SEARCH · PubMed Health

Results for “structural features”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 973 records · Page 54Linked to original sources

PubMed2004

Complex structural features of satellite DNA sequences in the genus Pimelia (Coleoptera: Tenebrionidae): random differential amplification from a common 'satellite DNA library'.

The major satellites of the nine species of the subgenera Pimelia s. str. and Amblyptera characterised in this paper are composed of longer monomers (500 and 700 bp) than those described previously in 26 Pimelia s. str. taxa (357 bp, a sequence called PIM357). Sequence analysis reveals partial similarity among these satellites and with the PIM357 monomers. The discrepancy between the phylogeny obtained based on three mitochondrial and two nuclear markers and that deduced from satellite DNA (stDNA) sequences suggests that the different Pimelia satellites were already present in a common ancestor forming what has been called a 'satellite DNA library'. Thus, the satellite profiles in the living species result from a random amplification of sequences from that 'library' during diversification of the species. However, species-specific turnover in the sequences has occurred at different rates. They have included abrupt replacements, a gradual divergence and, in other cases, no apparent change in sequence composition over a considerable evolutionary time. The results also suggest a common evolutionary origin of all these Pimelia satellite sequences, involving several rearrangements. We propose that the repeat unit of about 500 bp has originated from the insertion of a DNA fragment of 141 bp into the PIM357 unit. The 705-bp repeats have originated from a 32-bp direct duplication and the insertion of a 141-bp fragment in inverted orientation relative to a basic structure of 533 bp.

Animals↗

PubMed1993

[Effect of structural features of nitro-derivatives of fluorenone and biphenyl on frameshift mutagenesis in tester strains of Salmonella typhimurium].

Comparative mutagenic activity of 7 derivatives of biphenyl and fluorenone, 4,4'-dinitrobiphenyl-2,2'-dicarboxylic acid; 4,4',6,6'-tetranitrobiphenyl-2,2'-dicarboxylamide; 2-nitrofluorenone-5-carboxylic acid; 2,7-dinitrofluorenone-5-carboxylic acid; 2,7-dinitrofluorenone-5-carboxylamide; 2-nitrofluorenone-5,7-dicarboxylic acid; 2,4-dinitrofluorenone-5,7-dicarboxylic acid was studied. The highest activity was demonstrated for 2,7-DNF-5-KA and 2,7-DNF-5,7-DK which induced frameshift mutations in the tester strains Salmonella typhimurium TA1537, TA97, TA1538, TA98. High mutagenicity of these compounds is correlated with the position of nitro-groups and the effects of carboxylic and carboxyamide groups.

Amides↗

PubMed2001

3'-5' Exonucleolytic activity of DNA polymerases: structural features that allow kinetic discrimination between ribo- and deoxyribonucleotide residues.

We have determined rates for the excision of nucleotides from the 3' termini of chimeric DNA-RNA oligonucleotides using the Klenow fragment (KF) and two other DNA polymerases, from phages T4 and T7. For these studies, we synthesized DNA-RNA chimeric oligonucleotides with RNA residues in defined positions. When a ribonucleotide residue was placed at the 3' terminus, all three DNA polymerases removed it at the same rate as they did for substrates composed solely of deoxynucleotide residues. There was a decrease in the excision rate, however, when a ribonucleotide residue was located at the second or third position from the 3' terminus. When both the second and third positions were occupied by ribonucleotide residues, the excision rate for the 3' terminal nucleotide was reduced even further and was almost identical to the rate observed when the DNA polymerases encountered single-stranded RNA. The magnitude of the effect of ribonucleotide residues on the excision rate was lower when Mn(2+) replaced Mg(2+) as the essential divalent cation. Two KF mutations, Y423A and N420A, selectively affected the excision rates for the chimeric substrates. Specifically, Y423A totally abolished the rate reduction when there was a single ribonucleotide residue immediately preceding the 3' terminus, whereas N420A diminished, but did not eliminate, the rate reduction relative to that of wild-type KF when the single ribonucleotide residue occupied either the second or third position from the 3' terminus. These results are consistent with the structure of a KF-ss DNA complex from which it can be deduced, by modeling, that a 2' OH group on the second sugar from the 3' terminus would sterically clash with the Tyr 423 side chain, and a 2' OH group on the third sugar would clash with the side chain of Asn 420. The corresponding mutations in T4 DNA polymerase did not affect the rate of hydrolysis of the chimeric oligonucleotides. Thus, there appears to be a major difference in the kinetic behavior of KF and T4 DNA polymerase with respect to the exonuclease reaction. These results are discussed with respect to their possible biological relevance to DNA replication.

