SEARCH · PubMed Health
Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.
Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.
The primary structure of the 5 S rRNA isolated from the cryptobiotic cysts of the brine shrimp Artemia salina is pACCAACGGCCAUACCACGUUGAAAGUACCCAGUCUCGUCAGAUCCUGGAAGUCACACAACGUCGGGCCCGGUCAGUACUUGGAUGGGUGACCGCCUGGGAACACCGGGUGCUGUUGGCAU (OH).
Evaluation of the folded structure of E.coli 16S-rRNA was performed using 5'-Ru(II) complex labeled oligodeoxyribonucleotide (Ru-probe) as the probe. This probe could evaluate the dynamic manner of the binding site of Ru-probe by using the time-resolved luminescence anisotropy technique. It was found that the rotational manner of Ru-probe in the presence of 16S-rRNA was markedly dependent on the oligonucleotide sequence, indicating that the microenvironments around the Ru-probes were largely different.
The fastidious nature of the mollicutes (mycoplasmas), their lack of a classic bacterial cell wall, and their very small genome, make phylogenetic placements of new species in this enlarging group of prokaryotes an important and valuable aid in their classification. In this report we have determined the phylogeny of the Mycoplasma hominis cluster of the hominis group. The 16S rDNA sequences from several previously described Mycoplasma species were determined and ten species were found to belong to the M. hominis cluster. With almost complete sequences available, the phylogenetic analysis revealed that the M. hominis cluster currently comprises 19 species, forming a distinct clade as judged from branch lengths, bootstrap percentage values, nucleotide signature analysis, and structural elements in the 16S rRNA molecule. The 16S rRNA gene sequences of species in the M. hominis cluster were found to be > or = 94% similar and the range within which similarities can be used in the classification of new species is discussed. Members of the M. hominis cluster all share a major biochemical property of M. hominis, in that they hydrolyse arginine and are incapable of fermenting glucose. This consistency in phenotypic pattern has not been found in any of the other phylogenetic clusters of the hominis group. Two species, the non-cultivable agent of Grey Lung disease in rodents (tentatively named 'Candidatus Mycoplasma ravipulmonis') and the avian species Mycoplasma gypis strain B1/T1T, were regarded as close relatives to the M. hominis cluster, but are clearly separated from the species of this cluster. Both species formed early branches of the M. hominis cluster and should be regarded as individual lines containing one species.
Neurospora mitochondrial tyrosyl-tRNA synthetase (mt tyrRS), which is encoded by nuclear gene cyt-18, functions in splicing of group I introns in mitochondria. Here, we overproduced functional cyt-18 protein in Escherichia coli and purified it to near homogeneity. The purified protein has splicing and tyrRS activities similar to those of cyt-18 protein isolated from mitochondria and is by itself sufficient to splice the mitochondrial large rRNA intron in vitro. Structure-function relationships in the cyt-18 protein were analyzed by in vitro mutagenesis. We confirmed that a small amino-terminal domain not found in bacterial tyrRSs is required for splicing activity, but not tyrRS activity. Two linker insertion mutations, which disrupt the predicted ATP-binding site, completely inhibit tyrRS activity but leave substantial splicing activity. Finally, deletions or linker insertion mutations in the putative carboxy-terminal tRNA-binding domain inhibit both tyrRS and splicing activities, although some have differential effects on the two activities. Our results show that the normal catalytic activity of the cyt-18 protein is not required for splicing and are consistent with the hypothesis that the protein functions by binding to the precursor RNA and facilitating formation of the correct RNA structure. Regions required for splicing are distributed throughout the cyt-18 protein and overlap, but are not identical to, regions required for tyrRS activity. The finding that the putative carboxy-terminal tRNA-binding domain is required for both tyrRS and splicing activities suggests that the mechanism for binding the intron has similarities to the mechanism for binding tRNA(Tyr).
Genetic characteristics of 12 Borrelia isolates from the tick, Ixodes ovatus, I. persulcatus, and the rodent, Apodemus speciosus ainu, in Japan were compared to members of the three genospecies of Borrelia burgdorferi sensu lato; B. burgdorferi sensu stricto, B. garinii and group VS461. The methods used in this study were the quantitative microplate DNA hybridization assay and restriction fragment length polymorphism (RFLP) analyses of the flagellin structural genes and the 16S rRNA genes. The six isolates from I. persulcatus and A. speciosus ainu were identified as genospecies B. garinii using RFLP analysis of the flagellin and 16S rRNA genes. In contrast, RFLP analysis of the six isolates from I. ovatus indicated that they were different from the three reported genospecies. DNA homology studies confirmed the RFLP results. The six isolates from I. ovatus had DNA homologies ranging from 85 to 99%, whereas DNA relatedness of the I. ovatus isolate with strains belonging to the three genospecies was 50 to 64%. These results suggest that the strains isolated from I. ovatus in Japan differ from the three genospecies and should be classified as a new genospecies of B. burgdorferi sensu lato. We propose that strains isolated from I. ovatus should be classified as B. japonica sp. nov.
