding for the first nucleotide binding fold. The RNA sequence between exons 10 and 13 was converted to cDNA and amplified by the polymerase chain reaction (PCR). We detected two PCR products of 583 bp and 464 bp in length. Direct sequencing of both fragments showed that the 583 bp PCR fragment contained an additional 119 bp sequence between exon 10 and exon 11, directly at the normal junction. This insertion contains an in frame stop codon and would, if translated, cause a shift in the reading frame. This stop codon does not result in an undetectable mRNA level as seen with other nonsense mutations within the same region of the CFTR gene (1, 2, own unpublished results). The alternatively spliced mRNA was found to be transcribed from both CF and normal alleles. The 119 bp fragment was amplified from genomic DNA and from the genomic phage TE24V, which includes exon 9, intron 9, exon 10 and a part of intron 10 (3) by PCR using primers created from within the inserted sequence. In addition, the insertion was mapped to a 1Kb EcoRI fragment of phage TE24V by Southern-blot analysis. By sequencing the insert surroundings within the phage TE24V we identified consensus splice sites (donor and acceptor sites, branch point). Furthermore no alterations were detected in the splice site sequences between individuals who express the aberrantly spliced product and those who do not.

Alleles↗

PubMed1998

Snapshot of a large dynamic replicon in a halophilic archaeon: megaplasmid or minichromosome?

Extremely halophilic archaea, which flourish in hypersaline environments, are known to contain a variety of large dynamic replicons. Previously, the analysis of one such replicon, pNRC100, in Halobacterium sp. strain NRC-1, showed that it undergoes high-frequency insertion sequence (IS) element-mediated insertions and deletions, as well as inversions via recombination between 39-kb-long inverted repeats (IRs). Now, the complete sequencing of pNRC100, a 191,346-bp circle, has shown the presence of 27 IS elements representing eight families. A total of 176 ORFs or likely genes of 850-bp average size were found, 39 of which were repeated within the large IRs. More than one-half of the ORFs are likely to represent novel genes that have no known homologs in the databases. Among ORFs with previously characterized homologs, three different copies of putative plasmid replication and four copies of partitioning genes were found, suggesting that pNRC100 evolved from IS element-mediated fusions of several smaller plasmids. Consistent with this idea, putative genes typically found on plasmids, including those encoding a restriction-modification system and arsenic resistance, as well as buoyant gas-filled vesicles and a two-component regulatory system, were found on pNRC100. However, additional putative genes not expected on an extrachromosomal element, such as those encoding an electron transport chain cytochrome d oxidase, DNA nucleotide synthesis enzymes thioredoxin and thioredoxin reductase, and eukaryotic-like TATA-binding protein transcription factors and a chromosomal replication initiator protein were also found. A multi-step IS element-mediated process is proposed to account for the acquisition of these chromosomal genes. The finding of essential genes on pNRC100 and its property of resistance to curing suggest that this replicon may be evolving into a new chromosome.

Chromosome Mapping↗

PubMed1989

Insertion of new sequences into the catalytic domain of an enzyme.

Activities of enzymes can be modified by the replacement of active-site amino acids with residues that strengthen specific interactions with substrates or that alter the specificity. The scope for engineered enzymes would be broadened if additional, new sequences could be inserted into a catalytic domain. Properly designed, these sequences could encode new ligand binding sites, be intermediates in the construction of chimeric enzymes, or alter the internal flexibility and "breathing" modes of the active-site region. As a first step toward this objective, we inserted oligopeptides of up to 14 amino acids into various locations within an 82 amino acid region of the adenylate synthesis domain of Escherichia coli methionyl-tRNA synthetase. These sites include ones that are flanked by sequences that are conserved between the proteins from E. coli and the yeast Saccharomyces cerevisiae and those that are essential for activity and stability. We found that all of the insertional mutants are stable and some have catalytic parameters for adenylate synthesis that are comparable to those of the wild-type enzyme. Thus, such an approach may provide for a variety of novel applications.

Amino Acid Sequence↗

PubMedDate not supplied

[Detection of intragenomic polymorphism in the LR2 region of human intergenic ribosomal spacer].

