SEARCH · PubMed Health

Results for “duplex sequencing”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,153 records · Page 64Linked to original sources

PubMed2000

Synthesis and monitored selection of 5'-nucleobase-capped oligodeoxyribonucleotides.

Oligodeoxynucleotides bearing 5'-appendages consisting of a nucleobase and an amide linkage were prepared from 5'-amino-5'-deoxyoligonucleotides, amino acid building blocks and thymine or uracil derivatives. Small chemical libraries of 5'-modified oligonucleotides bearing the nucleobase moieties via five, three or two atom linkages were subjected to spectrometrically monitored nuclease selections to identify members with high affinity for target strands. The smallest of the appendages tested, a uracil acetic acid substituent, was found to convey the greatest duplex stabilizing effect on the octamer 5'-T*GGTTGAC-3', where T* denotes the 5'-amino-5'-deoxythymidine residue. Compared to 5'-TTGGTTGAC-3', the modified sequence 5'-u-T*GGTTGAC-3' gives a duplex with 5'-GTCAACCAA-3' that melts 4 degrees C higher. The duplex-stabilizing effect of this 5'-substituent does not require a specific residue at the 3'-terminus of the complement and the available data suggest that the uracil moiety is located in the major groove of the duplex.

Acetic Acid↗

PubMed1997

The NMR structure of estrone (Es)-tethered tandem DNA duplex: [d(5'pCAGCp3')-Es] + [Es-d(5'pTCCA3')]: d(5'pTGGAGCTG3').

The solution structure of an estrone (Es)-tethered tandem DNA duplex consisting of two Es-tethered tetranucleotides and a target octameric DNA sequence is reported. The structure of this Es-tethered tandem duplex has been compared with a corresponding natural tandem duplex without estrones. The Tm of the 3'-Es-tethered tetranucleotide part of the tandem duplex increases by 5 degrees C, whereas the Tm of the 5'-Es-tethered tetranucleotide part increases by 7 degrees C, compared with the corresponding natural counterpart. The NMR structures of both the Es-tethered tandem duplex and the natural counterpart have been based on 24 experimental NMR constraints per residue. Despite the fact that there is considerable distortion at the junction of two Es-tethered tetranucleotides in the major groove of the Es-tethered DNA duplex compared to the natural counterpart, both duplexes do take up B-type DNA structures. It is likely that the spatial proximity of two Es residues, and the resulting hydrophobic interaction between them might be responsible for the increase of the thermal stability of the Es-tethered tandem duplex in comparison with the natural counterpart.

DNA↗

PubMed1993

Tetramethylammonium does not universally neutralize sequence dependent DNA stability.

Effects of different concentrations of Tetramethylammonium on the thermostability of six DNA dumbbells with similar well defined sequences have been investigated. Each molecule has a 16 base pair duplex stem linked on both ends by T4 single strand loops. Only the sequence of the four central base pairs distinguishes one molecule from the next. The distinguishing central sequences are, [A-T-A-T], [T-A-T-A], [A-A-A-A], [C-G-C-G], [G-C-G-C] and [G-G-G-G] situated between the sequences: 5'-G-T-A-T-C-C-[]-G-G-A-T-A-C-3' which are the same in all molecules. Optical melting curves collected on these molecules as a function of TMA concentration over the range from 0.09 M to 4.5 M revealed there is no single concentration of TMA where all these molecules exhibit the same melting temperature.

Base Sequence↗

PubMed1999

Discrimination of DNA duplexes with matched and mismatched tandem repeats by T4 endonuclease VII.

A simple in situ method for scoring short tandem DNA repeat length has been developed using T4 endonuclease VII. This method measures tandem repeated simple sequences embedded in unique sequences. Single-stranded loops are formed on duplexes containing mismatched (different) numbers of tandem repeats. No single stranded loops are formed on structures containing matched (identical) numbers of tandem repeats. The matched and mismatched loop structures were distinguished and differentially labeled by enzymatic treatment with T4 endonuclease VII.

