PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “PLACENTAL EXTRACTS”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,045 records · Page 58Linked to original sources
PubMed2003

Binding of AP-2 and ETS-domain family members is associated with enhancer activity in the hypersensitive site III region of the human growth hormone/chorionic somatomammotropin locus.

The human GH gene family is specifically expressed in somatotrophs of the anterior pituitary and placental syncytiotrophoblast. Two nuclease-hypersensitive sites, HS III and HS V, are associated with a region of chromatin located 28 and 30 kb upstream of the pituitary GH gene transcription initiation site (+1) in both pituitary and placenta nuclei. A role for this region in pituitary GH gene expression has been reported, but the potential relevance to placental gene expression has not been determined. Deletion analysis of a 5.2-kb region (nucleotides - 27,568/-32,746) containing HS III to V-related sequences localized significant enhancer activity to a 574-bp HS III fragment (nucleotides -27,676/-28,249) in multiple transfected cell lines. Four nuclease-protected regions [footprints (FP) 1-4] were identified in the 574-bp fragment. FP2 and FP3 were detected with placenta cell nuclear protein, whereas FP1 and FP4 were observed with placental and nonplacental cell nuclear extract. Disruption of FP1 had no effect on heterologous promoter activity in transfected pituitary and placental cells, whereas loss of FP2 and FP3 resulted in modest increases in placental cells, reflecting the presence of repressor activity associated with these regions in vitro. In contrast, disruption of the FP4 region by mutation or deletion significantly reduced enhancer activity. As a result, 30-fold enhancer activity was localized to a 41-bp region in transfected placental tumor cells. Binding of candidate proteins, activator protein (AP)-2 (FP3) and Elk-1 (FP4), was confirmed using competition assays with specific oligonucleotides and antibodies. Moreover, these factors were associated with the hyperacetylated HS III region in human pituitary [activator protein 2 (AP-2) and Elk-1] and term placenta (AP-2) chromatin. These data implicate AP-2 and ETS-domain family members in the regulation of the GH/CS locus and raise the possibility that different complexes form in the HS III region in placenta and pituitary cells.

Acetylation↗
PubMed1995

[mRNA expression and protein localization of placental tissue protein 11, 12, 19 in gynecologic malignant tumors].

In recent years, the localization and function of placental tissue proteins (PPs), extracted by Bohn et al., have been extensively studied, the genetic code has been identified for each of the PPs. The present study was carried out to clarify the mRNA expression and protein localization of PP11, PP12, PP19 at the cell level and also to define PP19 the nature of which has remained obscure. PP19 was said to be placenta-derived S-100P. PP11 mRNA was not expressed in cytotrophoblast-derived normal placental tissue or endometrium-derived normal cells, but was expressed in syncytiotrophoblast-derived normal placental tissue, and in choriocarcinoma and endometrial adenocarcinoma, suggesting its involvement in carcinogenesis. PP12 mRNA was expressed in cytotrophoblast-derived normal placental tissue or endometrium-derived normal cells, but was not expressed in syncytiotrophoblast-derived normal placental tissue, choriocarcinoma or endometrial adenocarcinoma, suggesting that this protein serves in the function of normal cells. PP19 mRNA was expressed in the squamous epithelial cells of the uterine cervix and the villous cells, PP19 was localized in more differentiated regions, where cells tended toward keratinization, in both normal and dysplastic uterine cervices. In squamous cell carcinoma, PP19 was localized in more differentiated cells with a large cytoplasm. PP19 mRNA was not expressed in normal endometrial glands, but was detected in endometrial adenocarcinoma, suggesting its involvement in cell differentiation in cervical epitherial cells.

Base Sequence↗
PubMed1998

Functional map of a placenta-specific enhancer of the human leukemia inhibitory factor receptor gene.