In all cells, a long precursor RNA is processed into mature rRNAs for ribosome biogenesis. In eukaryotes, the complexity and speed of the overall process often has made it difficult to establish finer details of the maturation pathway. Since phylogenetic comparisons can provide evidence for critical events, the major rRNA processing pathway for the yeast Schizosaccharomyces pombe was determined using primer extension, nuclease protection and Northern-hybridisational analyses. Transcript mapping of the 5' external transcribed spacer revealed six cleavage sites which occur upstream of the mature 18S termini. Two of these sites as well as a site adjacent to the 18S termini are complementary to conserved Box sequences in the S. pombe U3 small nucleolar RNA. Transcript mapping of the internal transcribed spacers (1 and 2) suggest similar maturation schemes for the two spacers, in which an initial endonuclease cleavage is followed by processing to the mature termini. The mature 5' termini of 25S rRNA appear to be heterogeneous in S. pombe, as has been demonstrated for 5.8S rRNA, suggesting an essential limiting structure in the ribosome-integrated mature RNA. Together with our previous analysis of the 3' external spacer region, the results reveal the major processing pathway for S. pombe and further support a maturation process which acts as a quality assurance mechanism.
When microbes are subjected to temporal changes in nutrient availability, growth rate and substrate affinity can contribute to competitive fitness and thereby affect microbial community structure. This hypothesis was tested using planktonic bacterial communities exposed to nutrient additions at 1-, 3-, 7-, or 14-day intervals. Growth rates after nutrient addition were inversely proportional to the pulse interval and declined from 0.5 h(-1) to 0.15 h(-1) as the pulse interval increased from 1 to 14 days. The dynamics of community structure were monitored by 16S rRNA gene PCR-denaturing gradient gel electrophoresis. At pulse intervals of more than 1 day, the community composition continued to change over 130 days. Although replicate systems exposed to the same pulse interval were physiologically similar, their community compositions could exhibit as much dissimilarity (Dice similarity coefficients of <0.5) as did systems operated at different intervals. Bacteria were cultivated from the systems to determine if the physiological characteristics of individual members were consistent with the measured performance of the systems. The isolates fell into three bacterial divisions, Bacteroidetes, Proteobacteria, and Actinobacteria. In agreement with community results, bacteria isolated from systems pulsed every day with nutrients had higher growth rates and ectoaminopeptidase specific activities than isolates from systems pulsed every 14 days. However, the latter isolates did not survive starvation longer than those provided with nutrients every day. The present study demonstrates the dynamic nature of microbial communities exposed to even simple and regular environmental discontinuities when a substantial pool of species that can catabolize the limiting substrate is present.
A hypervariable region of Rhizobium 23S rDNA was amplified by polymerase chain reaction and phylogenetic relationships of several strains were determined by comparing nucleotide sequences of the amplified product. Variation in the 23S rDNA nucleotide sequences was consistent with phylogenetic relationships determined by host nodulation specificity and (or) 16S rDNA sequence analysis. Six strains representing three Rhizobium species (R. leguminosarum bv. trifolii, R. meliloti, and R. etli), and two strains each of Bradyrhizobium and Agrobacterium were clustered into five rDNA groups. Unique features identified by secondary structure analysis of the 23S rRNA sequenced region were consistent with the hypothesis that 23S rDNA could be used to design species- or strain-specific Rhizobium probes.
Actinobacillus actinomycetemcomitans is a Gram-negative coccobacillus which can cause certain severe extra-oral infections as well as forms of human periodontal disease such as localized juvenile periodontitis. In contrast to many prokaryotic and eukaryotic species which exhibit an intact 23S ribosomal RNA (rRNA) molecule, examination of six A. actinomycetemcomitans strains--including three serogroup representative strains and two strains from non-human primates--revealed that this micro-organism does not produce an intact 23S ribosomal RNA (rRNA) molecule but, rather, two smaller forms of 1.8 kb and 1.2 kb designated as 23S alpha and 23S beta fragments. On the other hand, 14 other strains of Actinobacillus, Haemophilus, and Pasteurella species demonstrated intact 23S rRNA. The sequence of the region of the 23S rRNA gene in A. actinomycetemcomitans strain ATCC 43718 containing the cleavage site was determined by dideoxynucleotide sequencing, while the location of the 3' and 5' termini of the 23S alpha and 23S beta fragments was resolved by S1 nuclease mapping and cDNA primer-extension. A deletion of 112 bases was noted in comparisons of base sequences from A. actinomycetemcomitans rRNA and rDNA. The DNA intervening sequence was localized to nucleotide 1180 of the Escherichia coli 23S rRNA map. While the primary structure of the gap region showed little homology with the gap regions described in other organisms, the secondary structure was similar to that previously described in the parasitic helminth Schistosoma japonicum. Restriction enzyme and nucleotide sequence analysis of the gap region in eight other A. actinomycetemcomitans strains showed it to be highly conserved.