It is a common point of view today that tandem ribosomal genes are subject to concerted evolution, a process that promotes homogeneity among the many copies through the mechanisms of unequal homologous exchange and gene conversion. These mechanisms can lead to opposite results: they can correct and eliminate new variants and they also can promote the spread of new gene variants throughout individual gene clusters among homologous and non homologous chromosomes. A number of experiments performed to decide which of these mechanisms is more important have yielded contradictory answers to this question. In this work we have cloned and partially sequenced 36 PCR-amplified copies of the human rIGS segment 22763-23523 apart from the transcription start point, obtained from the individual genome. This segment is enriched by (G)n and (AG)n clusters and enters into 2kb LR2 element of the human rIGS. Comparative analysis showed that absolutely identical sequences are absent among 36 inserts sequenced. The 26 clones differed only on a number of repeating elements in the paralogous (G)n and (AG)n clusters. The last ten clones differed not only on a number of cluster repeating elements, but contained insertions and deletions of distinct sizes, which do not correspond to the human rIGS polymorphism variants described earlier.

Base Sequence↗

PubMed2003

Complete sequence of virulence plasmid pJM1 from the marine fish pathogen Vibrio anguillarum strain 775.

The virulence plasmid pJM1 enables the fish pathogen Vibrio anguillarum, a gram-negative polarly flagellated comma-shaped rod bacterium, to cause a highly fatal hemorrhagic septicemic disease in salmonids and other fishes, leading to epizootics throughout the world. The pJM1 plasmid 65,009-nucleotide sequence, with an overall G+C content of 42.6%, revealed genes and open reading frames (ORFs) encoding iron transporters, nonribosomal peptide enzymes, and other proteins essential for the biosynthesis of the siderophore anguibactin. Of the 59 ORFs, approximately 32% were related to iron metabolic functions. The plasmid pJM1 confers on V. anguillarum the ability to take up ferric iron as a complex with anguibactin from a medium in which iron is chelated by transferrin, ethylenediamine-di(o-hydroxyphenyl-acetic acid), or other iron-chelating compounds. The fatDCBA-angRT operon as well as other downstream biosynthetic genes is bracketed by the homologous ISV-A1 and ISV-A2 insertion sequences. Other clusters on the plasmid also show an insertion element-flanked organization, including ORFs homologous to genes involved in the biosynthesis of 2,3-dihydroxybenzoic acid. Homologues of replication and partition genes are also identified on pJM1 adjacent to this region. ORFs with no known function represent approximately 30% of the pJM1 sequence. The insertion sequence elements in the composite transposon-like structures, corroborated by the G+C content of the pJM1 sequence, suggest a modular composition of plasmid pJM1, biased towards acquisition of modules containing genes related to iron metabolic functions. We also show that there is considerable microheterogeneity in pJM1-like plasmids from virulent strains of V. anguillarum isolated from different geographical sources.

Animals↗

PubMed1996

Molecular analysis of a spontaneous insertion mutation near the alcohol dehydrogenase gene of Drosophila melanogaster.

The structural integrity of the Adh gene in several isogenic lines of Drosophila melanogaster was tested by Southern blot analysis using a 4.75 kilobase (kb) genomic clone of Alcohol dehydrogenase (Adh) as a probe. One line, RI22, III, showed evidence of a spontaneous insertion mutation 5' to the adult enhancer in an area previously indicated as a putative larval enhancer region. The inserted allele was present at an approximate frequency of 50% in relation to the uninserted wildtype allele. Isogenic lines were constructed of both homozygous mutant and wildtype flies, allowing the comparison of a spontaneous insertion mutant allele and it's direct wildtype ancestral allele. The inserted sequence is a 296 basepair (bp) truncated jockey retroposable element. The sequence and distribution of the element as well as it's proximity to the Adh gene are discussed.

Alcohol Dehydrogenase↗

PubMed2001

RNA binding proteins and selenocysteine.

Selenocysteine is incorporated into protein by a complex co-translational mechanism that involves both cis and trans acting factors. Among the trans-acting factors are RNA binding proteins that interact with the selenoprotein 3' UTRs at a sequence known as the selenocysteine insertion sequence (SECIS). These factors are generally referred to as SBPs, and in this review we will discuss the history of the SBPs, and give a detailed description of the recently identified SBP2 which is the only SBP known to be required for Sec insertion. The mechanism by which SBP2 may be involved in this process will be discussed.

3' Untranslated Regions↗

PubMed1979

Expression of ribosomal DNA insertions in Drosophila melanogaster.