We recently reported a placenta-specific enhancer in the human leukemia inhibitory factor receptor (LIFR) gene and now show detailed characterization of the 226-base pair enhancer (-4625/-4400 nucleotides). Four of twenty-two mutants in linker analysis showed reduced promoter activities to 45, 30, 10, and 10%, respectively. Specific binding of region A (-4617/-4602) with nuclear extract was competed by a known Oct-1 oligo and supershifted by Oct-1 antibody. Specific binding of region B (-4549/-4535) was competed by a GATA oligo, but could not be supershifted by four GATA antibodies. Nevertheless, mutagenesis showed that critical bases in region B were identical to the GATA core motif, indicating that region B may bind to a novel GATA family transcription factor. The other two adjacent regions designated as region C (-4464/-4445) showed no known consensus binding sites, and their specific placental JEG-3 nuclear extract binding was not evident in nonplacental nuclear extracts and was not competed by a trophoblast specific element (TSE), indicating that region C is a novel placenta-specific element (PSE, CATTTCCTGAACTAGTTTTT). Footprinting localized the binding boundary of PSE-binding protein (PSEB), and three Gs were found to be important for specific PSE binding. UV cross-linking showed that PSEB had a molecular mass of approximately 160 kDa, substituting the PSE with two previously reported placenta elements TSE or chorionic somatomammotropin enhancer factor 1 (CSEF-1) motifs resulted in markedly different promoter activities, indicating that PSEB is indeed different from TSE binding protein or CSEF-1. These results are the first demonstration that a novel PSE is the major element for placenta-specific enhancer activity in human LIFR gene.

Binding Sites↗
PubMed1999

Concentrations of activin A, inhibin A and follistatin in human amnion, choriodecidual and placental tissues at term and preterm.

To investigate labour-associated changes in production of activin and related hormones by gestational tissues we prepared extracts from amnion, choriodecidual and placental tissues delivered at term before labour (TNL; n=15), at term after spontaneous labour (TSL; n=15) or preterm (PTD; n=31) and measured concentrations of inhibin A, activin A and follistatin by ELISA. Activin concentrations in placental tissues were significantly (Mann-Whitney U-test; P<0.05) elevated with term labour (pg/mg protein, median; 1313 vs 2591), but in the PTD tissues concentrations were lower than those delivered spontaneously at term (3650 vs 2649). Inhibin concentrations also increased with term labour in the placenta (480 vs 686), but paradoxically decreased in amnion (188 vs 64) and choriodecidua (657 vs 358). Little or no significant changes in follistatin concentrations were observed. Concentrations of all three proteins were significantly correlated between amnion and choriodecidual tissues, and were significantly correlated with each other in most tissues (Spearman's ranked correlation; P<0.05). The activin:inhibin ratio in term amnion and choriodecidual tissues was increased 2 to 3-fold (P<0.0005 by Mann-Whitney U-test) after term labour, with similar trends also observed in the activin:follistatin ratio in placental tissue. These data suggest that a modest increase in placental activin and inhibin production may occur with labour at term. In addition, an increase in activin bioactivity may occur with labour, potentiating any paracrine effects of activin during parturition. The data, however, do not support an association between increased intrauterine activin biosynthesis and preterm delivery.

Activins↗
PubMed1989

Placental protein 14 (PP14) content and immunosuppressive activity of human cervical mucus.

Extracts of cervical mucus contain measurable levels of placental protein 14 (PP14), a protein known to suppress proliferative responses of human peripheral blood lymphocytes. Such extracts have been shown to exert suppressive activities on allogeneically stimulated peripheral blood lymphocytes in a dose-dependent manner. However, there was no correlation between the PP14 content of cervical mucus samples and their suppressive activities. Such activity could not be removed from the extracts by dialysis, suggesting high molecular weight mediators. These results indicate that there may be an immunosuppressive factor in human cervical mucus which functions to protect inseminated sperm in a potentially immunologically hostile environment in the female reproductive tract.

Cells, Cultured↗
PubMed1983

The effect of a ribonuclease inhibitor from human placenta on the in vitro synthesis of human placental proteins.

Addition of a ribonuclease inhibitor (10 micrograms/ml) from human placenta caused 2-3-fold increase of [3H]leucine incorporation in the wheat germ extract as directed by human placental poly (A)-mRNA. Analysis of the translated products by sodium dodecyl sulfate/polyacrylamide gel electrophoresis/fluorography revealed that the inhibitor preferentially increased the yields of the larger proteins, particularly those of larger than Mr 40 000. In the presence of the inhibitor, yields of two placental proteins (human placental lactogen and human chorionic gonadotropin) were increased about 70-80% as detected by immunoprecipitation with specific homologous antisera. The method provided an improvement of translation system for studying biosynthesis of other human placental proteins.

Cell-Free System↗
PubMed1995

Characterization of placental transcriptional activation of the human gene for P450scc.