Bacteriophage T4↗

PubMed1997

Common and differential recognition of structural features in synthetic peptides by the catalytic domain and the Src-homology 2 (SH2) domain of pp60c-src.

The relative efficiencies of the catalytic domain of the src-family kinase pp60c-src in phosphorylating four peptide substrates including (i) src-optimal peptide (AEEEIYGEFEAKKKK), (ii) "-YEEI-peptide" (KKTHQEEEEPQYEEIPIYL), (iii) cdc2(6-20) (KVEKIGEGTYGVVYK), (iv) src-autophosphorylation site peptide (ADFGLARLIEDNEYTARG) and the relative efficiencies of its SH2 domain in binding the phosphorylated forms of these peptide substrates were compared. The results show that the src-optimal peptide, "-YEEI-peptide," cdc2(6-20) peptide were phosphorylated by the catalytic domain with high efficiency and that the phosphorylated form of all three peptides could bind the SH2 domain of the kinase, confirming the hypothesis proposed by Songyang and co-workers that the catalytic domain of pp60c-src phosphorylates sites which are recognized by its own SH2 domain (Songyang et al. (1995) Nature 373, 536-539). The four peptides were phosphorylated by the kinase with relative efficiencies in the order of Src-optimal peptide > "-YEEI-peptide" > cdc2(6-20) >> src-autophosphorylation site peptide. However, the Tyr(P)-Src-optimal peptide and [pY]15cdc2(6-20) bound to the SH2 domain of the kinase with an affinity at least an order of magnitude lower than that of the tight-binding peptide, "-pYEEI-peptide." Thus, our study suggests that the catalytic and SH2 domains of pp60c-src recognize overlapping but not identical determinants in the local structure around the tyrosine phosphorylation site of the substrate peptides.

Amino Acid Sequence↗

PubMed1984

Structural features of glutamine substrates for transglutaminases. Role of extended interactions in the specificity of human plasma factor XIIIa and of the guinea pig liver enzyme.

Amino acid residues at several locations in close primary vicinity to a substrate glutamine residue have been recognized as important determinants for the specificities of human plasma factor XIIIa and guinea pig liver transglutaminase (Gorman, J. J., and Folk, J. E. (1981) J. Biol. Chem. 256, 2712-2715). The present studies measure the influence on transglutaminase specificity of some changes in amino acid side chains in a small synthetic glutamine peptide amide, Leu-Gly-Leu-Gly-Gln-Gly-Lys-Val-Leu-GlyNH2, which was designed to contain most of the known elements needed for enzyme recognition. The results are in agreement with previous findings and show that full catalytic activity of each enzyme may be retained upon replacement of the lysine residue by certain other amino acid residues. Evidence is provided that serine in place of glycine at one or more positions causes a significant increase in specificity with factor XIIIa, but not with liver enzyme. The effective substrate property for factor XIIIa seen with the model peptide amide is lost upon reversal of the sequence Val-Leu. This is not the case with the liver enzyme even though replacement of either of these amino acids by alanine causes a pronounced loss in activity with this enzyme. These differences and the effects of various other substitutions in the model peptide amide on the enzymes' specificities points up the relatively stringent structural requirements of factor XIIIa and the rather broad requirements for liver transglutaminase.

Acyltransferases↗

PubMed2000

Structural features of the Pip/AzPip couple in the crystalline state: influence of the relative AzPip location in an azadipeptide sequence upon the induced chirality and conformational characteristics.