Approximately half of the ribosomal genes on the X chromosome of Drosophila melanogaster are interrupted by an insertion of type 1. Nuclear RNA from D. melanogaster embryos was transferred to DBM paper and hybridized with cloned type 1 insertion sequences. With a DNA fragment derived specifically from large insertions, transcripts were detected between 5 and 10 kb. These insertion transcripts represent less than one RNA molecule per nucleus, which is more than three orders of magnitude below the concentration of nascent rRNA chains, as determined by kinetics of hybridization. With a DNA fragment derived from the right end of large insertions which is also complementary to short insertions, more discrete RNA bands appeared with sizes between 1 and 8.5 kb, representing altogether about 13 RNA molecules per nucleus. Insertion transcripts large enough to be potential precursors to 28S rRNA represent less than one molecule per nucleus. It was shown by sandwich hybridization that at least some of the insertion transcripts are derived from rDNA. No significant difference was found between insertion transcripts in RNA extracted from ovaries, embryos, larvae, pupae or adult flies. Unless a mechanism other than splicing is involved, ribosomal genes with insertions cannot contribute significantly to the synthesis of 28S rRNA. A cytoplasmic RNA approximately 1 kb long, which is complementary to a short insertion and to ribosomal gene sequences flanking both sides of the insertion, was found. The abundance of this short unspliced RNA is about 50 molecules per embryo cell.

Animals↗

PubMed2006

Characterization of the Pseudomonas putida mobile genetic element ISPpu10: an occupant of repetitive extragenic palindromic sequences.

We have characterized the Pseudomonas putida KT2440 insertion element ISPpu10. This insertion sequence encodes a transposase which exhibits homology to the transposases and specific recombinases of the Piv/Moov family, and no inverted repeats are present at the borders of its left and right ends, thus constituting a new member of the atypical IS110/IS492 family. ISPpu10 was found in at least seven identical loci in the KT2440 genome, and variants were identified having an extra insertion at distinct loci. ISPpu10 always appeared within the core of specific repetitive extragenic palindromic (REP) sequences TCGCGGGTAAACCCGCTCCTAC, exhibiting high target stringency. One intragenic target was found associated with the truncation of a GGDEF/EAL domain protein. After active in vitro transposition to a plasmid-borne target, a duplication of the CT (underlined above) at the junction as a consequence of the ISPpu10 insertion was experimentally demonstrated for the first time in the IS110/IS492 family. The same duplication was observed after transposition of ISPpu10 from a plasmid to the chromosome of P. putida DOT-T1E, an ISPpu10-free strain with REPs similar to those of strain KT2440. Plasmid ISPpu10-mediated rearrangements were observed in vivo under laboratory conditions and in the plant rhizosphere.

Amino Acid Sequence↗

PubMed1993

Detailed characterization of a human 8q24.1 microdissection library and generation of "sequence-tagged sites".

A total of 533 clones from a human 8q24.1 microdissection library was analyzed by automatic DNA sequencing. Three hundred and thirty-seven different insert sequences were found. The insert size ranged from 45 to 376 bp (mean, 170 bp). Eighty-six percent (291/337) of these sequences were free of repetitive DNA. Each of 19 clones tested was successfully translated into a sequence-tagged site. We conclude that the microdissection library is a rich source of DNA markers for 8q24.1.

Base Sequence↗

PubMed1993

DNA homology in species of bacteriophages active on Pseudomonas aeruginosa.

Using electron microscopy and DNA-DNA-hybridization, 113 virulent and temperate bacteriophages specific for P. aeruginosa have been assigned to 23 species. In most cases, especially in virulent phages, both particle morphology and DNA homology types were in good correlation and their use was sufficient for clear-cut definition of phage species. No virulent phages of different species had any DNA homology. DNA homology was detected between temperate phages of several species. Temperate phages formed two large groups of two and seven species, respectively. The first group included all transposable bacteriophages. The extent of interspecies DNA homology of phages belonging to each group was not more than 10-15% (except for 25% for phages D 3 and KF 1). No DNA homology was between phages of different groups. The possible origin and function of homologous sequences (genetic modules, linkers, occasional insertional sequences) are discussed. One of the phages (phi C 15) may be considered as the result of recombination between phages belonging to two different species, 295 and SM.

DNA, Viral↗

PubMed2004

A novel lipase/chaperone pair from Ralstonia sp. M1: analysis of the folding interaction and evidence for gene loss in R. solanacearum.