Steroid hormones, which are ubiquitous regulators of physiologic processes, are produced primarily in the adrenals, gonads, and placenta. Each steroidogenic cell type produces different steroids due to cell-specific expression of various steroidogenic enzymes, but all steroidogenesis is initiated by P450scc, the mitochondrial enzyme that converts cholesterol to pregnenolone. We previously showed the unique segments of the P450scc promoter that are responsible for basal and cAMP-induced expression of this gene in the placenta are not employed for expression in the adrenal (C.C.D. Moore, D.W. Hum, and W.L. Miller, Mol. Endocrinol. 6, 2045-2058, 1992). We now show that sequences between -142 and -153 exhibit placental-specific activator activity. Sequences between -131 and -155 can confer activator activity to a 32-bp promoter from the thymidine kinase gene of herpes simplex virus in an orientation-independent fashion. Two protein complexes, termed IV and VII, interact specifically with DNA from -131 to -155. Mutating bases -142 to -151 abolishes formation of complex VII and partially inhibits complex IV, suggesting that the proteins forming these complexes bind neighboring segments of DNA. Mutating only two cytosines at bases 141 and 142 also eliminates the formation of complex VII and reduces the transcriptional activity of the activator by about 75-80%, indicating that complex VII is important for placental expression of P450scc. The sequence from -140 to -149 on the antisense strand resembles an NF-kappa B binding site. Antibodies to NF-kappa B subunit p50, but not to p52, p65, or c-Rel, will supershift some but not all of complex IV, whereas none of these antibodies interact with complex VII. A consensus NF-kappa B oligonucleotide does not form complex IV, suggesting that p50 interacts with the protein component, but not the DNA component of complex IV. Photoaffinity UV cross-linking yielded single bands of cross-linked DNA-protein complexes at approximately 85 kD for complex IV and approximately 70 kD for complex VII, indicating that separate proteins form complexes IV and VII. Southwestern blotting identified a single protein of 55 kD forming complex VII but did not identify the protein forming complex IV. Bandshifts and Southwestern blots with nuclear extracts from steroidogenic human placental JEG-3 cells and human adrenal NCI-H295 cells show that this 55-kD protein is found in placental but not adrenal cells. This 55-kD nuclear protein appears to be a trans-acting factor necessary for placental but not adrenal expression of P450scc.

Base Sequence↗
PubMed1990

Concentration of placental protein 19 in body fluid and placental tissues.

Placental protein 19 (PP19) is one of the new placental tissue proteins identified in extracts from human term placenta by Bohn and Winkler. We measured the PP19 concentration in body fluids and placental tissue by radioimmunoassay; the minimum detectable dose of standard was 1.5 ng/ml. Although ethylene diamine tetraacetic acid (EDTA-2K) inhibited the immunoreaction between PP19 (225/242) and anti-PP19 antibody (632 ZA), the PP19 concentration did not differ between serum and heparin and sodium citrate plasmas. The serum PP19 concentration was increased by hemolysis. In blood cell fractions separated by the Ficoll-Paque/Macrodex method, polymorphonuclear leukocyte fraction contained the highest PP19 concentration. The circulating serum PP19 concentration was 4.5 +/- 1.1 ng/ml (mean +/- standard deviation) in the proliferative phase (n = 8) and 5.1 +/- 1.6 ng/ml in the secretory phase (n = 7) for nonpregnant women, and 4.6 +/- 2.2 ng/ml from men (n = 12). Seminal plasma (n = 8) contained 212.2 +/- 99.7 ng/ml. The maternal serum PP19 concentration in 291 normal pregnancies increased from 6.2 ng/ml (median) at 6-7 weeks of gestation to 34.1 ng/ml at 38-39 weeks. The mean PP19 concentration was higher in amniotic fluid and retroplacental blood, but lower in umbilical cord blood than that in circulating maternal serum. In hydatidiform mole, vesicular fluid contained high PP19 concentration (1154.6 +/- 659.5 ng/ml), although these maternal serum concentration was not statistically higher than normal range. The chorionic villous trophoblast contained more PP19 than decidua, chorion, and amnion. These results suggest that PP19 has an extraplacental source, even though the chorionic villous trophoblast may be the main source throughout pregnancy.

Adult↗
PubMed1995

Maternal plasma and placental immunoreactive corticotrophin-releasing factor concentrations in infection-associated term and pre-term delivery.

