SEARCH · PubMed Health

Results for “Genomics”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 109 records · Page 6Linked to original sources

PubMed2006

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome.

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Chromosomes, Bacterial↗

PubMed2006

Comparative genomic analysis of Campylobacter jejuni strains reveals diversity due to genomic elements similar to those present in C. jejuni strain RM1221.

Analysis of the complete genomic sequence of Campylobacter jejuni strain RM1221 identified four large genomic elements, Campylobacter jejuni-integrated elements (CJIEs), that were absent from C. jejuni strain NCTC 11168. To further investigate the genomic diversity of Campylobacter, we conducted a comparative genomic analysis from a collection of 67 C. jejuni and 12 Campylobacter coli strains isolated from various geographical locations and clinical and veterinary sources. Utilizing PCR, we demonstrated that 55% of the C. jejuni strains examined were positive for at least one RM1221-like genomic element and 27% were positive for two or more of these CJIEs. Furthermore, many C. coli strains were positive for either genomic element CJIE1 or CJIE3. To simultaneously assess for the presence or absence of several genes that comprise the various CJIEs, we developed a multistrain C. jejuni DNA microarray that contained most of the putative coding sequences for strains NCTC 11168 and RM1221. A comparative genomic hybridization (CGH) analysis of 35 of the 67 C. jejuni strains confirmed the presence of genomic elements similar to those in strain RM1221. Interestingly, the DNA microarray analysis demonstrated that these genomic elements in the other C. jejuni strains often exhibited modular patterns with some regions of the CJIEs present and other regions either absent or highly divergent compared to strain RM1221. Our CGH method also identified 18 other intraspecies hypervariable regions, such as the capsule and lipooligosaccharide biosynthesis regions. Thus, the inclusion of genes from these integrated genomic elements and the genes from the other intraspecies hypervariable regions contributes to a better assessment of the diversity in C. jejuni and may increase the usefulness of DNA microarrays as an epidemiological genotyping tool. Finally, we also showed that in CJIE1, a Campylobacter Mu-like phage, is located differentially in other strains of C. jejuni, suggesting that it may integrate essentially randomly.

Campylobacter jejuni↗

PubMed2003

Patterns of genome duplication within the Brassica napus genome.

The progenitor diploid genomes (A and C) of the amphidiploid Brassica napus are extensively duplicated with 73% of genomic clones detecting two or more duplicate sequences within each of the diploid genomes. This comprehensive duplication of loci is to be expected in a species that has evolved through a polyploid ancestor. The majority of the duplicate loci within each of the diploid genomes were found in distinct linkage groups as collinear blocks of linked loci, some of which had undergone a variety of rearrangements subsequent to duplication, including inversions and translocations. A number of identical rearrangements were observed in the two diploid genomes, suggesting they had occurred before the divergence of the two species. A number of linkage groups displayed an organization consistent with centric fusion and (or) fission, suggesting this mechanism may have played a role in the evolution of Brassica genomes. For almost every genetically mapped locus detected in the A genome a homologous locus was found in the C genome; the collinear arrangement of these homologous markers allowed the primary regions of homoeology between the two genomes to be identified. At least 16 gross chromosomal rearrangements differentiated the two diploid genomes during their divergence from a common ancestor.

Brassica napus↗

PubMed2026

Mechanistic Perspectives From Genomics and Pangenomics of Medicinal and Aromatic Plants: Linking Genome Architecture to Phytochemical Diversity.