Azapipecolic (AzPip) is a pipecolic (Pip) residue analogue containing a nitrogen atom in place of the C(alpha)H group. AzPip was introduced into two reverse dipeptide sequences, Piv-AzPip-L-Ala-NHiPr I and Boc-L-Ala-AzPip-NHiPr II in order to evaluate, in the crystalline state, the influence of the L-Ala-induced chirality upon the prochiral AzPip residue, and therefore the resulting conformational characteristics, according to the relative position of the AzPip residue. Piv-DL-Pip-NHMe III served as a control derivative for comparison between the properties of the two different heterocycles of Pip and AzPip residues. Piperidine and hexahydropyridazine rings have a few characteristics in common: chair conformation, axial disposition of the C-terminal backbone substituent and the cisoid form of the N-terminal tertiary amide function. An almost pure sp3 hybridization state is observed for the substituted nitrogen atom N(alpha), so that L-Ala induces an AzPip (R) or (S) chirality when it follows or precedes, respectively, the azaresidue in such a pseudodipeptide sequence. If both I and II compounds present a short NH...N contact between the sp2 tertiary amide nitrogen atom and the NH of the next secondary amide function, whatever the chiral nature of the sequence, the heterochiral azadipeptide I adopts a rather totally extended conformation while the homochiral azadipeptide II is folded by a beta-VI turn-like structure stabilized by a classical 4-->1 intramolecular hydrogen bond.

Aza Compounds↗

PubMed1992

Structural features and sites of expression of a new murine 65 kD and 48 kD hair-related keratin pair, associated with a special type of parakeratotic epithelial differentiation.

In the course of studies on local keratin phenotypes in the epidermis of the adult mouse, we have identified a new 65 kD and 48 kD keratin pair. In mouse skin, this keratin pair is only expressed in suprabasal cells of adult mouse tail scale epidermis which is characterized by the complete absence of a granular layer and the formation of a remarkably compact stratum corneum. A second site in which the 65 kD and 48 kD keratin pair is suprabasally expressed and whose morphology corresponds to that of tail scale epidermis is found in the posterior unit of the complex filiform papillae of mouse tongue. The causal relationship of the expression of the 65 kD and 48 kD keratins with this particular type of a non-pathological epithelial parakeratosis is emphasized by the suppression of the mRNA synthesis of the two keratins during retinoic acid mediated orthokeratotic conversion of tail scale epidermis. Apart from tail scale epidermis and the posterior unit of the filiform papillae, the 65 kD and 48 kD keratin pair is, however, also coexpressed with "hard" alpha keratins in suprabulbar cells of hair follicles and in suprabasal cells of the central core unit of the lingual filiform papillae. The non alpha-helical domains of the two new keratins are rich in cysteine and proline residues and lack the typical subdomains into which epithelial keratins of both types can be divided. This structural resemblance of the 65 kD and 48 kD keratins to "hard" alpha keratins is supported by comparative flexibility predictions for their non alpha-helical domains. Phylogenetic investigations then show that the 65 kD and 48 kD keratin pair has evolved together with hair keratins, but has diverged from these during evolution to constitute an independent branch of a pair of hair-related keratins. In view of this exceptional position of the 65 kD and 48 kD keratins within the keratin multigene family, their expression has apparently been adopted by rare anatomical sites in which an orthokeratinized stratum corneum would be too soft and a hard keratinized structure would be too rigid to meet the functional requirement of the respective epithelia.

Amino Acid Sequence↗

PubMed1994

A beta-turn in alpha-amanitin is the most important structural feature for binding to RNA polymerase II and three monoclonal antibodies.