Maintaining gut microbial homeostasis is crucial for host health, whereas infection with Escherichia coli (E. coli) is a major contributor to intestinal inflammation and microbial dysbiosis. Recent research has focused on probiotic strategies for managing enteric inflammatory disorders. Previous studies have shown that beneficial microorganisms show protection through modulating host immune responses, enhancing intestinal epithelial barrier integrity, and inhibiting pathogenic bacteria. To evaluate the prophylactic effectiveness of a recently isolated strain, Lacticaseibacillus casei 2S-1, in a murine model of E. coli-induced enteritis, this study focuses on interactions within the microbiota-intestinal-immune axis, together with host transcriptional responses and pathway enrichment associated with oxidative stress and mitochondrial function. In vitro analysis of probiotic features, including growth dynamics, acidogenic capacity, and tolerance to acidic and bile salt environments, as well as genetic safety profiling, followed the methodical isolation and taxonomic identification of L. casei 2S-1. A preventive intervention protocol was established, and a murine model of enteritis was induced by exposure to E. coli. Histopathological analyses were performed to observe in vivo safety and protective efficacy. Changes in gut microbial structure were characterized by 16S rRNA gene sequencing, while host responses were identified by intestinal immunohistochemistry and transcriptome profiling. L. casei 2S-1 showed probiotic properties. In vitro analyses showed that the strain exhibited tolerance to acidic and bile salt conditions, and its untreated culture supernatant showed antimicrobial activity against pathogenic bacteria. Its safety profile was supported by genomic analysis, which verified the lack of virulence-associated genes and antibiotic resistance factors. In vivo, L. casei 2S-1 pretreatment reduced mortality and intestinal inflammation, modulated gut microbial composition, and preserved intestinal barrier-associated protein expression in infected mice. This study provides experimental evidence supporting the prophylactic effects of L. casei 2S-1 and its associations with gut microbiota modulation and host transcriptional responses, providing a foundation for further investigation of probiotic-based preventive strategies against intestinal infections.
Two regions of the primary structure of the small subunit rRNA of Sarcocystis muris bradyzoites were compared with nucleotide sequences of S. gigantea, Toxoplasma gondii, Plasmodium berghei and Mus musculus and used to design genus- and species-specific probes for the detection and identification of coccidia. Total cellular RNA of purified S. muris, S. cruzi, T. gondii and Eimeria nieschulzi and coccidia-infected tissues of mouse, ox, sheep and pig, were assayed using twenty-base oligomers labelled with 32P. Hybridization occurred at temperatures ranging from 21 degrees C to 41 degrees C or 51 degrees C. One probe detected only S. muris and another successfully hybridized to several members of coccidia, including S. muris, S. cruzi, T. gondii and E. nieschulzi. One ng of total cellular RNA was sufficient to yield detectable hybrids in slot blot assays. The excellent sensitivity suggests that rRNA-based probes are capable of detecting individual parasites, and can assay low levels of coccidial infections not detectable by other methods. The results of this study show that it is possible to customize the specificity of rRNA-based probes for diagnostic, epidemiological or taxonomic purposes.
The new model for the tertiary structure of ribosomal 5 S rRNA from plants recently proposed by some of us has been already supported by RNase H digestions in the presence of complementary oligodeoxynucleotides. These results are confirmed now by the new biochemical and NMR spectroscopy data. Diethylpyrocarbonate (DEP) and monoperphthalic acid (MPA) are the reagents with the high specificity toward single-stranded adenosine residues. Our experiments clearly show that under native conditions adenosine 100 (A100) of lupin 5 S rRNA is not available for reaction toward these reagents. However under denaturing conditions this residue reacts with DEP and MPA. The detailed analysis of the lupin 5 S rRNA by NMR spectra provide the data on the specific interaction of A100-U53. Thus, we have seen for the first time the NMR signal due to the A100-U53 tertiary base pair, which as we believe, stabilizes interactions between loops B and E.