The present study aimed to investigate whether microbial invasion of the amniotic cavity affects maternal plasma or placental immunoreactive corticotrophin releasing factor (ir-CRF) concentrations in pregnant women with pre-term or term labour. A cross-sectional study was conducted collecting blood samples in: (1) women with pre-term labour and intact membranes (25-36 weeks), with or without microbial invasion of the amniotic cavity (subdivided into three groups: 1A, no microbial invasion of the amniotic cavity, delivery at term, n = 54; group 1B, delivery < 48 h, no microbial invasion of the amniotic cavity, n = 10; group 1C, delivery < 48 h, microbial invasion of the amniotic cavity, n = 8); (2) women at term, not in labour and without microbial invasion of the amniotic cavity (n = 15); (3) women in spontaneous active labour at term without (A) (n = 55) or with (B) (n = 16) microbial invasion of the amniotic cavity; and (4) healthy women not in labour at 25-36 weeks of gestation (n = 25). Specimens of trophoblast tissue were collected from pregnant women with pre-term labour (no microbial invasion of the amniotic cavity, n = 6; microbial invasion of the amniotic cavity, n = 4) or delivering at term (no microbial invasion of the amniotic cavity, n = 8; microbial invasion of the amniotic cavity, n = 4). A specific radioimmunoassay on acidic extracts of plasma or placental specimens was used.(ABSTRACT TRUNCATED AT 250 WORDS)

Amnion↗
PubMed1994

A TEF-1 binding motif that interacts with a placental protein is important for the transcriptional activity of the hCS-B enhancer.

The transcriptional activity of the human placental lactogen genes (choriosomatomammotropic hormone, hCS) is controlled by tissue-specific enhancers located 4 kb downstream from their respective origins of transcription. The hCS-B enhancer is the strongest; its activity is mediated by synergism between two protein-binding sites (DF-3 and DF-4). The DF-4 site possesses a potential binding sequence for TEF-1, a known transcription factor. In this paper, we show by electrophoretic mobility-shift assays and antibody supershift experiments that TEF-1 does not bind to site DF-4. Mutations in the TEF-1-like binding motif of site DF-4 prevent formation of the DNA-protein complex, called complex f, in the presence of placental JEG-3 cell extracts. When HeLa cell extracts are used, another complex (complex c) is also affected. In transient expression experiments, TKCAT constructs linked to this mutated DF-4 site exhibit greatly reduced transcriptional activity when introduced into JEG-3 cells. Some cell lines contain both protein c and protein f (the proteins forming complexes c and f); when transfected, these lines display reduced DF-4-driven activity, suggesting that the two proteins could compete for the same DF-4 sequence. We conclude that protein f is important for the placenta-specific activity of the hCS-B enhancer. By UV cross-linking, we show that protein f is actually three polypeptides ranging in size from about 12 to 21 kD.

Base Sequence↗
PubMed1975

Progesterone concentration in placenta, molar tissue, and ovarian theca lutein cyst.

Progesterone concentrations in 2 full-term normal placentas, molar tissue from 3 cases of hydatidiform mole were measured by competitive protein binding. Sephadex LH-20 column chromatographic separation of extracts from these tissues showed that, in placental and molar tissue, 85 to 95% of the extracts were progesterone and very small amounts of 20 alpha-dihydroprogesterone and 17 alpha-hydroxyprogesterone. The concentration of progesterone in the placenta were 368.8 and 317.2 ng/g tissue, respectively, while in molar tissue the concentration were 2474.5, 1974.6, and 4146.0 ng/g tissue, respectively. Progesterone concentration in ovarian tissue was between 1121;2 and 1440.9 ng/g tissue. It is suggested that the high concentration of progesterone in molar tissue reflects functional capacity of the abnormal trophoblast in progesterone synthesis and accumulation of progesterone due to absence of a fetus. The lower concentration of progesterone in the ovary in molar pregnancy would appear to suggest that the ovary is a secondary source of progesterone in molar pregnancy.

Chorionic Gonadotropin↗
PubMed1993

Plasminogen activator inhibitors in endometrial adenocarcinoma.