Bacteriophage T4↗

PubMed1995

Conformational dynamism in d-(GAATTCCGTTATT) containing the complementary Myb responsive element d-CCGTTA: NMR and MD investigations.

Conformational features of the DNA segment d-(GAATTCCGTTATT) containing the complementary Myb responsive element CCGTTA has been studied by NMR and molecular dynamics calculations with a view to see the role of 3D structure in specific DNA recognition. From the low field imino proton NMR spectra, the DNA sequence is seen to exist as a duplex with pyrimidine mismatches in the centre. The 2D NMR spectra however show that teh molecule exhibits substantial dynamism even at 1 degree C. Several extra cross peaks, more than the expected number, are seen in particular regions in all the spectra. These observations indicate that the duplex undergoes slow transitions between base-paired and unbase-paired states due to mismatches in the centre. Hence, to characterise those transitions a restrained verlet dynamics has been performed for 50ps using X-PLOR force field. Structural intermediates at regular intervals have been analysed, and we see that the dynamism in the molecule results in substantial fluctuations in the different torsion angles. The mismatch sites are seen to exhibit the highest degree of fluctuations, with the bases stacking in and looping out of the duplex. The sugar geometry is seen to be fairly steady around the S domain for most of the residues.

Base Sequence↗

PubMed1996

A structural basis for the preferential binding of hemimethylated DNA by HhaI DNA methyltransferase.

The crystal structure of HhaI methyltransferase complexed with non-palindromic duplex DNA, containing a hemimethylated recognition sequence, and with the cofactor analog S-adenosyl-L-homocysteine (AdoHcy), has been determined. The structure provides an explanation for the stronger affinities of DNA methyltransferases for hemimethylated DNA than for unmethylated or fully methylated DNA in the presence of AdoHcy. The unmethylated target 2'-deoxycytidine flips out of the DNA helix and the CH group at position 5 makes van der Waals' contacts with the sulfur atom of AdoHcy. Selectivity/preference for hemimethylated over fully methylated DNA may thus reflect interactions among the chemical substituent (H or CH3) at the C5 position of the flipped cytosine, protein and the bound AdoHcy. The 5-methyl-2'-deoxycytidine on the complementary strand remains in the DNA helix, with the methyl group almost perpendicular to the carboxylate group of Glu239, which is part of the sequence recognition loop. Thus, selectivity/preference for hemimethylated over unmethylated DNA appears to result largely from van der Waals' contacts between the planar Glu239 carboxylate and the methyl group of the 5-methyl-2'-deoxycytidine. Furthermore, the positive electrostatic potential originating from the bound AdoHcy extends to the DNA phosphate groups flanking the flipped cytosine. The increased binding to DNA by long-range electrostatic interactions should also occur with the methyl donor S-adenosyl-L-methionine.

Amino Acid Sequence↗

PubMed1999

M-DNA: A complex between divalent metal ions and DNA which behaves as a molecular wire.

M-DNA is a complex of DNA with divalent metal ions (Zn(2+), Co(2+), or Ni(2+)) which forms at pH conditions above 8. Upon addition of these metal ions to B-DNA at pH 8.5, the pH decreases such that one proton is released per base-pair per metal ion. Together with previous NMR data, this result demonstrated that the imino proton in each base-pair of the duplex was substituted by a metal ion and that M-DNA might possess unusual conductive properties. Duplexes of 20 base-pairs were constructed with fluorescein (donor) at one end and rhodamine (acceptor) at the other. Upon formation of M-DNA (with Zn(2+)) the fluorescence of the donor was 95 % quenched. Fluorescence lifetime measurements showed the presence of a very fast component in the decay kinetics with tau</=10 ps. The fast component was absent in B-DNA and in M-DNA lacking an acceptor chromophore; a result which is only consistent with electron transfer. Efficient signal transduction was also observed between the two fluorophores separated by 54 base-pairs (over 150 A) in an M-DNA duplex. The addition of a sequence-specific DNA-binding protein prevented the flow of electrons and this was reversed by protease digestion. Therefore, M-DNA behaves as a molecular wire and could be manipulated to prepare self-assembling electronic circuits.

