SEARCH · PubMed Health

Results for “GS”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 109 records · Page 6Linked to original sources

PubMed1989

Decreased 8N3-[gamma-32P]GTP photolabeling of Gs alpha in tumorigenic lung epithelial cell lines: association with decreased hormone responsiveness and loss of contact-inhibited growth.

The 45-kDa alpha subunit of the signal transducing Gs protein complex, which stimulates receptor-coupled adenylate cyclase, incorporated less of the photoaffinity probe, 8N3-[gamma-32P]GTP, in extracts from tumorigenic cell lines in comparison with nontumorigenic cell lines derived from mouse lung epithelium. Immunoblotting experiments using anti-Gs alpha antibodies demonstrated that tumor cells do not have a decreased amount of Gs alpha and photolabeling of tumor cell Gs alpha increased when the rate of nucleotide exchange was promoted. Therefore, tumor cell Gs alpha function may be altered. Consistent with this hypothesis is the observation that the tumor cells exhibited decreased responsiveness to the beta-adrenergic agonist, isoproterenol. Gs alpha photolabeling in growing nontumorigenic cells was reduced to a level resembling that observed in tumor cells, but photolabeling increased when cells became contact-inhibited. This increase in 8N3-[gamma-32P]GTP incorporation into Gs alpha by normal cells at confluence was not seen in the tumorigenic cells. Since Gs alpha photolabeling was inversely proportional to the percentage of [3H]thymidine-labeled nuclei at confluence, we suggest that the altered Gs alpha in tumor cells is involved in the loss of cell growth regulation.

Affinity Labels↗

PubMed1992

Pharmacological evaluation of GS-389, a novel tetrahydroisoquinoline analog related to higenamine, on vascular smooth muscle.

The effects of GS-389, a novel tetrahydroisoquinoline analog, on isolated rat and mouse thoracic aorta rings, were investigated. Both GS-389 and papaverine induced endothelium-independent, concentration-dependent relaxations of the rat and mouse aortae precontracted with phenylephrine (PE). The GS-389-induced inhibition of the contractile response to PE was noncompetitive. The initial phasic contraction to PE elicited in Ca(2+)-free media was also attenuated by pretreatment with GS-389, indicating that GS-389 may interfere with the release of intracellular Ca2+ and/or the effects of intracellular Ca2+ release. GS-389 potentiated the vasodilatory effects of isoproterenol and sodium nitroprusside in rat and mouse aortae. GS-389 significantly increased cGMP levels in the rat aorta and inhibited cGMP phosphodiesterase from the rabbit brain. Methylene blue, but not propranolol, inhibited the vasodilatory effect of GS-389. These results suggest that the vasorelaxant effect of GS-389 may be due, at least in part, to inhibition of cGMP metabolism.

Alkaloids↗

PubMed2004

Structural requirements for the flavonoid-mediated modulation of glutathione S-transferase P1-1 and GS-X pump activity in MCF7 breast cancer cells.

The objective of this study was to investigate the structural requirements necessary for inhibition of glutathione S-transferase P1-1 (GSTP1-1) and GS-X pump (MRP1 and MRP2) activity by structurally related flavonoids, in GSTP1-1 transfected MCF7 cells (pMTG5). The results reveal that GSTP1-1 activity in MCF7 pMTG5 cells can be inhibited by some flavonoids. Especially galangin was able to inhibit almost all cellular GSTP1-1 activity upon exposure of the cells to a concentration of 25microM. Other flavonoids like kaempferol, eriodictyol and quercetin showed a moderate GSTP1-1 inhibitory potential. For GSTP1-1 inhibition, no specific structural requirements necessary for potent inhibition could be defined. Most flavonoids appeared to be potent GS-X transport inhibitors with IC(50) values ranging between 0.8 and 8microM. Luteolin and quercetin were the strongest inhibitors with IC(50) values of 0.8 and 1.3microM, respectively. Flavonoids without a C2-C3 double bond like eriodictyol, taxifolin and catechin did not inhibit GS-X pump activity. The results of this study demonstrate that the structural features necessary for high potency GS-X pump inhibition by flavonoids are (1) the presence of hydroxyl groups, especially two of them generating the 3',4'-catechol moiety; and (2) a planar molecule due to the presence of a C2-C3 double bond. Other factors, like lipophilicity and the total number of hydroxyl groups do not seem to be dominating the flavonoid-mediated GS-X pump inhibition. To identify the GS-X pump responsible for the DNP-SG efflux in MCF7 cells, the effects of three characteristic flavonoids quercetin, flavone and taxifolin on MRP1 and MRP2 activity were studied using transfected MDCKII cells. All three flavonoids as well as the typical MRP inhibitor (MK571) affected MRP1-mediated transport activity in a similar way as observed in the MCF7 cells. In addition, the most potent GS-X pump inhibitor in the MCF7 cells, quercetin, did not affect MRP2-mediated transport activity. These observations clearly indicate that the GS-X pump activity in the MCF7 cells is likely to be the result of flavonoid-mediated inhibition of MRP1 and not MRP2. Altogether, the present study reveals that a major site for flavonoid interaction with GSH-dependent toxicokinetics is the GS-X pump MRP1 rather than the conjugating GSTP1-1 activity itself. Of the flavonoids shown to be most active especially quercetin is frequently marketed in functional food supplements. Given the physiological levels expected to be reached upon supplement intake, the IC(50) values of the present study point at possible flavonoid-drug and/or flavonoid-xenobiotic interactions especially regarding transport processes involved in toxicokinetics.