Four amatoxin-binding proteins with KD values in the nanomolar range, 3 monoclonal antibodies and RNA polymerase II, were studied with respect to their affinities to 24 alpha-amanitin derivatives with modified side chains. From KD values we estimated the amounts of binding energy that single side chains of the amatoxins contribute to complex formation. Ile6, previously identified by X-ray analysis to be part of a beta-turn (Kostansek EC, Lipscomb WN, Yocum RR, Thiessen WE, 1978, Biochemistry 17:3790-3795) proved to be of outstanding importance in all complexes. Replacement of the isoleucine with alanine reduced the affinity to all binding proteins to < 1%, suggesting a strong hydrophobic interaction. A strong effect was also seen when Gly5 was replaced with alanine, suggesting that the absence of a side chain in proximity to the beta-turn is likewise important. In addition to the beta-turn, each of the proteins showed at least 2 other points of strong contact formed by hydrogen bonds. Donors are the indole NH of 6'-hydroxy-Trp4 and OH of hydroxy-Pro2 and dihydroxy-Ile3. All the antibodies, but not RNA polymerase II, recognized the indole nucleus of 6'-hydroxy-Trp4. The geometric arrangement of the 4 strongest contact points suggests that the amatoxin binding site is different in each of the 4 proteins, except for the 2 antibodies raised in the same animal. Here, most of the contact points were identical but differed in strength of interaction. The method of structural analysis presented in this study is useful for identifying contact sites in complexes of proteins with peptides of rigid conformation. Furthermore, the method complements X-ray data by providing information on the amount of binding energy contributed by single structural elements.

Amanitins↗

PubMed1983

Binding of synthetic oligosaccharides to the hepatic Gal/GalNAc lectin. Dependence on fine structural features.

A series of synthetic oligosaccharides, resembling natural N-acetyllactosamine type glycans, were tested for their ability to inhibit the binding of labeled ligand to the mammalian hepatic lectin on rabbit hepatocytes at 2 degrees C. A dramatic hierarchy of inhibitory potency (tetraantennary greater than triantennary much greater than biantennary much greater than monoantennary) could be demonstrated. The range of concentration required for 50% inhibition of labeled ligand binding extended from approximately 1 mM, for the monoantennary oligosaccharides, to approximately 1 nM for triantennary oligosaccharides, even though the absolute Gal concentration increased only 3-fold. It was found that the number of Gal residues/cluster and their branching mode are major determinants of binding affinity of ligands to the hepatic lectin on the surface of hepatocytes.

Animals↗

PubMed1995

Thermodynamic and structural features of cooperative interactions in tandem oligonucleotide derivatives arranged at the complementary template. Chemical modification data.

General equations are derived for the limit yield [PZ] infinity of the intraduplex reaction between reactive oligonucleotide derivative X bearing p-(N-2-chloroethyl-N-methyl-amino)phenyl residue and oligonucleotide target P encompassing the sequence complementary to X in the presence of one or two oligonucleotide effectors E1 and E2. The latters form the complementary tandem sequence E1-X-E2 at the target. It is shown that association constants characterizing the affinity of the reagent X to the effector containing complexes PE1, PE2 and PE1E2 may be calculated from the dependencies of [PZ] infinity on the initial concentration chi 0 of X providing the sufficient excess of effectors is present. The approach was applied to reaction of C1RCH2NHpd(TTCCCA) with 26-mer dTTGCCTTGAATGGGAAGAGGGTCATT and effectors Phn-L-pd(TTCAAGG-C)p-L-Phn(E1) and Phn-L-pd(TGACCCTC)p-L-Phn(E2) where Phn- is N-(2-hydroxyethyl)-phenazinium residue and L is -NHCH2CH2NH- spacer. The association constants were found to be Kxe1 = 6.75 x 10(5)M-1, Kxe2 = 4.15 x 10(4)M-1 and Kxe12 = 5.87 x 10(6)M-1 as compared with the affinity of X to P Kx = 2.16 x 10(4)M-1 in the absence of effectors. The experiments on self-alkylation of target reactive derivative C1RCH2NHpd(TTGCCTTGAATGGGAAGAGGGTCATT) both in the presence and in the absence of effector E2 as well as the Molecular Mechanics calculations of its prereactive states showed target to form the hairpin secondary structure. Under reasonable suggestions taking into account the internal structure of the target co-operativity parameters describing the contribution of interactions of the terminal nucleotides of X with adjacent residues of effector were calculated and found to be alpha 1 = 16, alpha 2 = 10 and alpha 12 = 139 for the duplexes PXE1, PXE2 and PXE1E2, respectively.