BACKGROUND: Plasminogen activators (PA) play an important role in the mediation of pathologic processes, including cancer invasion. Levels of urokinase are increased in malignant endometrium compared with normal endometrium. The role of PA inhibitors (PAI) in the malignant process is not known. METHODS: PAI-1 (endothelial type inhibitor) and PAI-2 (placental type inhibitor) in extracts of malignant (n = 14) and normal (n = 7) postmenopausal endometrium were measured. The results were correlated with the standard prognostic variables in endometrial carcinoma, namely, stage, histologic grade, depth of myometrial invasion, and estrogen receptor status of the tumor. RESULTS: PAI-1 was not detectable in normal endometrium and was present in small quantitities (0.11-1.54 ng PAI-1/mg protein) in 4 of 14 specimens of malignant endometrium. PAI-2 was present in 4 of 7 normal and all (14 of 14) malignant endometrial cytosols. PAI-2 levels were higher in Stage II and III compared with Stage I cancers (P < 0.05) and in malignant endometrium that invaded the myometrium to more than half its depth compared with those with less than 50% invasion (P < 0.05). No significant correlation was found between PAI-2 and estrogen receptor levels (r = -0.32). CONCLUSIONS: Endometrial adenocarcinoma has higher levels of PAI-2 than does normal postmenopausal endometrium. Highest levels of PAI-2 were found in the poorer prognostic categories of endometrial cancer.

Adenocarcinoma↗
PubMed1994

Transient expression of the cytochrome P450 aromatase gene in elongating porcine blastocysts is correlated with uterine insulin-like growth factor levels during peri-implantation development.

The insulin-like growth factors (IGFs-I and -II) are mediators of cellular growth and differentiation. The expression of these growth factor genes is temporally and hormonally regulated in the uterus during pregnancy, suggesting potentially important roles in embryonic development, implantation, and successful progression of pregnancy. A known regulator of uterine IGF-I secretion is estrogen, which is produced by pre-implantation mammalian embryos of several species and whose amounts may be influenced by growth factors via their effects on the transcriptional activities of steroidogenic enzyme genes. We have previously proposed that within the uterine microenvironment, a positive feedback loop may link uterine secretion of IGFs with embryonic production of estrogens to maintain and coordinate the timing of biological signals essential for embryo development. The present study examined the temporal relationships between the levels of conceptus cytochrome P450 aromatase mRNA and protein and concentrations of IGF-I and -II in uterine luminal fluids of pigs. A DNA fragment encoding a highly conserved region among mammalian aromatase P450 proteins was isolated by hybridization screening of a porcine genomic DNA library with a human aromatase P450 cDNA fragment as probe. A synthetic oligopeptide DDVIDGYPVKKGTNI within this highly conserved region was used to generate an antiserum in sheep that recognized a protein of M(r) 49,000 in Western blot analysis of porcine ovarian, placental, endometrial, and conceptus extracts. A radioimmunoassay (RIA) for aromatase P450 was established and validated using this antiserum. RIA demonstrated highest levels of aromatase P450 protein in extracts of days 10, 11, and 12 porcine conceptuses with significantly diminished levels in elongated conceptuses at days 15 and 18. In the conceptus, aromatase P450 was localized to the inner cell layer (hypoblast) of the trophectoderm. A major mRNA transcript of approximately 3 kb in length was demonstrated by Northern blot analysis of conceptus RNA with a porcine aromatase P450 antisense RNA probe. The relative levels of aromatase P450 mRNA were higher in conceptuses at day 12 than at days 15 and 18, in parallel with the levels of aromatase P450 protein. RIA of uterine luminal fluids demonstrated maximal concentrations of IGF-I at day 12, which were significantly decreased by day 15, and increased concentrations of IGF-II by day 12, which were maintained until day 18 of pregnancy. These results demonstrate that the transient expression of conceptus aromatase P450 mRNA and protein in elongating pig blastocysts is coincident with their capacity to secrete estrogens and with the rapidly changing concentrations of IGFs within the uterine microenvironment.(ABSTRACT TRUNCATED AT 400 WORDS)

Amino Acid Sequence↗
PubMed1993

A method for the assay of phosphatidylinositol-specific phospholipase D activity in serum.

A reproducible substrate for the assay of phosphatidylinositol-specific phospholipase D (PIPLD) can be prepared by extracting alkaline phosphatase from placental tissue with n-butanol under alkaline conditions. The alkaline phosphatase thus prepared retains its hydrophobic glycan phosphatidylinositol (GPI) anchor and aggregates into high M(r) forms. Incubation with serum hydrolyses the phosphate inositol linkage by PIPLD action, producing a less lipophilic, non-aggregated isoform of alkaline phosphatase. Three methods of measuring the amount of this isoform produced after a timed incubation with serum are described and compared: two types of phase partitioning systems, and electrophoresis and densitometry of the products after gradient-pore electrophoresis. All give comparable and reproducible measurements of PIPLD; however, the electrophoretic method is preferred for routine analysis.