The primary structure of the 5.8S rRNA gene was established in 37 species of the genus Nicotiana representing four different sections of the subgenus Petuniodes: Acuminatae, Alatae, Noctiflorae, and Suaveolentes. On the basis of these data, phylogenetic analysis was performed. The obtained results are in good agreement with the modern systematics of the genus. However, the bootstrap analysis gives only poor statistical support for the branches of the phylogenetic tree owing to a small number of phylogenetically informative positions.
The standard model of eukaryotic ribosomal RNA (rRNA) genes involves tandem arrays with hundreds of units in clusters, the nucleolus organizer regions (NORs). A first genomic overview for human cells is reported here for these regions, which have never been sequenced in their totality, by using molecular combing. The rRNA-coding regions are examined by fluorescence on single molecules of DNA with two specific probes that cover their entire length. The standard organization assumed for rDNA units is a transcribed region followed by a nontranscribed spacer. While we confirmed this arrangement in many cases, unorthodox patterns were also observed in normal individuals, with one-third of the rDNA units rearranged to form apparently palindromic structures (noncanonical units) independent of the age of the donors. In cells from individuals with a deficiency in the WRN RecQ helicase (Werner syndrome), the proportion of palindromes increased to one-half. These findings, supported by Southern blot analyses, show that rRNA genes are a mosaic of canonical and (presumably nonfunctional) palindromic units that may be altered by factors associated with genomic instability and pathology.
The nucleotide sequences of small ribosomal RNA (5 S rRNA) molecules of different organisms are presumably designed to ensure folding of these molecules in some standard secondary structure(s). To extract this message contained in the sequences we have plotted the triangular matrix diagrams of all potential hairpins for 44 representative 5 S rRNA sequences. Subjecting these diagrams to simple image-processing procedures we have found that only five hairpins are universally present in all known 5 S rRNA molecules. Two of these hairpins share the same stretch of the nucleotide sequence, others being independent. Thus, only two major secondary structures of 5 S rRNA can be formed. These are of the well-known Y-like (open) form and a novel P-like form closed by the tertiary interaction which involves two complementary stretches four to seven bases long.
To learn if an mRNA.18S rRNA interaction or a special secondary structure in the mRNA start region is essential for translation in eukaryotic cells, we constructed recombinant plasmids with the SV40 early promoter 5' to part of the Escherichia coli tufB-lacZ gene. Deletion of bases potentially complementary to the 18S rRNA highly increased the transient beta-galactosidase expressed in transfected CHO cells. Deletion of bases that fostered formation of potential hairpins with the mRNA 5'-terminus or altered the structure of the coding region reduced beta-galactosidase activity suggesting that these features of the mRNA secondary structure may be essential for initiation of translation. Computer aided analysis of the potential structure of 290 mRNAs suggests these are conserved features of the initiation region.
The structure of the unspliced 35S precursor rRNA of Neurospora mitochondria was studied by psoralen photochemical cross-linking. The results show that when the 35S RNA is cross-linked in ribonucleoprotein particles (RNPs) under appropriate conditions, the predominant configuration is a 2.2 kb intron loop which brings opposite splice sites into proximity; that the predominant secondary structural feature in the free RNA is a relatively large hairpin (length = 0.105 kb) in the center of the molecule at or near the 5' splice site; that the intron loop and the central hairpin are different configurations of sequences at or near the 5' splice site; and that the intron loop is stabilized by protein components of RNPs. Based on the structures detected by psoralen photochemical cross-linking, we propose a mechanism for the splicing of the Neurospora mitochondrial precursor rRNA. We propose further that certain features of this mechanism may be relevant to the splicing of other RNAs, including eucaryotic mRNAs.
The L11 ribosomal protein operon in Escherichia coli consists of the genes for proteins L11 and L1 and is feedback regulated by the translational repressor L1. The mRNA target site for this repression is located close to the translation initiation site of the first L11 cistron. Several mutant plasmid molecules carrying altered nucleotide sequences in the L1 target site were constructed by site-directed in vitro mutagenesis using synthetic oligodeoxyribonucleotides. Specifically, we examined the importance of a presumptive double-stranded stem structure that is common among L1 binding sites on rRNA from a variety of organisms and in L11 mRNA. Mutational alterations that disrupt the stem structure were found to abolish translational regulation as analyzed both in vitro and in vivo. Two of the mutations were combined so that the stem structure was restored but with a different primary nucleotide sequence. This double mutant was shown to restore the original phenotype, the ability to be translationally regulated by L1. These experiments show the importance of the stem structure, but not its primary sequence, for the interaction of L1 with the mRNA and support the concept that mRNA target sites share some structural features with the corresponding ribosomal protein binding sites of rRNA.