SEARCH · PubMed Health

Results for “Translational repression”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,027 records · Page 57Linked to original sources

PubMed2002

S6 phosphorylation-independent pathways regulate translation of 5'-terminal oligopyrimidine tract-containing mRNAs in differentiating hematopoietic cells.

Synthesis of new ribosomes is an energy costly and thus highly regulated process. Ribosomal protein synthesis is controlled by regulating translation of the corresponding ribosomal protein (rp)mRNAs. In mammalian cells a 5'-terminal oligopyrimidine tract (TOP) is a conserved feature of these mRNAs that has been demonstrated to be essential for their translational regulation. Translation of TOP mRNAs has been proposed to be regulated by phosphorylation of ribosomal protein S6, which is a common effect of mitogenic stimulation of cells. However, as demonstrated here, S6 phosphorylation is not detectable in murine erythroleukemia (MEL) or other hematopoietic cells. The absence of S6 phosphorylation appears to be due to the action of a phosphatase that acts downstream of S6 kinase, presumably on S6 itself. Despite the absence of changes in S6 phosphorylation, translation of TOP mRNAs is repressed during differentiation of MEL cells. These data demonstrate the existence of a mechanism for regulating S6 phosphorylation that is distinct from kinase activation, as well as the existence of mechanisms for regulating translation of TOP mRNAs that are independent of S6 phosphorylation.

5' Flanking Region↗

PubMed1976

Yeast cytochrome c messenger RNA. In vitro translation and specific immunoprecipitation of the CYC1 gene product.

An assay based upon indirect immunoprecipitation has been developed for yeast cytochrome c and apocytochrome c. The specificity of this assay was demonstrated by its ability to selectively precipitate cytochrome c from an autolysate of yeast cell proteins. Translation of the polypeptide chain of cytochrome c in a wheat germ extract programmed with yeast poly(A) RNA was demonstrated using this immunoprecipitation assay. Translation of poly(A) RNA from yeast strains carrying nonsense mutations in the cyc1 gene yielded in vitro cytochrome c polypeptides which were shorter than the wild type protein by the amount expected for polypeptide chains which had terminated at the nonsense codon. The in vivo rate of cytochrome c synthesis was shown to be 6-fold greater in derepressed cells than in glucose-repressed cells. The 6-fold difference is sufficient to account for the 6-fold higher level of cytochrome c in derepressed than in repressed cells. The level of translatable cytochrome c mRNA is at least 4 times as high in derepressed as in glucose-repressed cells, suggesting that regulation occurs at some step in the synthesis of this messenger.

Cytochrome c Group↗

PubMed1995

The intracellular localization of messenger RNAs.

As I hope this review has made clear, mRNA localization plays an important role in directing specific proteins to their correct position within a cell. Although the study of this process is still in its infancy, it is already apparent that there are several ways that mRNAs can be targeted to particular subcellular sites. However, the molecular mechanisms responsible for these different localization pathways are still largely obscure, and their elucidation must await the identification of the specific factors that mediate the interactions between the localized mRNAs and more general components such as the cytoskeleton. Most examples of localized mRNAs are likely to share several common features. First, the site of localization will be determined by the preexisting polarity of the cell, and this will most often depend on the organization of the cytoskeleton, either directly, in the case of active transport, or indirectly, when localization is mediated by localized anchoring sites or stability factors. Second, mRNA localization is likely to be tightly coupled to translational control. If it is important for a cell to synthesize a protein in a particular place, then the translation of the mRNA must be repressed until it is localized. Indeed, there are already several examples where the direct linkage between translational control and localization has been demonstrated, and these are discussed in the accompanying review by Curtis et al. (1995).

Animals↗

PubMed2006

IMP1 interacts with poly(A)-binding protein (PABP) and the autoregulatory translational control element of PABP-mRNA through the KH III-IV domain.

Repression of poly(A)-binding protein (PABP) mRNA translation involves the formation of a heterotrimeric ribonucleoprotein complex by the binding of PABP, insulin-like growth factor II mRNA binding protein-1 (IMP1) and the unr gene encoded polypeptide (UNR) to the adenine-rich autoregulatory sequence (ARS) located at the 5' untranslated region of the PABP-mRNA. In this report, we have further characterized the interaction between PABP and IMP1 with the ARS at the molecular level. The dissociation constants of PABP and IMP1 for binding to the ARS RNA were determined to be 2.3 nM and 5.9 nM, respectively. Both PABP and IMP1 interact with each other, regardless of the presence of the ARS, through the conserved C-terminal PABP-C and K-homology (KH) III-IV domains, respectively. Interaction of PABP with the ARS requires at least three out of its four RNA-binding domains, whereas KH III-IV domain of IMP1 is necessary and sufficient for binding to the ARS. In addition, the strongest binding site for both PABP and IMP1 on the ARS was determined to be within the 22 nucleotide-long CCCAAAAAAAUUUACAAAAAA sequence located at the 3' end of the ARS. Results of our analysis suggest that both protein x protein and protein x RNA interactions are involved in forming a stable ribonucleoprotein complex at the ARS of PABP mRNA.