Base Sequence↗

PubMed2005

Silencing of Bak ameliorates apoptosis of human proximal tubular epithelial cells by Escherichia coli-derived Shiga toxin 2.

BACKGROUND: Escherichia coli-derived Shiga toxin (Stx), the cause of the enteropathic hemolytic uremic syndrome, is a potent inducer of apoptotic cell death. The present study was performed to examine the hypothesis that Stx initiates apoptosis by activating the mitochondrial pathway involving mitochondrial-associated, pro-apoptotic Bcl-2 family proteins Bax and Bak. MATERIALS AND METHODS: To determine if Stx2-mediated apoptosis is dependent on Bax or Bak, a gene-silencing approach was employed using sequence-specific small interfering (si)RNA duplexes. Silencing of Bax and Bak protein expression in human renal proximal tubular epithelial (HK-2) cells and its effect on Shiga toxicity was assessed by immunofluorescence microscopy and Western blotting. RESULTS: Transfection of HK-2 cells, shown to be exquisitely sensitive to Stx, with siRNA duplexes successfully diminished Bak, but not Bax protein expression. In order to determine if silencing of pro-apoptotic gene expression affects Stx-induced apoptosis, HK-2 cells were transfected with Bak-specific or control siRNA, exposed to lethal concentrations of Stx2 and assessed for cleavage of poly(ADPribose) polymerase-1 (PARP) as a marker of apoptosis, using Western blot technology. We observed that siRNA-induced reduction of Bak expression levels correlated with decreased PARP cleavage. CONCLUSION: Results suggest that Stx-induced cell death involves pro-apoptotic Bak and that silencing of Bak gene expression affords partial protection against Stx-mediated apoptosis.

Apoptosis↗

PubMed1992

Cloning of a human DNA sequence that restores expression of hepatic functions in a dedifferentiated rat hepatoma cell.

In a study of the regulation of gene expression in liver cells, a strain of dedifferentiated cells (C2) derived from the rat hepatoma line H4IIEC3 was transfected with DNA from human liver. After growth of these C2 variants in a glucose-free medium, revertants were selected which were characterized by the expression of a complete set of liver functions. A 4.3 kb human DNA sequence was detected with an Alu sequence probe in cells of four independent revertant clones and was shown to be an extrachromosomal, covalently closed duplex DNA. This molecule, called HALF1 for reversion inducing sequence, was cloned and transfected into C2 cells. Analyses of the transfectants indicated a correlation between the introduction of this cloned genomic human DNA sequence and the recovery of hepatic traits.

Adult↗

PubMed1978

Cloning of chemically synthesized lactose operators. II. EcoRI-linkered operators.

A 40 base, mainly duplex DNA segment, with the following sequence pAATTCCACATGTGGAATTGTGAGCGGATAACAATTTGTT (3') GGTGTACACCTTAACACTCGCCTATTGTTAAACACCTTAAp (5') has been synthesized by combination of chemical and enzymatic methods. It consists of a wild-type lactose operator sequence (boxed) bracketed by "linker" sequences which permit excision of the segment from plasmid vehicles by the EcoRI restriction endonuclease. This segment has been ligated into the pMB9 plasmid and the resulting operator plasmids used to transform E. coli K-12. Among the transformant products were strains carrying plasmids with one, two, three, or four operator segments in tandem. Derepression of the lactose operon effected by these plasmids in vivo as well as the lifetimes of complexes formed between repressor and these plasmids in vitro increase with increasing numbers of operators per plasmid.

Base Sequence↗

PubMed2006

Screening of threading bis-intercalators binding to duplex DNA by electrospray ionization tandem mass spectrometry.