Biological Transport↗

PubMed1994

Immunoelectron microscopic identification of cytoplasmic and nuclear Gs alpha in S49 lymphoma cells.

The subcellular distribution of Gs alpha was characterized in S49 lymphoma cells with two polyclonal antisera directed against specific COOH- and NH2-terminal epitopes. Nonspecific binding was determined in each subcellular compartment by incubating cyc- S49 cells, known to be deficient in Gs alpha and its mRNA, with primary and secondary antisera. Small proportions of total specific binding sites were localized to the plasmalemma as well as the nuclear envelope. Because of their small size, these compartments contained a high concentration of Gs alpha. However, most of the specific binding sites were found in nonstructured cytoplasm and within the nucleus. Specific binding was abolished or significantly reduced by preincubating primary antisera with their peptide immunogens but not with an irrelevant peptide. Intracellular Gs alpha immunoreactive binding sites did not colocalize with gold-conjugated transferrin in cells preincubated with this ligand to mark a classical endocytotic pathway. The intracellular and intranuclear location of Gs alpha was confirmed with confocal microscopy of S49 cells immunostained with specific primary and fluorescently labeled secondary antibodies. Gs alpha was also detected with immunoblots of proteins extracted from purified S49 cell nuclei. Thus, Gs alpha is abundantly distributed in intracellular and intranuclear sites in S49 cells and occurs in loci distinct from organelles of the transferrin pathway. The substantial intracellular distribution of Gs alpha suggests that Gs may subserve intracellular and, perhaps, intranuclear functions that may be important in proliferating cells.

Animals↗

PubMed2004

Development of primers specific for LMW-GS genes located on chromosome 1D and molecular characterization of a gene from Glu-D3 complex locus in bread wheat.

Glutenins are multimeric aggregates of high molecular weight (HMW) and low molecular weight (LMW) subunits, which determine the quality in wheat. Development of locus-specific primers is an important step toward cloning specific LMW glutenin subunits (LMW-GS) by PCR method. Based on the publicly available, a pair of primer, namely primer 3 (5' TTGTAGAAACTGCCATCCTT 3') and primer 4 (5' GTCACCGCTGCAT CGACATA 3') was designed and verified to specific for LMW-GS genes located on chromosome 1D in this study. The LMW-GS gene located at the Glu-D3 locus in bread wheat cultivar Xiaoyan 6 was cloned using this pair of primer. The clone designated as XYGluD3-LMWGS1 (AY263369), contains the endosperm-specific-expression promoter and the entire coding region. Nucleotide sequence comparison of the XYGluD3-LMWGS1 with other reported LMW-GS genes located at different Glu-3 loci showed the degree of identity among them ranged from 59.57% to 99.78%. The LMW-GS genes at the same locus showed more similar to each other than to the gene at different locus. Comparison of the deduced amino acid sequence of the XYGluD3-LMWGS1 with the sequences of 12 group LMW-GSs of wheat cultivar Norin 61 showed that the deduced amino acid sequence was nearly the same to LMW-GS group 10 (identity 99.67%). The deduced LMW-GS contains nine cystine residues, which contained one more cystine residue in the C-terminal conserved domain than previous reported. This was the first LMW-GS gene encoding for a LMW-GS with 9 cystine residues that has been discovered so far.

Amino Acid Sequence↗

PubMed1977

Ultrastructural localization of sucrases in Streptococcus mutans GS-5 and an extracellular polysaccharide mutant: a comparative cytochemical and immunocytochemical study.