5' Untranslated Regions↗

PubMed2003

Hallmarks of ion channel gene expression in end-stage heart failure.

Electrical conductance is greatly altered in end-stage heart failure, but little is known about the underlying events. We therefore investigated the expression of genes coding for major inward and outward ion channels, calcium binding proteins, ion receptors, ion exchangers, calcium ATPases, and calcium/calmodulin-dependent protein kinases in explanted hearts (n=13) of patients diagnosed with end-stage heart failure. With the exception of Kv11.1 and Kir3.1 and when compared with healthy controls, major sodium, potassium, and calcium ion channels, ion transporters, and exchangers were significantly repressed, but expression of Kv7.1, HCN4, troponin C and I, SERCA1, and phospholamban was elevated. Hierarchical gene cluster analysis provided novel insight into regulated gene networks. Significant induction of the transcriptional repressor m-Bop and the translational repressor NAT1 coincided with repressed cardiac gene expression. The statistically significant negative correlation between repressors and ion channels points to a mechanism of disease. We observed coregulation of ion channels and the androgen receptor and propose a role for this receptor in ion channel regulation. Overall, the reversal of repressed ion channel gene expression in patients with implanted assist devices exemplifies the complex interactions between pressure load/stretch force and heart-specific gene expression.

Action Potentials↗

PubMed2004

Regulation of local mRNA translation.

Regulated local mRNA translation is one mechanism cells employ to concentrate proteins in particular locations. However, cells use many different strategies to accomplish this task; for example, some mRNAs are destroyed in regions where they are not wanted, other mRNAs are repressed in areas where their translation would be deleterious, and yet other mRNAs are transported, in a quiescent state, to the sites where their translation is activated. The importance of local translation cannot be overstated, for, depending on the species or cell type, it is required for cell division, establishment of mating type, development and memory formation.

Animals↗

PubMed2006

The nuclear receptor transcriptional coregulator RIP140.

The nuclear receptor superfamily comprises ligand-regulated transcription factors that control various developmental and physiological pathways. These receptors share a common modular structure and regulate gene expression through the recruitment of a large set of coregulatory proteins. These transcription cofactors regulate, either positively or negatively, chromatin structure and transcription initiation. One of the first proteins to be identified as a hormone-recruited cofactor was RIP140. Despite its recruitment by agonist-liganded receptors, RIP140 exhibits a strong transcriptional repressive activity which involves several inhibitory domains and different effectors. Interestingly, the RIP140 gene, located on chromosome 21 in humans, is finely regulated at the transcriptional level by various nuclear receptors. In addition, the protein undergoes several post-translational modifications which control its repressive activity. Finally, experiments performed in mice devoid of the RIP140 gene indicate that this transcriptional cofactor is essential for female fertility and energy homeostasis. RIP140 therefore appears to be an important modulator of nuclear receptor activity which could play major roles in physiological processes and hormone-dependent diseases.

Journal Article↗

PubMed1994

Coordinate regulation of glucocorticoid receptor and c-jun mRNA levels: evidence for cross-talk between two signaling pathways' at the transcriptional level.