Medicinal and aromatic plants (MAPs) produce a remarkable diversity of specialized metabolites with significant pharmaceutical, nutraceutical, and industrial value. Although advances in long-read sequencing, chromosome-scale genome assembly, and pangenomics have greatly expanded genomic resources, the mechanistic links between genome architecture and phytochemical diversity remain incompletely understood. The present review synthesizes current evidence describing how structural genomic variation may contribute to phytochemical diversity, while acknowledging that many proposed genome-to-metabolite relationships require further experimental validation. Examples illustrate how genome architecture is associated with specialized-metabolite biosynthesis through multiple regulatory processes. However, the strength of supporting evidence varies considerably among MAP species. Moreover, relatively few genome-to-metabolite relationships have been confirmed through direct functional validation. We further discuss how pangenomics, multiomics integration, genome editing, synthetic biology, and artificial intelligence support the discovery, validation, and engineering of specialized metabolic pathways. Casual conclusions are evaluated according to the strength of available evidence, highlighting where causal relationships have been experimentally established and where conclusions remain primarily association-based. Overall, this review provides an integrated conceptual and evidence-based perspective summarizing proposed relationships between genome architecture and phytochemical diversity and outlines future priorities for functional genomics, precision breeding, metabolic engineering, and sustainable utilization of MAPs.

artificial intelligence↗

PubMed2005

Genome-wide screening of genomic alterations and their clinicopathologic implications in non-small cell lung cancers.

PURPOSE: Although many genomic alterations have been observed in lung cancer, their clinicopathologic significance has not been thoroughly investigated. This study screened the genomic aberrations across the whole genome of non-small cell lung cancer cells with high-resolution and investigated their clinicopathologic implications. EXPERIMENTAL DESIGN: One-megabase resolution array comparative genomic hybridization was applied to 29 squamous cell carcinomas and 21 adenocarcinomas of the lung. Tumor and normal tissues were microdissected and the extracted DNA was used directly for hybridization without genomic amplification. The recurrent genomic alterations were analyzed for their association with the clinicopathologic features of lung cancer. RESULTS: Overall, 36 amplicons, 3 homozygous deletions, and 17 minimally altered regions common to many lung cancers were identified. Among them, genomic changes on 13q21, 1p32, Xq, and Yp were found to be significantly associated with clinical features such as age, stage, and disease recurrence. Kaplan-Meier survival analysis revealed that genomic changes on 10p, 16q, 9p, 13q, 6p21, and 19q13 were associated with poor survival. Multivariate analysis showed that alterations on 6p21, 7p, 9q, and 9p remained as independent predictors of poor outcome. In addition, significant correlations were observed for three pairs of minimally altered regions (19q13 and 6p21, 19p13 and 19q13, and 8p12 and 8q11), which indicated their possible collaborative roles. CONCLUSIONS: These results show that our approach is robust for high-resolution mapping of genomic alterations. The novel genomic alterations identified in this study, along with their clinicopathologic implications, would be useful to elucidate the molecular mechanisms of lung cancer and to identify reliable biomarkers for clinical application.

Carcinoma, Non-Small-Cell Lung↗

PubMed2026

Low-pass whole-genome sequencing reveals genomic diversity and ecotype-specific adaptation in indigenous Tigrayan chickens.

Indigenous chickens play a critical role in food security and climate resilience in smallholder systems, yet their genomic diversity and adaptive potential remain insufficiently characterised. This study employed low-pass whole-genome sequencing (LP-WGS; 0.2-1.99×) to investigate genomic diversity, population structure, inbreeding and candidate environment-associated genomic variation in 33 chickens from highland, midland, and lowland agroecologies in the Tigray region of northern Ethiopia. After imputation and stringent filtering, 23.4 million high-confidence SNPs were retained, including ~ 17% novel variants, indicating substantial uncharacterised genetic diversity in these populations. SNP density (13.8 ± 8.6 SNPs/kb) was comparable to values reported from high-coverage Ethiopian chicken datasets, demonstrating the suitability of LP-WGS for population genomics in resource-limited settings. Marked differences in genomic diversity were observed among ecotypes: midland chickens showed the highest nucleotide diversity (π = 0.00267), followed by lowland (π = 0.00233), whereas highland chickens showed the lowest diversity (π = 0.00203) and elevated genomic inbreeding (FROH and FHOM ≈ 0.18). Population structure analyses revealed clear genetic separation among ecotypes. PCA (13.91% variation explained) distinguished lowland chickens along PC1 and separated highland from midland along PC2, while ADMIXTURE and FST patterns supported three major ancestral genomic backgrounds. Functional annotation of private missense variants uncovered distinct adaptive signatures reflecting the contrasting agroecological conditions. Highland chickens showed enrichment of candidate genes potentially involved in physiological processes relevant to high-altitude environments, including cold response, angiogenesis, cardiovascular regulation and metabolic homeostasis (eg., PARP1, ACOX2, ITGB3, EDNRB, SOX8, and SOX10). Midland chickens exhibited candidate signals of selection in genes with known roles in innate antiviral immunity, bacterial defence and inflammatory regulation (eg., BAK1, CLSTN1, CYSLTR1, CYSLTR2, CXCR7, GIPR, DSCAM, GDAP1, TLR3, TLR4, TLR7, IFIH1, ADORA1, EPHB1, and TMPRSS2). Lowland chickens displayed candidate variants associated with heat-stress response, DNA damage repair, oxidative balance and cardiovascular support under extreme temperatures (e.g., MLH1, BDKRB1, GPR19, FLT1, CCL18, TGM2, and RAMP3). Overall, the results indicate substantial genomic differentiation among ecotypes and suggest candidate environment-associated genetic divergence across Tigray's diverse agroecological zones. These populations may represent important reservoirs of adaptive genetic variation for climate-resilient poultry breeding, warranting further functional validation and conservation-oriented management.