The DNA binding of novel threading bis-intercalators V1, trans-D1, and cis-C1, which contain two naphthalene diimide (NDI) intercalation units connected by a scaffold, was evaluated using electrospray ionization mass spectrometry (ESI-MS) and DNAse footprinting techniques. ESI-MS experiments confirmed that V1, the ligand containing the -Gly3-Lys- peptide scaffold, binds to a DNA duplex containing the 5'-GGTACC-3' specific binding site identified in previous NMR-based studies. The ligand formed complexes with a ligand/DNA binding stoichiometry of 1:1, even when there was excess ligand in solution. Trans-D1 and cis-C1 are new ligands containing a rigid spiro-tricyclic scaffold in the trans- and cis- orientations, respectively. Preliminary DNAse footprinting experiments identified possible specific binding sites of 5'-CAGTGA-5' for trans-D1 and 5'-GGTACC-3' for cis-C1. ESI-MS experiments revealed that both ligands bound to DNA duplexes containing the respective specific binding sequences, with cis-C1 exhibiting the most extensive binding based on a higher fraction of bound DNA value. Cis-C1 formed complexes with a dominant 1:1 binding stoichiometry, whereas trans-D1 was able to form 2:1 complexes at ligand/DNA molar ratios >or=1 which is suggestive of nonspecific binding. Collisional activated dissociation (CAD) experiments indicate that DNA complexes containing V1, trans-D1, and cis-C1 have a unique fragmentation pathway, which was also observed for complexes containing the commercially available bis-intercalator echinomycin, as a result of similar binding interactions, marked by intercalation in addition to hydrogen bonding by the scaffold with the DNA major or minor groove.

Binding Sites↗

PubMed2005

Crystal structure of the human LRH-1 DBD-DNA complex reveals Ftz-F1 domain positioning is required for receptor activity.

The DNA-binding and ligand-binding functions of nuclear receptors are localized to independent domains separated by a flexible hinge. The DNA-binding domain (DBD) of the human liver receptor homologue-1 (hLRH-1), which controls genes central to development and metabolic homeostasis, interacts with monomeric DNA response elements and contains an Ftz-F1 motif that is unique to the NR5A nuclear receptor subfamily. Here, we present the 2.2A resolution crystal structure of the hLRH-1 DBD in complex with duplex DNA, and elucidate the sequence-specific DNA contacts essential for the ability of LRH-1 to bind to DNA as a monomer. We show that the unique Ftz-F1 domain folds into a novel helix that packs against the DBD but does not contact DNA. Mutations expected to disrupt the positioning of the Ftz-F1 helix do not eliminate DNA binding but reduce the transcriptional activity of full-length LRH-1 significantly. Moreover, we find that altering the Ftz-F1 helix positioning eliminates the enhancement of LRH-1-mediated transcription by the coactivator GRIP1, an action that is associated primarily with the distantly located ligand-binding domain (LBD). Taken together, these results indicate that subtle structural changes in a nuclear receptor DBD can exert long-range functional effects on the LBD of a receptor, and significantly impact transcriptional regulation.

Alanine↗

PubMed2001

Protonation studies and multivariate curve resolution on oligodeoxynucleotides carrying the mutagenic base 2-aminopurine.