Electron microscopy and cytochemical and immunocytochemical procedures were used to study the ultrastructural distribution of sucrase enzymes in two strains of Streptococcus mutans. In a strongly adherent and virulent parent strain, GS-5, most of the invertase and fructosyltransferase activities were demonstrated extracellularly or bound to the cell surfaces. Intracellularly, enzymatic sites were detected near the plasma membrane on the periphery of the nucleoid and central mesosome. In GS-511, a mutant of diminished virulence and adherence, most of the enzymatic activity was not located on the cell surfaces, but was found away from the cell walls and associated with extracellular polysaccharides. Intracellularly, GS-511 manifested the same distribution of invertase and fructosyltransferase as did GS-5; however, the close association of these enzymes with the plasma membrane was not shown in GS-511. In both strains, extracellular areas near regions associated with cross wall formation appeared to show localized concentrations of these sucrases. Antibodies against partially purified glucosyltransferase (GTF) enzymes from GS-5 were used to localize GTF by immunocytochemical techniques. Indirect ferritin localization procedures showed that the extracellular and cell-bound GTF enzymes were distributed in similar locations as the fructosyltransferase and invertase enzymes. By absorption of the antiserum with whole GS-511 cells, the location of extracellular GTF and surface antigens unique to GS-5 was demonstrated. The dramatically reduced levels of cell-bound sucrase activity in GS-511 indicates the significant role of these enzymes in adherence and cariogenicity.

Cell Membrane↗

PubMed1996

Subcellular compartmentalization of Gs alpha in cardiac myocytes and its redistribution in heart failure.

Intracellular compartmentalization of G proteins may contribute to regulating signal transduction pathways in normal and failing myocardium. To test this hypothesis, we used postembedment immunogold electron microscopy to characterize the subcellular distribution of Gs alpha in normal canine and porcine left ventricular myocytes and in myocytes from a pacing-induced heart failure model in pigs in which beta-adrenergic signaling is impaired. Gs alpha was highly compartmentalized in normal canine myocytes and was localized specifically to the sarcolemma, intercalated disks, T-tubule and sarcoplasmic reticulum (SR) triads, and myoplasm. The highest Gs alpha concentration was observed in the intercalated disks. Only 20 +/- 5% of total cellular Gs alpha was localized to the sarcolemma. The triads and myoplasm compartments contained 45 +/- 13 and 27 +/- 8% of total cellular Gs alpha, respectively. The distribution of Gs alpha in normal porcine and canine myocytes was similar. However, in failing porcine myocytes Gs alpha was redistributed from the sarcolemma and T-tubule and SR triads to the myoplasm. The proportion of total cellular Gs alpha in the sarcolemma fell from 22 +/- 5 in normal to 11 +/- 4% in failing myocytes (P < 0.005), and the proportion in T-tubule and SR triads fell from 55 +/- 5 to 40 +/- 5% (P < 0.01), with a quantitatively corresponding increase in the proportion in the myoplasm from 19 +/- 3 to 43 +/- 4% (P < 0.0001). Thus redistribution of Gs alpha from the sarcolemma and the T-tubule and SR triads, where it may transduce beta-adrenergic signals, to internal sites where such actions may be precluded, might contribute to the pathophysiology of heart failure.

Animals↗

PubMed1996

Role of guanine nucleotide-binding proteins, Gi alpha 3 and Gs alpha, in dopamine and thyrotropin-releasing hormone signal transduction: evidence for competition and commonality.