Animals↗

PubMed2002

A comparison of whole-genome shotgun-derived mouse chromosome 16 and the human genome.

The high degree of similarity between the mouse and human genomes is demonstrated through analysis of the sequence of mouse chromosome 16 (Mmu 16), which was obtained as part of a whole-genome shotgun assembly of the mouse genome. The mouse genome is about 10% smaller than the human genome, owing to a lower repetitive DNA content. Comparison of the structure and protein-coding potential of Mmu 16 with that of the homologous segments of the human genome identifies regions of conserved synteny with human chromosomes (Hsa) 3, 8, 12, 16, 21, and 22. Gene content and order are highly conserved between Mmu 16 and the syntenic blocks of the human genome. Of the 731 predicted genes on Mmu 16, 509 align with orthologs on the corresponding portions of the human genome, 44 are likely paralogous to these genes, and 164 genes have homologs elsewhere in the human genome; there are 14 genes for which we could find no human counterpart.

Animals↗

PubMed2004

DNA microarray analysis of genome dynamics in Yersinia pestis: insights into bacterial genome microevolution and niche adaptation.

Genomics research provides an unprecedented opportunity for us to probe into the pathogenicity and evolution of the world's most deadly pathogenic bacterium, Yersinia pestis, in minute detail. In our present work, extensive microarray analysis in conjunction with PCR validation revealed that there are considerable genome dynamics, due to gene acquisition and loss, in natural populations of Y. pestis. We established a genomotyping system to group homologous isolates of Y. pestis, based on profiling or gene acquisition and loss in their genomes, and then drew an outline of parallel microevolution of the Y. pestis genome. The acquisition of a number of genomic islands and plasmids most likely induced Y. pestis to evolve rapidly from Yersinia pseudotuberculosis to a new, deadly pathogen. Horizontal gene acquisition also plays a key role in the dramatic evolutionary segregation of Y. pestis lineages (biovars and genomovars). In contrast to selective genome expansion by gene acquisition, genome reduction occurs in Y. pestis through the loss of DNA regions. We also theorized about the links between niche adaptation and genome microevolution. The transmission, colonization, and expansion of Y. pestis in the natural foci of endemic plague are parallel and directional and involve gradual adaptation to the complex of interactions between the environment, the hosts, and the pathogen itself. These adaptations are based on the natural selections against the accumulation of genetic changes within genome. Our data strongly support that the modern plague originated from Yunnan Province in China, due to the arising of biovar orientalis from biovar antiqua rather than mediaevalis.

Adaptation, Physiological↗

PubMed2026

Assembly and comparative analysis of the mitochondrial genome of Pleione yunnanensis: genome structure and evolutionary insights.