A microbial strain (referred to as M1) that produces an extracellular lipase was isolated from a soil sample in Vietnam, and identified as a Ralstonia species by partial sequencing of its 16S rDNA. A genomic library was constructed from Pst I fragments, and a colony showing lipase activity was selected for further analysis. Sequencing of the 4.7-kb insert in this clone (named M1-72) revealed one incomplete and three complete ORFs, predicted to encode a partial hypothetical glutaminyl tRNA synthetase (304 aa), a hypothetical transmembrane protein (500 aa), a lipase (328 aa) and a lipase chaperone (352 aa), respectively. Alignment of the insert sequence with the corresponding region of the genome of R. solanacearum GMI1000 (GenBank Accession No. AL646081) confirmed the presence in the latter of the genes for the hypothetical transmembrane protein and glutaminyl tRNA synthetase, which exhibited 89-91% identity to their counterparts in M1. However, R. solanacearum GMI1000 lacks the complete lipase-encoding gene and the major part of the chaperone-encoding gene, creating a so-called "black hole". The deduced amino acid sequences of the products of the lipase gene lipA and chaperone gene lipB from strain M1 shared 49.3-60.3% and 23.9-32.7% identity, respectively, with those of the Burkholderia lipase/chaperone subfamily I.2. lipB is located downstream of lipA, and separated from it by only 9 bp, and each gene has a putative ribosome binding site. The mature lipase LipA, a His-tagged derivative (LipAhis), the tagged full-length chaperone LipBhis and a truncated form (DeltaLipBhis) lacking the 56 N-terminal residues were expressed in Escherichia coli BL21. LipA, LipAhis and DeltaLipBhis could be expressed at high levels (70, 15 and 12 mg/g wet cells, respectively) and were easily purified. However, LipBhis was expressed at a much lower level which precluded purification. The specific activity of purified LipAhis, expressed on its own, was very low (<52 U/mg). However, after co-incubation with the purified DeltaLipBhis in vitro, the specific activity of the enzyme was markedly enhanced, indicating that the chaperone facilitated correct folding of the enzyme. A lipase:chaperone ratio of 1:10 was found to be optimal, yielding an enzyme preparation with a specific activity of 650 U/mg.

Amino Acid Sequence↗

PubMed2004

An intragenic deletion/inversion event in the DMD gene determines a novel exon creation and results in a BMD phenotype.

Duchenne and Becker Muscular Dystrophy (DMD and BMD) are caused, in the majority of cases, by deletions in the dystrophin gene ( DMD). Here we describe the unprecedented case of a BMD patient carrying a large out-of-frame intragenic deletion, together with an inversion in the DMD gene, resulting in the inclusion of a novel exon in the transcript. Multiplex PCR amplification revealed the presence of a 48-52 exon deletion, but transcript analysis identified two unexpected products, neither of them including exon 53. The shorter mRNA derived from the juxtaposition of exons 47-54 (in-frame), while the longer one resulted from the inclusion of a novel 73-bp exon between exons 47 and 54. Sequence analysis revealed that the inserted sequence derived from an inverted portion of intron 53; its inclusion is predicted to determine protein truncation. The presence of a genomic inversion involving exon 53 and flanking regions was confirmed, and inversion/deletion breakpoints were sequenced. The inverted 73-bp sequence displays splicing signals at both ends and thus it is probably recognized as a novel exon when the partially inverted hnRNA is processed. These findings highlight the importance of mRNA analysis on patients that, based on routine DNA screenings, do not follow the reading-frame rule. This is the first reported patient carrying both an intragenic deletion and inversion in the DMD locus. This case might provide further insight into both the mechanisms that determine genomic rearrangements in the DMD locus and the molecular signals that drive exon inclusion.

Adult↗

PubMed1984

Rat immunoglobulin E heavy chain locus.

A 2100 base-pair long sequence has been established which covers all four constant domains of the rat epsilon-chain. An analysis of messenger RNA from an immunoglobulin E producing rat immunocytoma revealed two separate epsilon-chain mRNA species, 2.3 X 10(3) and 2.8 X 10(3) base-pairs long. The latter mRNA encodes the membrane binding form of the epsilon-chain. The membrane exons which are located approximately 2 X 10(3) base-pairs away from the 3'-side of the CH4 exon were also sequenced. A comparison between the rat and mouse epsilon-chains at the protein sequence level revealed an overall homology of 80% which, as expected, is considerably higher than the homology found between rat and human epsilon-chains. The fourth constant domain together with the two membrane exons exhibited the highest degree of homology, 81 to 89%. Only two differences were found when the epsilon-chains from LOU and Sprague Dawley rats were compared. The most striking difference at the nucleotide sequence level between the rat, mouse, and human epsilon genes was found within the first intron. The mouse genome contains a unique 366 base-pair long sequence in this region. The inserted sequence is repetitive and present in approximately 100 copies in the mouse genome. It is flanked by 22 base-pair long direct repeats and contains also 14 base-pair long inverted repeats, thus having properties in common with transposable elements.