Autologous regulation of steroid receptors by their cognate ligands has been demonstrated for a number of nuclear receptor family members. To determine the molecular mechanism for glucocorticoid receptor (GR) autoregulation, the expression of glucocorticoid receptor mRNA and protein levels were examined in the mouse AtT-20 pituitary tumor cell line. The expression of c-jun and c-fos mRNA and protein was also examined in the same cell extracts. A rapid down-regulation of the GR protein was observed after treatment with the glucocorticoid analog, triamcinolone acetonide (TA). An oscillatory, parallel regulation of both GR and c-jun mRNA levels occurred. In contrast, POMC mRNA levels remained at a stable, low level during chronic TA treatment. Dose-response analyses also revealed a coordinate down-regulation of GR and c-jun (but not POMC or c-fos) mRNA levels. FOS protein levels were unaffected by TA treatment. Surprisingly, JUN protein levels were increased by TA, even when the c-jun mRNA levels were decreasing. Perhaps a derepression of c-jun mRNA translation occurs after TA treatment, and this may be due to GR/JUN heteromer formation interfering with JUN repression of c-jun mRNA translation. The effect of TA on GR and c-jun gene expression was a primary effect, as it occurred rapidly and was not inhibited by cycloheximide (CHX). Nuclear run-on transcription assays revealed a rapid (15 min) down-regulation in both GR and c-jun gene transcription rates, while POMC gene transcription was unaffected at this early time. Treatment of AtT-20 cells with all-trans retinoic acid gave different kinetics for GR and c-jun mRNA regulation than obtained with TA; however, the GR and c-jun mRNA levels were still coordinately regulated after retinoic acid treatment. Based upon these data, the promoter structures of the GR and c-jun genes, and previously published results, a novel mechanism for the coupled regulation of GR and c-jun transcription, via a direct transcriptional interference with AP-1 (FOS/JUN) activity, is proposed.

Animals↗

PubMed2005

Epigenetic regulation of the binding activity of translation inhibitory proteins that bind the 3' untranslated region of beta-F1-ATPase mRNA by adenine nucleotides and the redox state.

Here, we describe the binding affinities and the regulation of the binding activities of the fetal liver proteins that interact with the 3' untranslated region of beta-F1-ATPase mRNA (beta-mRNA). These proteins (3'beta FBPs), which are involved in the repression of beta-mRNA translation during fetal development, have poly(A)-binding activity. Reducing agents do not affect the RNA-binding activity of 3'beta FBPs. In contrast, oxidizing and alkylating reagents abolished the binding activity of 3'beta FBPs to its target RNA element, an effect that is partially prevented by the presence of reducing agents. Interestingly, the availability of adenine nucleotides regulates in a concentration-dependent manner the binding activities of 3'beta FBPs. The results suggest that epigenetic changes that occur at the time of birth affecting both the redox and energy state of the liver play a relevant role in the regulation of the binding activities of 3'beta FBPs and therefore in the translation of beta-mRNA.

3' Untranslated Regions↗

PubMed1998

Translational control of viral and host protein synthesis during the course of herpes simplex virus type 1 infection: evidence that initiation of translation is the limiting step.

Herpes simplex virus type 1 (HSV-1) infection induces the selective shut-off of host protein synthesis, other than ribosomal proteins, and the successive synthesis of viral proteins. Because viral mRNAs persist in the cytoplasm after viral protein synthesis has been inhibited, we hypothesized that viral gene expression may be under translational control. Expression of genes encoding immediate early ICP27, early DBP and late US11 proteins, together with glyceraldehyde-3-phosphate dehydrogenase (GAPDH), was monitored over the course of infection at the level of mRNA and protein synthesis. After an efficient synthesis beginning with the appearance of successive viral mRNAs in the cytoplasm, synthesis of viral proteins was shut off similarly to the synthesis of GAPDH. This shut-off was not achieved by mRNA degradation but by progressive shifts of viral mRNAs from large polyribosomes to smaller ones, then to 40S ribosomal subunits. Transient expression of the UL41 gene alone, directing synthesis of virion-associated host shut-off (VHS) protein, induced efficient mRNA degradation, but did not impair recruitment of the remaining GAPDH and beta-actin mRNAs into polyribosomes. These results indicate that HSV-1 induces a selective repression of initiation of mRNA translation which is probably the main cause of the shut-off of viral protein synthesis, and which contributes to the repression of host protein synthesis. VHS protein is not directly involved in this repression, at least in the absence of other viral proteins.

Cell Line↗

PubMed1993

Translational regulation of tra-2 by its 3' untranslated region controls sexual identity in C. elegans.

C. elegans hermaphrodites make sperm and then oocytes in an otherwise female animal. Gain-of-function mutations in the sex-determining gene tra-2 (tra-2(gf)) transform hermaphrodites into females (spermless hermaphrodites). The tra-2(gf) mutations map to a perfect direct repeat in the 3' untranslated region; each repeat is called a direct repeat element (DRE). Three experiments demonstrate that DREs repress tra-2 at the translational level. First, tra-2(gf) mRNAs are associated with larger polysomes than are their wild-type counterparts. Second, translation of a reporter RNA is inhibited by DREs. Third, disruption of DREs does not increase tra-2 mRNA levels. An RNA binding activity specifically associates with the DREs. We propose that tra-2 translation is inhibited by association of an RNA binding-factor with the DREs and that this translational control is essential for development of C. elegans as a hermaphrodite/male species.