BACKGROUND: Pleione yunnanensis a terrestrial or semi-epiphytic herbaceous plant belonging to the Orchidaceae family, is valued for both its medicinal uses and ornamental appeal. Although its chloroplast genomes have been sequenced, its complete mt genome had not previously been resolved, limiting genetic and evolutionary studies of the species. RESULTS: In this work, we assembled and characterized the first complete mt genome of P. yunnanensis, revealing a structurally complex, multibranched system composed of 14 circular-mapping molecules totaling 468,176 bp with a GC content of 44.32%. The genome encodes 44 annotated genes, including 28 protein-coding genes (PCGs), 15 tRNAs, and one rRNA. The multibranched architecture provides new evidence supporting the dynamic and recombinational nature of plant mt genomes. Repeat analysis uncovered 29 simple sequence repeats (SSRs), 19 tandem repeats, and 118 dispersed repeats, indicating a comparatively lower repeat abundance than that found in closely related orchids with similar mt genome sizes. Codon-usage profiling of PCGs showed a marked bias toward A/T-ending codons. Prediction of RNA editing sites identified 4,708 putative edits across mitochondrial PCGs. Most mitochondrial genes displayed Ka/Ks ratios close to 1.0, suggesting relaxed selective constraints or lineage-specific evolutionary patterns rather than strong positive selection. Moreover, we detected 69 chloroplast-derived homologous fragments, including 15 intact genes, suggesting ongoing plastid-mitochondrial DNA transfer. Phylogenetic reconstruction and collinearity comparisons demonstrated that P. yunnanensis clustered closely with Dendrobium species, including D. amplum and D. hancockii, within the Orchidaceae clade. CONCLUSIONS: This study provides the first complete mt genome of P. yunnanensis, providing a foundational genomic resource for the genus Pleione. The results not only improve our understanding of mt genome structure and evolution in Orchidaceae, but also offer valuable molecular evidence for phylogenetic inference, germplasm identification, and conservation of this endangered medicinal species.

Orchidaceae↗

PubMed2002

Genomic BLAST: custom-defined virtual databases for complete and unfinished genomes.

BLAST (Basic Local Alignment Search Tool) searches against DNA and protein sequence databases have become an indispensable tool for biomedical research. The proliferation of the genome sequencing projects is steadily increasing the fraction of genome-derived sequences in the public databases and their importance as a public resource. We report here the availability of Genomic BLAST, a novel graphical tool for simplifying BLAST searches against complete and unfinished genome sequences. This tool allows the user to compare the query sequence against a virtual database of DNA and/or protein sequences from a selected group of organisms with finished or unfinished genomes. The organisms for such a database can be selected using either a graphic taxonomy-based tree or an alphabetical list of organism-specific sequences. The first option is designed to help explore the evolutionary relationships among organisms within a certain taxonomy group when performing BLAST searches. The use of an alphabetical list allows the user to perform a more elaborate set of selections, assembling any given number of organism-specific databases from unfinished or complete genomes. This tool, available at the NCBI web site http://www.ncbi.nlm.nih.gov/cgi-bin/Entrez/genom_table_cgi, currently provides access to over 170 bacterial and archaeal genomes and over 40 eukaryotic genomes.

Amino Acid Sequence↗

PubMed1984

Deletions in the genomes of pseudorabies virus vaccine strains and existence of four isomers of the genomes.

As part of a study designed to identify the genes responsible for the virulence of pseudorabies virus, we have mapped the genomes of two independently derived vaccine strains (Bartha and Norden) by restriction enzyme analysis. The structures of these genomes have been compared with that of the genome of a laboratory strain previously mapped, of restriction fragments which had been cloned. The genome of the Bartha strain was found to be very similar to that of other pseudorabies virus strains, except that a deletion of approximately 2.7 X 10(6) daltons was found in the unique short (US) region. This deletion was also observed in the genome of the Norden vaccine strain but was not observed in the genomes of any other pseudorabies virus strains that have been studied (more than 20). The genome of the Norden strain differs from that of other pseudorabies virus strains in several other respects as well. The most important difference is that in contrast to all other pseudorabies virus strains analyzed to date, which contain a type 2 herpesvirus DNA molecule (in which the US region only inverts itself relative to the unique long [UL] region), the genome of the Norden strain is a type 3 molecule in which both the US and the UL regions of the genome invert themselves, giving rise to four isomeric forms of the genome. The ability of the UL region to invert itself is probably related to the fact that a sequence normally present in all other pseudorabies virus strains at the end of the UL only is found also in inverted form at the junction of the UL and the internal inverted repeat in the Norden strain.