Alkaline Phosphatase↗
PubMed1991

Liquid chromatographic analysis of prednisolone, prednisone and their 20-reduced metabolites in perfusion media.

A reversed-phase liquid chromatographic assay was developed to quantitate prednisolone, prednisone and the 20 alpha-dihydro and 20 beta-dihydro reduced metabolites of both parent compounds in tissue culture media from in vitro perfusions of the human placental lobule. Steroids were extracted from perfusate, using reversed-phase cartridges, with average recoveries of 95.2% or greater. The internal standard for the analyses was 6 alpha-methylprednisolone. In this assay cortisol coelutes with prednisolone, however, no other significant interferences were found. Assay of each steroid was linear in the range 0-1 microgram/ml. Intra-assay coefficients of variation were measured at 10 and 750 ng/ml with ranges of 3.4% (20 alpha-dihydroprednisone) to 8.8% (20 beta-dihydroprednisolone) and 4.1% (20 beta-dihydroprednisone) to 8.8% (prednisone). The corresponding inter-assay coefficients of variation were 3.3% (20 alpha-dihydroprednisone) to 9.1% (20 beta-dihydroprednisolone) and 1.9% (prednisolone) to 3.5% (prednisone). The analyses utilized two C18 columns which were linked together and maintained at 40 degrees C.

Chromatography, Liquid↗
PubMed1996

Three-minute high-performance liquid chromatographic assay for NMN adenylyltransferase using a 20-mm-long reversed-phase column.

NMN adenylyltransferase (NAD pyrophosphorylase; NMNAT) reversibly catalyzes the synthesis of NAD from ATP and NMN. In this paper, we describe a rapid and sensitive high-performance liquid chromatographic assay for NMNAT, which uses a 20-mm-long C18 reversed-phase (RP) column. The activity was measured by separating in less than 3 min the substrates (NMN and ATP) from the product (NAD) with 0.1 M potassium phosphate, pH 6.0, at a 2 ml/min flow-rate and 22 degrees C. NAD was directly quantitated from its ultraviolet absorbance. Amounts of NAD as small as 25 pmol could be measured. The activity value closely agreed with that determined by the spectrophotometric assay. This method was successfully applied to the determination of NMNAT activity in human placental and bull testis extracts, as well as in rat pheochromocytoma (PC12) cells.

Adult↗
PubMed1985

Rapid changes in synaptic vesicle cytochemistry after depolarization of cultured cholinergic sympathetic neurons.

Sympathetic neurons taken from rat superior cervical ganglia and grown in culture acquire cholinergic function under certain conditions. These cholinergic sympathetic neurons, however, retain a number of adrenergic properties, including the enzymes involved in the synthesis of norepinephrine (NE) and the storage of measurable amounts of NE. These neurons also retain a high affinity uptake system for NE; despite this, the majority of the synaptic vesicles remain clear even after incubation in catecholamines. The present study shows, however, that if these neurons are depolarized before incubation in catecholamine, the synaptic vesicles acquire dense cores indicative of amine storage. These manipulations are successful when cholinergic function is induced with either a medium that contains human placental serum and embryo extract or with heart-conditioned medium, and when the catecholamine is either NE or 5-hydroxydopamine. In some experiments, neurons are grown at low densities and shown to have cholinergic function by electrophysiological criteria. After incubation in NE, only 6% of the synaptic vesicles have dense cores. In contrast, similar neurons depolarized (80 mM K+) before incubation in catecholamine contain 82% dense-cored vesicles. These results are confirmed in network cultures where the percentage of dense-cored vesicles is increased 2.5 to 6.5 times by depolarizing the neurons before incubation with catecholamine. In both single neurons and in network cultures, the vesicle reloading is inhibited by reducing vesicle release during depolarization with an increased Mg++/Ca++ ratio or by blocking NE uptake either at the plasma membrane (desipramine) or at the vesicle membrane (reserpine). In addition, choline appears to play a competitive role because its presence during incubation in NE or after reloading results in decreased numbers of dense-cored vesicles. We conclude that the depolarization step preceding catecholamine incubation acts to empty the vesicles of acetylcholine, thus allowing them to reload with catecholamine. These data also suggest that the same vesicles may contain both neurotransmitters simultaneously.

Acetylcholine↗