It is clear that dopamine (DA) at high concentrations (> 100 nmol/l) inhibits the release of prolactin (PRL). Paradoxically, this monoamine at low concentrations (< 10 nmol/l) has also been shown to augment PRL secretion. One possible explanation for these divergent effects is that DA binds receptors capable of interacting with multiple G protein subtypes that recruit opposing intracellular signaling pathways within lactotropes. To identify G proteins which couple DA receptor activation to PRL secretion, we have selectively immunoneutralized the activity of Gi alpha 3 and Gs alpha in primary cultures of rat pituitaries and subsequently tested the ability of these cultures to respond to high and low dose DA. Specifically, permeabilized pituitary cell cultures from random-cycling female rats were treated with control immunoglobulins (IgGs; 50 micrograms/ml) purified from preimmune serum (PII) or IgGs directed against the C-terminal portion of Gi alpha 3 or Gs alpha. After immunoneutralization of these G proteins, cells were challenged with 10 or 1000 nmol DA/l and the relative amount of PRL released was assessed by reverse hemolytic plaque assay. Results were expressed as % of basal values and compared. Under control conditions (PII), 1000 nmol DA/l inhibited (61.4 +/- 7.6% of basal values; mean +/- S.E.M.) while 10 nmol DA/l augmented (120.0 +/- 7.0%) PRL release in five separate experiments. Treatment of cells with anti-Gi alpha 3 attenuated the inhibitory effect of high dose DA (87.3 +/- 14.5%). However, elimination of Gi alpha 3 activity did not significantly alter the PRL stimulatory effect of 10 nmol DA/l (121.0 +/- 5.2%). Interestingly, immunoneutralization of Gs alpha resulted in a reciprocal shift in the activity of the lower dose of DA from stimulatory to inhibitory (69.7 +/- 7.3%) while combined treatment of anti-Gi alpha 3 and anti-Gs alpha abrogated the responsiveness of pituitary cell cultures to either DA treatment (1000 nmol/l, 70.7 +/- 12.5% and 10 nmol/l, 87.5 +/- 21.4%). These data reveal that ligand-activated DA receptors can interact with both Gi alpha 3 and Gs alpha. Elimination of the stimulatory component (Gs alpha) favors the DA receptor activation of the inhibitory pathway (Gi alpha 3) suggesting a competition between negative and positive intracellular signaling mechanisms in normal lactotropes. In addition to DA treatment, we also challenged permeabilized pituitary cells with 100 nmol thyrotropin-releasing hormone (TRH)/l as a positive control for secretory integrity. As anticipated, TRH stimulated PRL release to 188.0 +/- 31.0% of basal values under control conditions. Unexpectedly, immunoneutralization of Gs alpha completely blocked the ability of TRH to induce PRL release (101.8 +/- 12.0%). This neutralizing effect was specific to Gs alpha in that blockade of Gi alpha 3 activity had no significant effect on TRH-stimulated PRL release (166.2 +/- 13.1%). These data are the first to support a direct role of Gs alpha in TRH signal transduction within PRL-secreting cells.

Analysis of Variance↗

PubMed1990

Transcriptional activation of Gs alpha expression by retinoic acid and parathyroid hormone-related protein in F9 teratocarcinoma cells.

Cyclic AMP is known to enhance retinoic acid-induced differentiation of F9 mouse teratocarcinoma cells to parietal endoderm. Recently, we showed that a parathyroid hormone-related protein (PTHrP), by activating adenylate cyclase, can substitute for exogenous cAMP in promoting retinoic acid-induced differentiation of F9 cells. However, the mechanisms by which endogenous cAMP levels are regulated during F9 differentiation are poorly defined. We therefore assessed whether Gs alpha, a subunit of the stimulatory coupling protein of adenylate cyclase, is induced during this process. Treatment of F9 cells with retinoic acid (1 microM) for 5 days resulted in a 20-fold increase in steady-state levels of a 2.0-kilobase Gs alpha mRNA. This was accompanied by an increase in the expression of 52- and 45-kDa Gs alpha polypeptides. Gs alpha mRNA increases within 24 h of exposure to retinoic acid, whereas the expression of alpha 1 (IV) collagen, a marker for F9 differentiation, did not increase until 48 h of treatment. In the presence of retinoic acid, exogenous human PTHrP-(1-34)-amide (20 nM) produced a further 2-fold increase in Gs alpha mRNA. These effects of retinoic acid and PTHrP were exerted largely if not entirely at the level of Gs alpha gene transcription, as assessed by nuclear run-on assay. Bt2cAMP (1 mM) did not reproduce the stimulatory effects of PTHrP on Gs alpha transcription, mRNA, or protein. These data demonstrate that a marked increase in Gs alpha expression accompanies F9 differentiation induced by retinoic acid and PTHrP, and that the regulation is predominantly transcriptional. The resulting increase in adenylate cyclase responsiveness to PTHrP and perhaps other ligands may be a critical component of the differentiation process. The effect of PTHrP on the expression of Gs alpha appears to be mediated by signals other than cAMP.

Animals↗

PubMed1990

Gs alpha mediates epidermal growth factor-elicited stimulation of rat cardiac adenylate cyclase.