Chromosome Deletion↗

PubMed2006

CGAT: a comparative genome analysis tool for visualizing alignments in the analysis of complex evolutionary changes between closely related genomes.

BACKGROUND: The recent accumulation of closely related genomic sequences provides a valuable resource for the elucidation of the evolutionary histories of various organisms. However, although numerous alignment calculation and visualization tools have been developed to date, the analysis of complex genomic changes, such as large insertions, deletions, inversions, translocations and duplications, still presents certain difficulties. RESULTS: We have developed a comparative genome analysis tool, named CGAT, which allows detailed comparisons of closely related bacteria-sized genomes mainly through visualizing middle-to-large-scale changes to infer underlying mechanisms. CGAT displays precomputed pairwise genome alignments on both dotplot and alignment viewers with scrolling and zooming functions, and allows users to move along the pre-identified orthologous alignments. Users can place several types of information on this alignment, such as the presence of tandem repeats or interspersed repetitive sequences and changes in G+C contents or codon usage bias, thereby facilitating the interpretation of the observed genomic changes. In addition to displaying precomputed alignments, the viewer can dynamically calculate the alignments between specified regions; this feature is especially useful for examining the alignment boundaries, as these boundaries are often obscure and can vary between programs. Besides the alignment browser functionalities, CGAT also contains an alignment data construction module, which contains various procedures that are commonly used for pre- and post-processing for large-scale alignment calculation, such as the split-and-merge protocol for calculating long alignments, chaining adjacent alignments, and ortholog identification. Indeed, CGAT provides a general framework for the calculation of genome-scale alignments using various existing programs as alignment engines, which allows users to compare the outputs of different alignment programs. Earlier versions of this program have been used successfully in our research to infer the evolutionary history of apparently complex genome changes between closely related eubacteria and archaea. CONCLUSION: CGAT is a practical tool for analyzing complex genomic changes between closely related genomes using existing alignment programs and other sequence analysis tools combined with extensive manual inspection.

Algorithms↗

PubMed2005

"Harnessing genomics to improve health in Africa" - an executive course to support genomics policy.

BACKGROUND: Africa in the twenty-first century is faced with a heavy burden of disease, combined with ill-equipped medical systems and underdeveloped technological capacity. A major challenge for the international community is to bring scientific and technological advances like genomics to bear on the health priorities of poorer countries. The New Partnership for Africa's Development has identified science and technology as a key platform for Africa's renewal. Recognizing the timeliness of this issue, the African Centre for Technology Studies and the University of Toronto Joint Centre for Bioethics co-organized a course on Genomics and Public Health Policy in Nairobi, Kenya, the first of a series of similar courses to take place in the developing world. This article presents the findings and recommendations that emerged from this process, recommendations which suggest that a regional approach to developing sound science and technology policies is the key to harnessing genome-related biotechnology to improve health and contribute to human development in Africa. METHODS: The objectives of the course were to familiarize participants with the current status and implications of genomics for health in Africa; to provide frameworks for analyzing and debating the policy and ethical questions; and to begin developing a network across different sectors by sharing perspectives and building relationships. To achieve these goals the course brought together a diverse group of stakeholders from academic research centres, the media, non-governmental, voluntary and legal organizations to stimulate multi-sectoral debate around issues of policy. Topics included scientific advances in genomics innovation systems and business models, international regulatory frameworks, as well as ethical and legal issues. RESULTS: Seven main recommendations emerged: establish a network for sustained dialogue among participants; identify champions among politicians; use the New Plan for African Development (NEPAD) as entry point onto political agenda; commission an African capacity survey in genomics-related R&D to determine areas of strength; undertake a detailed study of R&D models with demonstrated success in the developing world, i.e. China, India, Cuba, Brazil; establish seven regional research centres of excellence; and, create sustainable financing mechanisms. A concrete outcome of this intensive five-day course was the establishment of the African Genome Policy Forum, a multi-stakeholder forum to foster further discussion on policy. CONCLUSION: With African leaders engaged in the New Partnership for Africa's Development, science and technology is well poised to play a valuable role in Africa's renewal, by contributing to economic development and to improved health. Africa's first course on Genomics and Public Health Policy aspired to contribute to the effort to bring this issue to the forefront of the policy debate, focusing on genomics through the lens of public health. The process that has led to this course has served as a model for three subsequent courses (in India, Venezuela and Oman), and the establishment of similar regional networks on genomics and policy, which could form the basis for inter-regional dialogue in the future.