Base Sequence↗

PubMed1994

N-cyclohexyl-N'-isopropylcarbodiimide: a hybrid that combines the structural features of DCC and DIC.

N-Cyclohexyl-N'-isopropylcarbodiimide was prepared and used for peptide couplings by various procedures. Reaction between Z-Val and Gly-OEt was used for yield studies and determination of the extent of the side reaction in solution. The value of this reagent for solid peptide synthesis was demonstrated by the synthesis of sequences comprising the 65-74 residues of acyl carrier protein. The efficiency of activation was determined by competition experiments. From all these studies the conclusion can be drawn that N-cyclohexyl-N'-isopropylcarbodiimide is comparable to or even better than the commonly used DCC for mediation of peptide bond formation in solid phase synthesis. By virtue of the solubility of N-cyclohexyl-N'-isopropylurea in dichloromethane, the carbodiimide seems to be a good candidate for practical execution of peptide bond formation by the standard carbodiimide procedure.

Carbodiimides↗

PubMed1975

Regional and systemic haemodynamic effects of some vasopressins: structural features of the hormone which prolong activity.

Cardiac output and regional blood flows to myocardium, gut, uterus and kidney were determined in anaesthetised female rats by a single injection of 86RbCl. The haemodynamic responses were measured at various time intervals up to 2 h after single I.V. injections of lysine-vasopressin and the following of its analogues: a) with extended peptide chains at the N-terminal (including "hormonogens") Nalpha-glycyl-glycyl-lysine-vasopressin, Nalpha-glycyl-glycyl-glycyl-arginine-vasopressin and Nalpha-D-valyl-lysine-vasopressin, b) "carba" modifications desamino-carba6-arginine-vasopressin, desamino-carba6-D-arginine8-vasopressin, desamino-carba6-ornithine8-vasopressin, desamino-dicarba-arginine-vasopressin and c) other steric alterations - desamino-D-arginine8-vasopressin and desamino-N-methylarginine8-vasopressin. Sub-pressor doses of lysine-vasopressin were followed by marked reductions in gut and uterus blood flows which reached a peak at 10 min. and had completely receded by 60 min. The presence of steric alterations in the C-terminal tripeptide of the molecule- D-arginine or N-methylarginine in sequence position 8 - practically completely eliminated vascular activity. The same was true for Nalpha-D-valyl-lysine-vasopressin. None of the latter three analogues showed any inhibitor properties to the action of lysine-vasopressin. The two hormonogens (triglycyl N-terminal extensions) had to be given in doses 10 times greater to obtain a vasoconstrictor effect in gut and uterus equivalent in amplitude to that of a lysine-vasopressin, but this effect was still present to the same degree 2 h later with the hormonogen of lysine-vasopressin, and was only starting to return to baseline values at the same time with the arginine-vasopressin hormonogen. The vascular potency of both mono-carba L-analogues was higher than that of lysine-vasopressin, and the effect was as prolonged as with the hormonogens. The dicarba analogue also showed a prolonged action, but with much reduced potency. No significant changes in renal or myocardial blood flows were observed at all. Molecular features of vasopressin smooth muscle activity were discussed, and a receptor model was proposed. It was suggested that the -S-S-, -CH2CH2-bridges in the above analogues are not directly bound in the peptide-receptor complex and constitute the limiting factor determining complex duration, or persistence of the active peptide in the "receptor compartment". These results provide an experimental basis for possible clinical application of triglycyl-vasopressin and carba-vasopressin in bleeding from both gut and uterus and for induction of menstruation.

Amino Acid Sequence↗

PubMedDate not supplied

Structural basis of light chain amyloidogenicity: comparison of the thermodynamic properties, fibrillogenic potential and tertiary structural features of four Vlambda6 proteins.