Animals↗

PubMed1996

Uncoupling of transcription and translation during zygotic gene activation in the mouse.

Zygotic gene expression in mice is delayed by a time-dependent mechanism until the two-cell stage in development. To investigate the basis of this 'zygotic clock', the firefly luciferase gene was injected into mouse embryos, and quantitative assays were used to monitor luciferase gene transcription and translation in individual embryos from single mothers. These studies confirmed, at the mRNA level, previous conclusions about the relative capacities of paternal and maternal pronuclei to transcribe genes, and the requirements for promoters and enhancers during zygotic gene activation. Furthermore, these studies revealed that fertilized mouse eggs can delay expression of zygotic genes by uncoupling translation from transcription. An RNA polymerase II-dependent gene could be translated until zygotic gene expression began (a delay of up to 15 h after injection). The time course for nascent mRNA accumulation was biphasic, with the second phase occurring during zygotic gene expression. If the luciferase gene was injected after zygotic gene expression had begun, then translation was tightly linked to transcription. If the second phase of mRNA accumulation was repressed, then luciferase was not produced. Therefore, translation was linked to the accumulation of mRNA during the onset of zygotic gene expression. Similar biphasic time courses also were observed for RNA polymerase I- and III-dependent transcription. These and other results reveal that the zygotic clock regulates the onset of both transcription and translation of zygotic genes.

Amanitins↗

PubMed2000

Protein kinase-A dependent phosphorylation of transcription enhancer factor-1 represses its DNA-binding activity but enhances its gene activation ability.

The cAMP-dependent signaling pathway has been implicated in cardiac cell growth/differentiation and muscle gene transcription. Previously, we have identified a cAMP-inducible E-box/M-CAT hybrid motif in the cardiac alpha-myosin heavy chain (alpha-MHC) gene promoter. The two factors, TEF-1 and Max, that bind to this motif are found to physically associate with each other and exert a positive cooperative effect for gene regulation. Here we show that TEF-1, but not Max, is a substrate for protein kinase-A (PK-A)-dependent phosphorylation. TEF-1 is phosphorylated by PK-A at residue serine-102. This post-translational modification of TEF-1 repressed its DNA-binding activity, but not its ability to interact with the Max protein. Replacement of serine-102 in TEF-1 by a neutral or a charged amino acid did not abolish its DNA-binding ability, suggesting that changing a charge at the 102 amino-acid position of TEF-1 was not sufficient to inhibit its DNA-binding activity. We also show that PK-A response of the alpha-MHC gene is stimulated by the presence of wild-type TEF-1 but not by mutant TEF-1 having serine-102 replaced by alanine, suggesting that phosphorylation at this residue accounts for the cAMP/PK-A response of the gene. Thus, these data demonstrate that TEF-1 is a direct target of cAMP/PK-A signaling in cardiac myocytes.

Amino Acid Sequence↗

PubMed1994

Autogenous translational regulation of the ribosomal MvaL1 operon in the archaebacterium Methanococcus vannielii.

The mechanisms for regulation of ribosomal gene expression have been characterized in eukaryotes and eubacteria, but not yet in archaebacteria. We have studied the regulation of the synthesis of ribosomal proteins MvaL1, MvaL10, and MvaL12, encoded by the MvaL1 operon of Methanococcus vannielii, a methanogenic archaebacterium. MvaL1, the homolog of the regulatory protein L1 encoded by the L11 operon of Escherichia coli, was shown to be an autoregulator of the MvaL1 operon. As in E. coli, regulation takes place at the level of translation. The target site for repression by MvaL1 was localized by site-directed mutagenesis to a region within the coding sequence of the MvaL1 gene commencing about 30 bases downstream of the ATG initiation codon. The MvaL1 binding site on the mRNA exhibits similarity in both primary sequence and secondary structure to the L1 regulatory target site of E. coli and to the putative binding site for MvaL1 on the 23S rRNA. In contrast to other regulatory systems, the putative MvaL1 binding site is located in a sequence of the mRNA which is not in direct contact with the ribosome as part of the initiation complex. Furthermore, the untranslated leader sequence is not involved in the regulation. Therefore, we suggest that a novel mechanism of translational feedback regulation exists in M. vannielii.

Base Sequence↗

PubMed2006

LrhA regulates rpoS translation in response to the Rcs phosphorelay system in Escherichia coli.