Editorial↗

PubMed2004

Reconstructing the genomic architecture of ancestral mammals: lessons from human, mouse, and rat genomes.

Recent analysis of genome rearrangements in human and mouse genomes revealed evidence for more rearrangements than thought previously and shed light on previously unknown features of mammalian evolution, like breakpoint reuse and numerous microrearrangements. However, two-way analysis cannot reveal the genomic architecture of ancestral mammals or assign rearrangement events to different lineages. Thus, the "original synteny" problem introduced by Nadeau and Sankoff previously, remains unsolved, as at least three mammalian genomes are required to derive the ancestral mammalian karyotype. We show that availability of the rat genome allows one to reconstruct a putative genomic architecture of the ancestral murid rodent genome. This reconstruction suggests that this ancestral genome retained many previously postulated chromosome associations in the placental ancestor and reveals others that were beyond the resolution of cytogenetic, radiation hybrid mapping, and chromosome painting techniques. Three-way analysis of rearrangements leads to a reliable reconstruction of the genomic architecture of specific regions in the murid ancestor, including the X chromosome, and for the first time allows one to assign major rearrangement events to one of human, mouse, and rat lineages. Our analysis implies that the rate of rearrangements is much higher in murid rodents than in the human lineage and confirms the existence of rearrangement hot-spots in all three lineages.

Algorithms↗

PubMed2001

Comparing vertebrate whole-genome shotgun reads to the human genome.

Multi-species sequence comparisons are a very efficient way to reveal conserved genes. Because sequence finishing is expensive and time consuming, many genome sequences are likely to stay incomplete. A challenge is to use these fragmented data for understanding the human genome. Methods for using cross-species whole-genome shotgun sequence (WGS) for genome annotation are described in this paper. About one-half million high-quality rat WGS reads (covering 7.5% of the rat genome) generated at the Baylor College of Medicine Human Genome Sequencing Center were compared with the human genome. Using computer-generated random reads as a negative control, a set of parameters was determined for reliable interpretation of BLAST search results. About 10% of the rat reads contain regions that are conserved in the human genomic sequence and about one-third of these include known gene-coding regions. Mapping the conserved regions to human chromosomes showed a 23-fold enrichment for coding regions compared with noncoding regions. This approach can also be applied to other mammalian genomes for gene finding. These data predicted approximately 42,500 genes in the human, slightly more than reported previously.

Animals↗

PubMed2003

Leveraging the mouse genome for gene prediction in human: from whole-genome shotgun reads to a global synteny map.

The availability of draft sequences for both the mouse and human genomes makes it possible, for the first time, to annotate whole mammalian genomes using comparative methods. TWINSCAN is a gene-prediction system that combines the methods of single-genome predictors like GENSCAN with information derived from genome comparison, thereby improving accuracy. Because TWINSCAN uses genomic sequence only, it is less biased toward highly and/or ubiquitously expressed genes than GENEWISE, GENOMESCAN, and other methods based on evidence derived from transcripts. We show that TWINSCAN improves gene prediction in human using intermediate products from various stages of the sequencing and analysis of the mouse genome, from low-redundancy, whole-genome shotgun reads to the draft assembly and the synteny map. TWINSCAN improves on the prior state of the art even when alignments from only 1X coverage of the mouse genome are available. Gene prediction accuracy improves steadily from 1X through 3X, more slowly from 3X to 4X, and relatively little thereafter. The assembly and the synteny map greatly speed the computations, however. Our human annotation using the mouse assembly is conservative, predicting only 25,622 genes, and appears to be one of the best de novo annotations of the human genome to date.