Primary (AL) amyloidosis results from the pathologic deposition of monoclonal light chains as amyloid fibrils. Studies of recombinant-derived variable region (VL) fragments of these proteins have shown an inverse relationship between thermodynamic stability and fibrillogenic potential. Further, ionic interactions within the VL domain were predicted to influence the kinetics of light chain fibrillogenicity, as evidenced from our analyses of a relatively stable Vlambda6 protein (Jto) with a long range electrostatic interaction between Asp and Arg side chains at position 29 and 68, respectively, and an unstable, highly fibrillogenic Vlambda6 protein (Wil) that had neutral amino acids at these locations. To test this hypothesis, we have generated two Jto-related mutants designed to disrupt the interaction between Asp 29 and Arg 68 (JtoD29A and JtoR68S). Although the thermodynamic stabilities of unfolding for these two molecules were identical, they exhibited very different kinetics of fibril formation: the rate of JtoD29A fibrillogenesis was slow and comparable to the parent molecule, whereas that of JtoR68S was significantly faster. High-resolution X-ray diffraction analyses of crystals prepared from the two mutants having the same space group and unit cell dimensions revealed no significant main-chain conformational changes. However, several notable side-chain alterations were observed in JtoR68S, as compared with JtoD29A, that resulted in the solvent exposure of a greater hydrophobic surface and modifications in the electrostatic potential surface. We posit that these differences contributed to the enhanced fibrillogenic potential of the Arg 68 mutant, since both Jto mutants lacked the intrachain ionic interaction and were equivalently unstable. The information gleaned from our studies has provided insight into structural parameters that in addition to overall thermodynamic stability, contribute to the fibril forming propensity of immunoglobulin light chains.

Amino Acid Sequence↗

PubMed1991

Structural features of the sulphated polysaccharide from a green seaweed, Cladophora socialis.

A sulphated heteropolysaccharide, [alpha]27D + 59.9 degrees, has been isolated from a green seaweed, Cladophora socialis, by extraction with dilute acid and purified by fractional precipitation. The polymer is composed of galactose (58.3%), arabinose (31.8%), xylose (10.6%) and sulphate (16.9%). The results of methylation analysis, periodate oxidation and partial acid hydrolysis studies indicate that the polymer is a branched one and is composed of 1,3-linked galactose and 1,4-linked arabinose units. Xylose is present at the non-reducing end position of the branches. Both arabinose and galactose carry branches. Desulphation and subsequent analysis of the polymer show that some of the arabinose units carry sulphate groups at C-3 and some of the galactose units carry the sulphate groups at C-4 and some at C-4 and C-6 as well.

Carbohydrate Sequence↗

PubMed2002

Element mixing distribution and structure feature of fusion zone in laser welding between different alloys and pure titanium.

OBJECTIVE: To study micro morphology and element-mixing distribution of different alloys welded in laser and analyze the feasibility of laser welding different alloys. METHODS: Alloys and titanium were matched into 4 groups: Au-Pt with Ni-Cr; Au-Pt with pure Ti; pure Ti with Ni-Cr; Ni-Cr with Co-Cr. They were welded in laser. Changes in metallography after hybridization of crystalline grain, ranges of heat-affected zone and pores were observed through SEM with ultra-thin windowed X-ray energy atlas. Meanwhile 10 testing points were chosen with area of 300 micro m x 900 micro m along the welding surface from the side A alloy to the side B alloy, than the element mixing distribution and tendency were analyzed with X-ray energy atlas. RESULTS: 1. Hybridization of different alloys: (l) in the group of Au-Pt with Ti, there was titanium element mixing into Au-Pt tissue gradually and evenly on the Au-Pt side of the interface without clear boundary and increasing in size of crystalline grain. However, there was titanium crystalline grain increasing in size, irregular morphology and small sacks on the titanium side with clear boundary. (2) in the group of Ni-Cr with Ti, there was mixing regularly, slow transition and interlocks between crystalline grains on the Ni-Cr side of the in terface. Poor transition, clear boundary and small cracks were observed on titanium side. (3) in the group of Co-Cr with Ni-Cr, there was good transition, obscure boundary on both sides resulting from network, cylinder and branch structure growing. 2. Element-mixing distribution of different alloys. In fusion zone, the metal elements in matched groups mixed well and hybridized into new alloys except titanium blocks. The location of wave peak depended on the composition of alloys. Most of elements were from the alloy far from the fusion zone. CONCLUSION: The hybridization between pure titanium and any other alloys is not good The effect of laser welding different alloys is ideal except with pure titanium.