In an earlier study we demonstrated that epidermal growth factor (EGF) increases the cellular accumulation of cAMP in perfused rat hearts by stimulating the cardiac adenylate cyclase via a stimulatory GTP-binding protein (Nair, B. G., Rashed, H. M., and Patel, T. B. (1989) Biochem. J. 264, 563-571). Employing antiserum, CS1, generated against a synthetic decapeptide RMHLRQYELL representing the carboxyl terminus of Gs alpha, the involvement of Gs in mediating the effects of EGF on cardiac adenylate cyclase was further investigated. The CS1 antiserum specifically recognized two forms, (52 and 40 kDa) of Gs alpha in rat cardiac membranes; the 52 kDa being the predominant species. In functional assays of adenylate cyclase activity, the CS1 antiserum did not alter either aluminum fluoride- or forskolin-stimulated adenylate cyclase activity. Similarly, basal adenylate cyclase activity in the absence of guanyl-5'-yl imidodiphosphate (Gpp(NH)p) was also not altered by the CS1 antiserum. However, as compared with controls performed in the presence of non-immune serum, preincubation of cardiac membranes with the CS1 antiserum resulted in a concentration-dependent inhibition of Gpp(NH)p-, isoproterenol-, and EGF-stimulated activities. In experiments which monitored Gi function as the ability of different G(pp)NHp, (-)N6-(R-phenylisopropyl)adenosine and carbachol to inhibit forskolin-stimulated adenylate cyclase, CS1 antiserum by inhibiting Gs, increased the apparent activity of Gi. Overall, our data demonstrate that the CS1 antiserum can specifically inhibit Gs function and therefore the stimulation of adenylate cyclase by agonists whose actions are mediated by Gs. In this respect, the data presented here demonstrate that Gs is the G-protein involved in mediating EGF-elicited stimulation of cardiac adenylate cyclase. Additionally, the finding that CS1 antiserum can overcome the effects of Gpp(NH)p on Gs, but not Gi, suggests that the carboxyl-terminal region of Gs alpha is important in the interactions with GTP or its analogs.

Adenylyl Cyclases↗

PubMed1990

Prostaglandin E1-mediated, cyclic AMP-independent, down-regulation of Gs alpha in neuroblastoma x glioma hybrid cells.

Treatment of neuroblastoma x glioma hybrid, NG108-15, cells with prostaglandin E1, which in these cells activates adenylate cyclase, produced a marked (50%) reduction in immunologically detectable levels of Gs alpha associated with the plasma membrane. This effect was dependent both on the time of treatment and on the concentration of the receptor ligand used and did not involve a translocation of Gs alpha from the membrane to the cytoplasm of the cells. Both the 45- and 42-kDa forms of Gs alpha which are expressed by these cells were reduced in levels by treatment with the agonist but the greater effect was on the more prevalent 45-kDa polypeptide. By contrast, treatment of the cells with forskolin over the same period did not produce a reduction in levels of Gs alpha, indicating that the effect of prostaglandin E1 was independent of cAMP production. Prostaglandin E1-mediated down-regulation of Gs alpha levels was not produced at the transcriptional level as amounts of mRNA encoding Gs alpha were not reduced by treatment of the cells with agonist. Further, treatment of NG108-15 cells with cycloheximide, throughout the time period required to produce maximal prostaglandin E1-dependent down-regulation of Gs alpha, demonstrated that complete suppression of de novo protein synthesis could not mimic the effect of prostaglandin E1 and hence even complete inhibition of transcription of the Gs alpha gene and/or translation of pre-existing mRNA could not account for these results. Prostaglandin E1 treatment of the cells had no effect on steady-state levels of the alpha subunits of the pertussis toxin-sensitive G-proteins, Gi2, Gi3, Go, which are expressed by these cells or on the level of G-protein beta subunit. Fluoride stimulation of adenylate cyclase activity in membranes of S49 cyc- cells following addition of sodium cholate extracts of membranes of prostaglandin E1-treated NG108-15 cells was only some 50% as effective as with equivalent extracts from untreated cells. These results provide evidence for a novel mechanism of receptor-mediated control of the stimulation of adenylate cyclase, involving reduction in the steady-state amounts of Gs alpha.

Adenosine Deaminase↗

PubMed1988

The stimulatory G protein of adenylyl cyclase, Gs, also stimulates dihydropyridine-sensitive Ca2+ channels. Evidence for direct regulation independent of phosphorylation by cAMP-dependent protein kinase or stimulation by a dihydropyridine agonist.