Animals↗

PubMed2006

SIGMA: a system for integrative genomic microarray analysis of cancer genomes.

BACKGROUND: The prevalence of high resolution profiling of genomes has created a need for the integrative analysis of information generated from multiple methodologies and platforms. Although the majority of data in the public domain are gene expression profiles, and expression analysis software are available, the increase of array CGH studies has enabled integration of high throughput genomic and gene expression datasets. However, tools for direct mining and analysis of array CGH data are limited. Hence, there is a great need for analytical and display software tailored to cross platform integrative analysis of cancer genomes. RESULTS: We have created a user-friendly java application to facilitate sophisticated visualization and analysis such as cross-tumor and cross-platform comparisons. To demonstrate the utility of this software, we assembled array CGH data representing Affymetrix SNP chip, Stanford cDNA arrays and whole genome tiling path array platforms for cross comparison. This cancer genome database contains 267 profiles from commonly used cancer cell lines representing 14 different tissue types. CONCLUSION: In this study we have developed an application for the visualization and analysis of data from high resolution array CGH platforms that can be adapted for analysis of multiple types of high throughput genomic datasets. Furthermore, we invite researchers using array CGH technology to deposit both their raw and processed data, as this will be a continually expanding database of cancer genomes. This publicly available resource, the System for Integrative Genomic Microarray Analysis (SIGMA) of cancer genomes, can be accessed at http://sigma.bccrc.ca.

Adenocarcinoma↗

PubMed2006

Synteny conservation between the Prunus genome and both the present and ancestral Arabidopsis genomes.

BACKGROUND: Due to the lack of availability of large genomic sequences for peach or other Prunus species, the degree of synteny conservation between the Prunus species and Arabidopsis has not been systematically assessed. Using the recently available peach EST sequences that are anchored to Prunus genetic maps and to peach physical map, we analyzed the extent of conserved synteny between the Prunus and the Arabidopsis genomes. The reconstructed pseudo-ancestral Arabidopsis genome, existed prior to the proposed recent polyploidy event, was also utilized in our analysis to further elucidate the evolutionary relationship. RESULTS: We analyzed the synteny conservation between the Prunus and the Arabidopsis genomes by comparing 475 peach ESTs that are anchored to Prunus genetic maps and their Arabidopsis homologs detected by sequence similarity. Microsyntenic regions were detected between all five Arabidopsis chromosomes and seven of the eight linkage groups of the Prunus reference map. An additional 1097 peach ESTs that are anchored to 431 BAC contigs of the peach physical map and their Arabidopsis homologs were also analyzed. Microsyntenic regions were detected in 77 BAC contigs. The syntenic regions from both data sets were short and contained only a couple of conserved gene pairs. The synteny between peach and Arabidopsis was fragmentary; all the Prunus linkage groups containing syntenic regions matched to more than two different Arabidopsis chromosomes, and most BAC contigs with multiple conserved syntenic regions corresponded to multiple Arabidopsis chromosomes. Using the same peach EST datasets and their Arabidopsis homologs, we also detected conserved syntenic regions in the pseudo-ancestral Arabidopsis genome. In many cases, the gene order and content of peach regions was more conserved in the ancestral genome than in the present Arabidopsis region. Statistical significance of each syntenic group was calculated using simulated Arabidopsis genome. CONCLUSION: We report here the result of the first extensive analysis of the conserved microsynteny using DNA sequences across the Prunus genome and their Arabidopsis homologs. Our study also illustrates that both the ancestral and present Arabidopsis genomes can provide a useful resource for marker saturation and candidate gene search, as well as elucidating evolutionary relationships between species.

Arabidopsis↗