Alloys↗

PubMedDate not supplied

Acetylcholinesterase staining in human auditory and language cortices: regional variation of structural features.

Cholinergic innervation of the cerebral neocortex arises from the basal forebrain and projects to all cortical regions. Acetylcholinesterase (AChE), the enzyme responsible for deactivating acetylcholine, is found within both cholinergic axons arising from the basal forebrain and a subgroup of pyramidal cells in layers III and V of the cerebral cortex. This pattern of staining varies with cortical location and may contribute uniquely to cortical microcircuitry within functionally distinct regions. To explore this issue further, we examined the pattern of AChE staining within auditory, auditory association, and putative language regions of whole, postmortem human brains. The density and distribution of acetylcholine-containing axons and pyramidal cells vary systematically as a function of auditory processing level. Within primary auditory regions AChE-containing axons are dense and pyramidal cells are largely absent. Adjacent cortical regions show a decrease in the density of AChE-containing axons and an increase in AChE-containing pyramidal cells. The posterior auditory and language regions contain a relatively high density of AChE-containing pyramidal cells and AChE-containing axons. Although right and left posterior temporal regions are functionally asymmetrical, there is no apparent asymmetry in the general pattern of AChE staining between homologous regions of the two hemispheres. Thus, the pattern of AChE staining covaries with processing level in the hierarchy of auditory cortical regions, but does not vary between the functionally distinct right and left posterior regions. An asymmetry in the size of layer III AChE-rich pyramidal cells was present within a number of cortical regions. Large AChE-rich pyramidal cells of layer III were consistently greater in size in the left hemisphere as compared to the right. Asymmetry in layer III pyramidal cell size was not restricted to language-associated regions, and could potentially have a variety of etiologies including structural, connectional, and activational differences between the left and right hemisphere.

Acetylcholinesterase↗

PubMed1989

Broxaterol: pharmacological profile of a unique structural feature.

A series of 1-(3-substituted-5-isoxazolyl)-2-alkylaminoethanol derivatives was synthesized in order to evaluate the effectiveness of the isoxazole ring in replacing the catechol moiety of beta-adrenergic compounds. Among the investigated compounds, 1-(3-bromo-5-isoxazolyl)-2-tert-butyl aminoethanol hydrochloride, named broxaterol hydrochloride (laboratory code Z 1170), resulted to be the most potent and selective beta 2-agonist of the series. In vitro studies confirmed the beta 2-agonist profile of broxaterol, which showed a marked bronchodilating activity in different experimental models. Interestingly, besides its direct effect in relaxing bronchial smooth muscle, broxaterol was, also, very effective in inhibiting asthmogenic mediator release both in vitro and in vivo. The preclinical studies demonstrated that the similar potency observed in vitro for both broxaterol and salbutamol resulted in a higher effectiveness of broxaterol with respect to salbutamol, when the compounds were given by oral route. These findings account for a probably greater bioavailability of broxaterol after oral administration.

Adrenergic beta-Agonists↗

PubMed1993

Studies on the yeast proteasome uncover its basic structural features and multiple in vivo functions.

Proteasomes are large multicatalytic protease complexes found in the cytoplasm and nucleus of all eukaryotic cells. 20S proteasomes are cylindrically shaped particles composed of a set of different subunits arranged in a stack of 4 rings with 7-fold symmetry. In yeast 14 different genes are known, which are proposed to code for the complete set of 20S proteasomal subunits. They can be divided in 7 alpha- and 7 beta-type subunits. 26S proteasomes are even larger proteinase complexes which contain the 20S proteasome as the functional proteolytic core. They degrade ubiquitinylated proteins in vitro. Several yeast 26S proteasome subunits have been characterized as members of a novel ATPase family. Studies with yeast 20S and 26S proteasome mutants uncovered the function of proteasomes in stress-dependent and ubiquitin-mediated proteolytic pathways. Proteasomes are important for cellular regulation, cell differentiation, adaptation to environmental changes and are involved in cell cycle control.

Animals↗