We demonstrated recently that purified preparations of Gs, the stimulatory G protein of adenylyl cyclase, can stabilize Ca2+ channels in inside-out cardiac ventricle membrane patches stimulated prior to excision by the beta-adrenergic agonist isoprenaline or by the dihydropyridine agonist Bay K 8644 and that such preparations of Gs can restore activity to spontaneously inactivated cardiac Ca2+ channels incorporated into planar lipid bilayers (Yatani, A., Codina, J., Reeves, J.P., Birnbaumer, L., and Brown, A.M. (1987) Science 238, 1288-1292). To test whether these effects represented true stimulation and to further identify the G protein responsible, we incorporated skeletal muscle T-tubule membranes into lipid bilayers and studied the response of their Ca2+ channels to G proteins, specifically Gs, and manipulations known to be specific for Gs. In contrast to cardiac channels, incorporated T-tubule Ca2+ channels exhibit stable average activities over prolonged periods of time (up to 20 min at room temperature), allowing assessment of possible effects of G proteins under steady-state assay conditions. We report that exogenously added human erythrocyte GTP gamma S (guanosine 5'-O-(3-thiotriphosphate]-activated Gs (Gs) or its resolved GTP gamma S-activated alpha subunit (alpha s) stimulate T-tubule Ca2+ channels by factors of 2-3 in the presence of Bay K 8644, and of 10-20 in the absence of Bay K 8644 and that they do so in a manner that is independent of concurrent or previous phosphorylation by cAMP-dependent protein kinase. Activation of purified Gs by cholera toxin increases both its adenylyl cyclase stimulatory and its Ca2+ channel stimulatory effects. Ca2+ channels previously stimulated by the combined actions of Bay K 8644 and cAMP-dependent protein kinase still respond to Gs. We conclude that the responses seen are due to Gs rather than a contaminant, that the effect on Ca2+ channel activity is that of a true stimulation, akin to that on adenylyl cyclase, and show that a given G protein may regulate more than one effector system.

3-Pyridinecarboxylic acid, 1,4-dihydro-2,6-dimethy↗

PubMed1989

Expression of Gs alpha in Escherichia coli. Purification and properties of two forms of the protein.

Cloning of complementary DNAs that encode either of two forms of the alpha subunit of the guanine nucleotide-binding regulatory protein (Gs) that stimulates adenylyl cyclase into appropriate plasmid vectors has allowed these proteins to be synthesized in Escherichia coli (Graziano, M.P., Casey, P.J., and Gilman, A.G. (1987) J. Biol. Chem. 262, 11375-11381). A rapid procedure for purification of milligram quantities of these proteins is described. As expressed in E. coli, both forms of Gs alpha (apparent molecular weights of 45,000 and 52,000) bind guanosine 5'-(3-O-thio)triphosphate stoichiometrically. The proteins also hydrolyze GTP, although at different rates (i.e. 0.13.min-1 and 0.34.min-1 at 20 degrees C for the 45- and the 52-kDa forms, respectively). These rates reflect differences in the rate of dissociation of GDP from the two proteins. Both forms of recombinant Gs alpha have essentially the same kcat for GTP hydrolysis, approximately 4.min-1. Recombinant Gs alpha interacts functionally with G protein beta gamma subunits and with beta-adrenergic receptors. The proteins can also be ADP-ribosylated stoichiometrically by cholera toxin. This reaction requires the addition of beta gamma subunits. Both forms of recombinant Gs alpha can reconstitute GTP-, isoproterenol + GTP-, guanosine 5'-(3-O-thio)triphosphate-, and fluoride-stimulated adenylyl cyclase activity in S49 cyc- membranes to maximal levels, although their specific activities for this reaction are lower than that observed for Gs purified from rabbit liver. Experiments with purified bovine brain adenylyl cyclase indicate that the affinity of recombinant Gs alpha for adenylyl cyclase is 5-10 times lower than that of liver Gs under these assay conditions; however, the intrinsic capacity of the recombinant protein to activate adenylyl cyclase is normal. These findings suggest that Gs alpha, when synthesized in E. coli, may fail to undergo a posttranslational modification that is crucial for high affinity interaction of the G protein with adenylyl cyclase.

Adenylyl Cyclases↗

PubMed1989

Growth rate dependence of differential incorporation of a guanosine triphosphate photoaffinity probe into the alpha subunit of a guanine nucleotide binding protein, Gs, from metastatic variants of B16 melanoma cells.