2-Aminopurine (P) is a mutagen causing A.T to G.C transitions in prokaryotic systems. To study the base-pairing schemes between P and cytosine (C) or thymine (T), two self-complementary dodecamers containing P paired with either C or T were synthesized, and their protonation equilibria were studied by acid-base titrations and melting experiments. The mismatches were incorporated into the self-complementary sequence d(CGCPCCGGXGCG), where X was C or T. Spectroscopic data obtained from molecular absorption, circular dichroism (CD), and molecular fluorescence spectroscopy were analyzed by a factor-analysis-based method, multivariate curve resolution based on the alternating least squares optimization procedure (MCR-ALS). This procedure allows determination of the number of acid-base species or conformations present in an acid-base or melting experiment and the resolution of the concentration profiles and pure spectra for each of them. Acid-base experiments have shown that at pH 7, 150 mM ionic strength, and 37 degrees C, both C and P are deprotonated. At pH near 4, the majority of species shows C protonated and P deprotonated. Finally, at pH values near 3, the majority of species shows both protonated C and P. These results are in agreement with NMR studies showing a wobble geometry for the P x C base pair and a Watson-Crick geometry for the P x T base pair at neutral pH. Melting experiments were carried out to confirm the proposed acid-base distribution profile. For the sequence including the P x T mismatch, only one transition was observed at neutral pH. However, for the sequence including the P x C mismatch, two transitions were detected by CD but only one by molecular absorption. This behavior agrees with that observed by other authors for oligonucleotides of similar sequence and suggests the following sequence of conformational changes during melting: duplex --> hairpin --> random coil.

2-Aminopurine↗

PubMed2002

Structural and functional studies of an intermediate on the pathway to operator binding by Escherichia coli MetJ.

We present the results of in vitro DNA-binding assays for a mutant protein (Q44K) of the E. coli methionine repressor, MetJ, as well as the crystal structure at 2.2 A resolution of the apo-mutant bound to a 10-mer oligonucleotide encompassing an 8 bp met-box sequence. The wild-type protein binds natural operators co-operatively with respect to protein concentration forming at least a dimer of repressor dimers along operator DNAs. The minimum operator length is thus 16 bp, each MetJ dimer interacting with a single met-box site. In contrast, the Q44K mutant protein can also bind stably as a single dimer to 8 bp target sites, in part due to additional contacts made to the phosphodiester backbone outside the 8 bp target via the K44 side-chains. Protein-protein co-operativity in the mutant is reduced relative to the wild-type allowing the properties of an intermediate on the pathway to operator site saturation to be examined for the first time. The crystal structure of the decamer complex shows a unique conformation for the protein bound to the single met-box site, possibly explaining the reduced protein-protein co-operativity. In both the extended and minimal DNA complexes formed, the mutant protein makes slightly different contacts to the edges of DNA base-pairs than the wild-type, even though the site of amino acid substitution is distal from the DNA-binding motif. Quantitative binding assays suggest that this is not due to artefacts caused by the crystallisation conditions but is most likely due to the relatively small contribution of such direct contacts to the overall binding energy of DNA-protein complex formation, which is dominated by sequence-dependent distortions of the DNA duplex and by the protein-protein contact between dimers.

Bacterial Proteins↗

PubMed1983

Crystallographic data for complexes of the Cro repressor with DNA.

Complexes of the bacteriophage lambda Cro repressor with two DNA duplexes have been crystallized. The DNA sequences are equimolar mixtures of ApTpCpApCpC and its complementary strand and ApCpCpGpCpApApGpG and its complementary strand, which are both parts of the lambda OR3 operator. The space group of both co-crystals is C2221 with cell dimensions a = 81.1 A, b = 89.2 A, and c = 80.0 A. Analysis of dissolved crystals shows that they respectively contain approximately two hexamers per Cro dimer and one nonamer per dimer. The co-crystals diffract to about 3 A resolution and appear suitable for structural studies.

DNA↗

PubMed1996

High pressure effects on conformation of homo- and heteroduplexes of nucleic acids.