Regulation of the Escherichia coli stationary-phase sigma factor RpoS is complex and occurs at multiple levels in response to different environmental stresses. One protein that reduces RpoS levels is the transcription factor LrhA, a global regulator of flagellar synthesis. Here we clarify the mechanism of this repression and provide insight into the signaling pathways that feed into this regulation. We show that LrhA represses RpoS at the level of translation in a manner that is dependent on the small RNA (sRNA) chaperone Hfq. Although LrhA also represses the transcription of the sRNA RprA, its regulation of RpoS mainly occurs independently of RprA. To better understand the physiological signals affecting this pathway, a transposon mutagenesis screen was carried out to find factors affecting LrhA activity levels. The RcsCDB phosphorelay system, a cell envelope stress-sensing pathway, was found to repress lrhA synthesis. In addition, mutations in the gene encoding the DNA motor protein FtsK induce lrhA synthesis, which may explain why such strains fail to accumulate RpoS in stationary phase.

Bacterial Proteins↗

PubMed2002

Selective killing of cancer cells based on translational control of a suicide gene.

The translation initiation factor, eIF4E, is commonly overexpressed in solid tumors. This elevation allows for efficient translation of mRNA that are normally repressed by their 5' untranslated region, many of which encode growth-promoting proteins. This property was exploited to modulate the synthesis of HTK at the translational level to selectively kill cancer cells. Various breast cancer cell lines can efficiently synthesize HTK from the translationally regulated mRNA, whereas normal cells cannot. Accordingly, only cancer cells were killed at low concentrations of ganciclovir. By altering the expression of eIF4E, it was possible to modulate the sensitivity of various cell lines to ganciclovir.

Antiviral Agents↗

PubMed1995

Characterization of a specific interaction between Escherichia coli thymidylate synthase and Escherichia coli thymidylate synthase mRNA.

Previous studies have shown that human TS mRNA translation is controlled by a negative autoregulatory mechanism. In this study, an RNA electrophoretic gel mobility shift assay confirmed a direct interaction between Escherichia coli (E.coli) TS protein and its own E.coli TS mRNA. Two cis-acting sequences in the E.coli TS mRNA protein-coding region were identified, with one site corresponding to nucleotides 207-460 and the second site corresponding to nucleotides 461-807. Each of these mRNA sequences bind TS with a relative affinity similar to that of the full-length E.coli TS mRNA sequence (IC50 = 1 nM). A third binding site was identified, corresponding to nucleotides 808-1015, although its relative affinity for TS (IC50 = 5.1 nM) was lower than that of the other two cis-acting elements. E.coli TS proteins with mutations in amino acids located within the nucleotide-binding region retained the ability to bind RNA while proteins with mutations at either the nucleotide active site cysteine (C146S) or at amino acids located within the folate-binding region were unable to bind TS mRNA. These studies suggest that the regions on E.coli TS defined by the folate-binding site and/or critical cysteine sulfhydryl groups may represent important RNA binding domains. Further evidence is presented which demonstrates that the direct interaction with TS results in in vitro repression of E.coli TS mRNA translation.

Base Sequence↗

PubMed1988

Multiple regulatory mechanisms control the expression of the RAS1 and RAS2 genes of Saccharomyces cerevisiae.

Expression of the RAS1 and RAS2 genes of Saccharomyces cerevisiae has been examined at the transcriptional and translational levels. When dextrose is the carbon source, the steady-state amount of RAS1 mRNA and the rate of RAS1 protein synthesis are reduced in parallel as cells approach the mid-exponential phase of growth. RAS1 mRNA levels and protein synthesis are very low at all stages of growth when ethanol rather than dextrose is provided as the sole carbon source. The rate of RAS2 protein synthesis is regulated differently. In cells cultured on dextrose, it is lowest in the early exponential phase, increases approximately 10-fold and remains nearly constant as cells approach stationary phase. By contrast, RAS2 mRNA is found at uniformly high levels at all phases of exponential growth, suggesting that the translational efficiency of RAS2 mRNA is repressed during the early exponential phase. This repression is not observed when ethanol is the sole carbon source. Nutrient starvation, resulting in G1 arrest and sporulation in diploids, leads to greatly decreased amounts of RAS2 mRNA, accomplished in part by selective repression of RAS2 transcripts with particular 5' ends. However, this reduction in RAS2 mRNA levels has little effect on the rate of RAS2 protein synthesis, suggesting that the translational efficiency of RAS2 mRNA is stimulated by nutrient starvation. The combination of transcriptional and translational controls which regulate yeast RAS gene expression seems to ensure that one or the other RAS proteins will be produced over a wide range of physiological states.

Cell Cycle↗