The signal transducing regulatory protein (Gs alpha) was examined in B16 melanoma clones of low (F1C29) and high (F10C23) experimental metastatic potential. Incorporation of the photoaffinity analogue, [8-azido-gamma-32P]GTP, into Gs alpha was decreased in F10C23 extracts when compared to F1C29. This difference disappeared when the photolabeling reaction was carried out at an elevated temperature which enhanced the rate of GTP exchange, suggesting functional differences in the ability of Gs alpha to bind or release GTP rather than dissimilar intracellular Gs alpha concentrations. Differential Gs alpha photolabeling occurred only during the period of rapid growth when F10C23 cells proliferated faster than F1C29 cells. During the recovery phase of growth immediately following plating and at confluence, periods in which F1C29 and F10C23 growth rates are similar, Gs alpha photolabeling between the two clones was equal. CMT lung carcinoma clones of differential metastatic potential grew at a uniform rate at all stages of growth and also exhibited equal Gs alpha photolabeling. F10C23 cells were more responsive to alpha-melanocyte-stimulating hormone stimulation of adenylate cyclase activity than F1C29 cells at all growth stages. These results confirm previously observed functional differences in Gs alpha between B16 metastatic variants and show that photolabeling differences in Gs alpha are related to growth rate.

Affinity Labels↗

PubMed1994

A novel Gs alpha mutant in a patient with Albright hereditary osteodystrophy uncouples cell surface receptors from adenylyl cyclase.

Albright hereditary osteodystrophy (AHO) is an autosomal-dominant disorder characterized by decreased expression of Gs alpha and widespread tissue resistance to hormones that activate adenylyl cyclase. We identified a single mutation, R385H, in the Gs alpha gene of a subject with AHO who had evidence for a dysfunctional Gs alpha protein. The R385H substitution is near the carboxyl terminus of the Gs alpha protein and is located five amino acids upstream of the R389P mutation that uncouples Gs alpha from cell surface receptors in the unc clone of S49 murine lymphoma. To test the biological activity of the R385H mutant, we transiently expressed wild type, R385H, and R389P Gs alpha cDNAs in COS-1 cells. Neither of the mutant Gs alpha proteins stimulated adenylyl cyclase in response to l-isoproterenol (1 to 30 microM). By contrast, both mutant Gs alpha proteins showed activation of adenylyl cyclase in response to forskolin (10 microM) and fluoroaluminate (10 mM). We propose that the R385H mutation produces a Gs alpha molecule that is unable to interact with hormone receptors and results in uncoupling of adenylyl cyclase from cell surface receptors. This uncoupling mutation represents a new type of molecular defect that can result in AHO.

1-Methyl-3-isobutylxanthine↗

PubMed1994

Contribution of ligand structure to activation of alpha 2-adrenergic receptor subtype coupling to Gs.

Recently, we have demonstrated that alpha 2-adrenergic receptors (alpha 2AR) functionally couple not only to Gi but also to Gs. This alpha 2AR-Gs coupling was subtype selective, in that the degree of alpha 2AR-Gs (but not -Gi) coupling was different between alpha 2AR subtypes. It is not known whether the determinants of this subtype selectively are found within the ligand-binding region of the receptor or within the intracellular G protein-coupling domains of the individual subtypes. We therefore expressed the three cloned human alpha 2AR (alpha 2C10, alpha 2C4, and alpha 2C2) in Chinese hamster ovary cells and studied the contribution of the ligand-binding domain to functional Gi versus Gs coupling, by determining the ability of various agonists (catecholamines, imidazolines, and azepines) to elicit alpha 2AR-mediated inhibition and stimulation of adenylyl cyclase activity. Isolation of Gi and Gs responses was accomplished by incubating cells with cholera or pertussis toxin, respectively. Although each compound was found to be a full agonist for alpha 2AR-Gi coupling, the efficacy of these agonists to elicit alpha 2AR-Gs coupling was markedly different, not only among drugs but also among the three alpha 2AR subtypes. The most notable differences occurred with the imidazoline agonists. Specifically, oxymetazoline stimulated adenylyl cyclase activity 210 +/- 17% for alpha 2C2 and 22 +/- 2.6% for alpha 2C10 and displayed no stimulation for alpha 2C4. UK-14304 stimulated adenylyl cyclase activity 240 +/- 16% for alpha 2C10, 160 +/- 14% for alpha 2C4, and 86 +/- 9% for alpha 2C2. Overall, the rank order of efficacy of these agonists to elicit stimulation of adenylyl cyclase activity by alpha 2C10 was epinephrine = norepinephrine = UK-14304 > BHT-933 > BHT-920 > oxymetazoline. For alpha 2C4 the rank was epinephrine = norepinephrine = UK-14304, with oxymetazoline, BHT-920, and BHT-933 not eliciting any stimulation. For alpha 2C2 the rank was epinephrine = norepinephrine > oxymetazoline > UK-14304 = BHT-920 > BHT-933. Thus, the coupling of alpha 2AR subtypes to Gs occurs with endogenous catecholamines as well as multiple synthetic agonists, and the degree of Gs coupling is highly dependent on the structure of the agonist. Also, compounds that act as full agonists for Gi coupling are not necessarily full agonists for Gs coupling.