Animals↗

PubMed2004

Dissemination of nosocomial multiple-aminoglycoside-resistant Staphylococcus aureus caused by horizontal transfer of the resistance determinant (aacA/aphD) and clonal spread of resistant strains.

BACKGROUND: The multiple-aminoglycoside-resistant gene aacA/aphD exists as a transposable genetic element (Tn4001) in gram-positive cocci. Here we describe our retrospective investigation of the mechanism responsible for the dissemination of Tn4001 among staphylococci present in clinical isolates collected in our university hospital. At its peak, about 80% of the total isolates of methicillin-resistant Staphylococcus aureus showed multiple-aminoglycoside resistance, and all harbored aacA/aphD. METHODS: Clonal relatedness was analyzed by pulsed field gel electrophoresis after SmaI endonuclease digestion of the genomic DNA from isolates collected in 1991 and 1997. To detect Tn4001 on the chromosome and conjugative plasmids, specific sequences from aacA/aphD and the insertion sequence IS256, whose inverted sequence flanks aacA/aphD, were amplified by polymerase chain reaction. RESULTS: Pulsed field gel electrophoresis of genomic DNA, plasmid analysis, and polymerase chain reaction detection of the resistance determinant all indicated the presence of disseminated clones that had survived among hospitalized patients through acquisition of conjugative plasmids harboring aacA/aphD. Furthermore, aacA/aphD also disseminated among nosocomial strains other than S aureus as a consequence of the self-transferability of Tn4001. CONCLUSIONS: The nosocomial prevalence of multiple-aminoglycoside-resistant staphylococci is the result of both horizontal and interspecific transfer of aacA/aphD and the clonal spread and survival of resistant strains.

Amino Acid Sequence↗

PubMed2000

Genomic exploration of the hemiascomycetous yeasts: 10. Kluyveromyces thermotolerans.

A genomic exploration of Kluyveromyces thermotolerans was performed by random sequence tag (RST) analysis. We sequenced 2653 RSTs corresponding to inserts sequenced from both ends. We performed a systematic comparison with a complete set of proteins from Saccharomyces cerevisiae, other completely sequenced genomes and SwissProt. We identified six mitochondrial genes and 1358-1496 nuclear genes by comparison with S. cerevisiae. In addition, 25 genes were identified by comparison with other organisms. This corresponds to about 24% of the estimated gene content of this organism. A lower level of conservation is observed with orthologues to genes of S. cerevisiae previously classified as orphans. Gene order was found to be conserved between S. cerevisiae and K. thermotolerans in 56.5% of studied cases.

Amino Acid Sequence↗

PubMed2001

Technical Advance. Tobacco rattle virus as a vector for analysis of gene function by silencing.

Virus vectors carrying host-derived sequence inserts induce silencing of the corresponding genes in infected plants. This virus-induced gene silencing (VIGS) is a manifestation of an RNA-mediated defence mechanism that is related to post-transcriptional gene silencing (PTGS) in transgenic plants. Here we describe an infectious cDNA clone of tobacco rattle virus (TRV) that has been modified to facilitate insertion of non-viral sequence and subsequent infection to plants. We show that this vector mediates VIGS of endogenous genes in the absence of virus-induced symptoms. Unlike other RNA virus vectors that have been used previously for VIGS, the TRV construct is able to target host RNAs in the growing points of plants. These features indicate that the TRV vector will have wide application for gene discovery in plants.

Base Sequence↗

PubMed1992

Reversion of the hprt mutant clone SP5 by intrachromosomal recombination.

The spontaneous hprt mutant clone SP5, derived from V79 Chinese hamster cells, was shown to exhibit a duplication of approximately 2 kb, including exon 2 and its flanking intron sequences, inserted into the intron 1 sequence of the hprt gene. The most striking feature of SP5 is that this clone is quite unstable, demonstrating an extremely high spontaneous reversion frequency. Molecular analysis of 25 independent revertant clones of SP5 indicated that they arose after precise deletion of the duplicated fragment in the hprt gene. Reversion of SP5 could be induced by agents which damage DNA by different mechanisms, but there was no correlation with induction of the forward mutations. Based on these results, we suggest that intrachromosomal recombination must be responsible for the spontaneous reversion of SP5. Genetic recombination in somatic cells has been suggested to be involved in the multistep process of carcinogenesis. Since the ability to induce intrachromosomal recombination in yeast has been shown to be highly correlated with non-mutagenic as well as mutagenic carcinogens, it is of great interest to investigate similar systems in mammalian cells. The SP5 cell line may be unique for such a purpose, since this mutant clone contains an endogenic marker for studying the process of intrachromosomal recombination.

Animals↗