Four different chemically synthesized single stranded complementary oligonucleotides: DNA I, d(GCGCGCATATAT); RNA I, r(AUAUAUGCGCGC): RNA II, r(GGCCGGUUAAUU); and RNA III, r(AAUUAACCGGCC) were studied in order that the effects of high pressure on heteroduplex and homoduplex structures could be understood. The oligonucleotides were subjected to a high pressure at low and/or high salt buffer and analyzed by circular dichroism spectroscopy. In these conditions, both DNA-RNA and RNA-RNA duplexes with different purine-pyrimidine sequences change their conformation. The heteroduplex DNA I-RNA I with the complementary alternating purine-pyrimidine sequence, does not change its conformation of A type at high salt alone or at high salt and high pressure applied together. The homoduplex RNA II-RNA III with purine-purine-pyrimidine-pyrimidine sequence does not change strongly its. A-RNA conformation either. However, a structure of the homoduplex is affected by high pressure alone or with high salt as concluded from shifting the maximum of the CD spectrum to around 265 nm and inducing higher Cotton effect. These observations clearly suggest some conformational changes of the homoduplex. A single stranded oligonucleotide (RNA I) and oligodeoxynucleotide (DNA I) alone showed up a different conformation. The CD spectrum of RNA I is similar to that of A-RNA structure, out that of DNA I shows a very small Cotton effect and has not an ordered structure.

Circular Dichroism↗

PubMed1994

Sensitivity of HIV-1 reverse transcriptase and its mutants to inhibition by azidothymidine triphosphate.

HIV-1 reverse transcriptase can catalyze the addition of either azidothymidine monophosphate (AZTMP) or thymidine monophosphate (dTMP) to a primer strand opposite template adenosine bases. The ratio of incorporation of AZTMP to dTMP as catalyzed by HIV-1 reverse transcriptase has been determined to be 0.4 using an RNA-DNA duplex substrate prepared from oligonucleotides with sequences taken from the HIV-1 genome sequence. Slight variations are found for the incorporation ratio of the two nucleotides on other substrates. Substrates containing more than one adenosine in the single-stranded part of the template allow for more chances to incorporate AZTMP and less full-length product. Variations in the intensity of bands on an autoradiograph of a DNA sequencing gel corresponding to different positions of incorporation of AZTMP suggest that not all template adenosine positions offer the same level of discrimination against incorporation of AZTMP. A reverse transcriptase containing a set of four mutations (D67N, K70R, T215Y, K219Q) known to cause resistance to AZT in cell culture assays has a ratio of incorporation that is 0.77 +/- 0.03 times the ratio for the wild-type reverse transcriptase opposite one specific template adenosine. In contrast, a hybrid mutant containing the same four mutations that cause resistance to AZT and an additional mutation, Y181C, which by itself causes resistance to the non-nucleoside inhibitor L-697,661 [Sardana et al. (1992), J. Biol. Chem. 267, 17526-17530], has a ratio of incorporation that is 1.34 +/- 0.01 times that of the wild-type, indicating that the hybrid mutant enzyme is more susceptible to inhibition by AZTTP than the wild-type reverse transcriptase.(ABSTRACT TRUNCATED AT 250 WORDS)

Antiviral Agents↗

PubMed1996

Investigation of the structural basis for thermodynamic stabilities of tandem GU mismatches: solution structure of (rGAGGUCUC)2 by two-dimensional NMR and simulated annealing.

The duplex (rGAGGUCUC)2 contains the motif [sequence: see text] which is unusually stable compared with other symmetric tandem GU mismatches and occurs in the P5 helix of the group I intron of Tetrahymena thermophila. The three-dimensional solution structure of (rGAGGUCUC)2 was determined using two-dimensional NMR and a simulated annealing protocol. The structure is remarkably similar to the A-DNA crystal structure of (dGGGGTCCC)2 [Kneale, G., Brown, T., & Kennard, O. (1985) J. Mol. Biol. 186, 805-814] which contains the analogous motif [sequence: see text]. Incorporation of the [sequence: see text] motif has little effect on backbone torsion angles and helical parameters compared with standard A-form. The only significant departure from A-form is a slight overtwisting 5' of the G in the GU mismatch and a displacement of the mismatches toward the minor groove. Inspection of stacking patterns of this structure and comparison with symmetric tandem GT mismatches in A-DNA oligonucleotides from crystal structure data suggest that electrostatics are important in determining motif stability.

Hydrogen Bonding↗