Adenylyl Cyclases↗

PubMed1994

Synthetic peptides as probes for G protein function. Carboxyl-terminal G alpha s peptides mimic Gs and evoke high affinity agonist binding to beta-adrenergic receptors.

The molecular interfaces between Gs and the beta-adrenergic receptor were investigated using synthetic peptides corresponding to various regions of its alpha subunit, alpha s. These experiments were carried out on saponin-permeable C6 glioma cells in which the beta-adrenergic receptor appears tightly coupled to Gs. Synthetic site-specific peptides from alpha s (corresponding to amino acids 15-29, 354-372, and 384-394) and alpha i (8-22, 315-324, and 345-455) were tested for their ability to interfere with coupling between the beta-adrenergic receptor and Gs. The two carboxyl-terminal peptides from alpha s blocked beta-adrenergic stimulation of adenylyl cyclase in permeable cells. However, only alpha s-354-372 had this effect in C6 membranes. It is suggested that the partial uncoupling of Gs, which occurs subsequent to cell disruption, may be related to a change in the interaction of the alpha s carboxyl terminus with the beta-adrenoreceptor. Two carboxyl-terminal peptides, 354-372 and 384-394, could also mimic the effect of Gs to increase agonist affinity for the beta-adrenergic receptor. In combination, alpha s-354-372 and alpha s-384-394 increased the ability of isoproterenol to compete with 125I-pindolol binding in a partially additive manner. Synthetic peptides from alpha i and amino-terminal peptides from alpha s had no effect on beta-agonist binding, suggesting a high specificity of peptide effects. Two findings suggest that these peptides bind directly to the beta-adrenergic receptor and stabilize its high agonist affinity conformation. First, GTP and hydrolysis-resistant GTP analogs did not alter the high affinity binding in the presence of high concentrations of the peptides. Second, in S49 lymphoma cyc- cells, which lack Gs, these peptides evoked the high affinity agonist binding state of the beta-receptor. Neither peptide had an effect on antagonist binding affinity, as measured by propranolol displacement of 125I-pindolol. These data suggest that at least two regions on the alpha subunit of Gs participate in high affinity Gs binding to the beta-adrenergic receptor. The fact that these small peptides could mimic the holo-Gs effect on the receptor is rather surprising, and the specificity of the effect suggests that the primary and secondary structure of small regions of alpha s contain much of the information for specific interaction with beta-adrenergic receptors.

Adenylyl Cyclases↗

PubMed1993

Gs mediates hormonal inhibition of the calcium pump in liver plasma membranes.

We have reported that the calcium pump in liver plasma membranes is coupled to Gs or a Gs-like protein. However, we show here that isoproterenol, which activated adenylyl cyclase via Gs, had no effect on the calcium pump, while human calcitonin, human parathyroid hormone, and mini-glucagon, which inhibited this system, did not affect adenylyl cyclase activity. In order to determine the nature of the G protein coupled to the calcium pump, we used the RM antibody, raised against the carboxyl-terminal decapeptide of Gs alpha, which antagonized adenylyl cyclase activation by isoproterenol or glucagon. The RM antibody specifically blocked calcium pump inhibition by mini-glucagon, calcitonin, or parathyroid hormone, while it did not affect guanosine 5'-O-(thiotriphosphate) inhibition. Its effect was mimicked by the corresponding decapeptide RMHLRQYELL. The AS/7 antibody, reactive with Gt alpha, Gi 1 alpha, and Gi2 alpha, was ineffective. Complementation of liver plasma membranes with in vitro translated Gs alpha-2, the large form of Gs alpha, led to a 40% decrease in calcium pump activity, with a parallel 2-fold increase in adenylyl cyclase activity. In vitro translated Gi1 alpha did not affect the calcium pump activity, while it evoked a 40% inhibition of adenylyl cyclase activity. We conclude that a same Gs alpha may be coupled either to the calcium pump or to adenylyl cyclase. However, Gs is functionally specialized, since it does not ensure cross-talk between the two receptor-effector systems. These results point out the possible compartmentalization of Gs.

Adenylyl Cyclases↗