SEARCH · PubMed Health

Results for “simple sequence repeat”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,153 records · Page 64Linked to original sources

PubMed2005

[Genetic relationships among Fructus Aurantii cultivars revealed by ISSR].

OBJECTIVE: A total of 27 samples belonging to 5 cultivars of Fructus Aurantii (Citrus aurantium), i. e. cv. Xiucheng, cv. Xiangcheng, cv. Lecheng, cv. Jizicheng, and cv. Youzicheng, collected at Changfu and Huanggang, Zhangshu City, Jiangxi Province, were assayed to reveal the genetic relationship among the cultivars and the accordance between morphological and molecular markers. METHOD: Cultivar identification was based on morphology and cultivar relationship was based on Inter-simple sequence repeats (ISSR). RESULT: Twenty out of 40 ISSR primers screened generated 392 loci across all 27 samples with 315 informative loci. The UPGMA dendrogram showed that samples within cv. Xiucheng and cv. Xiangcheng from Changfu were closely related. However, samples of cv. Lecheng, cv. Jizicheng and cv. Youzicheng from Huanggang, or cv. Xiucheng and cv. Xiangcheng from both Changfu and Huanggang did not exhibited close relationships within each cultivars. CONCLUSION: Based on morphology the same cultivar grown in different plantations, or even within a single plantation sometimes do not show close genetic relationship, indicating diverse origin of the cultivars. Synonyms or homonyms are believed to common phenomenon in Fructus Aurantii production. To solve the problem ISSR markers can serve a kind of molecular markers which are preferable to partition genetic variations within and between cultivars and to establish genetic relationships among them.

Citrus↗

PubMed2006

[The effect of the duration of callus culture on the accumulation of genetic alterations in regenerated pea Pisum sativum L].

Two groups of regenerant plants were obtained from different pea genotypes (lines R-9 and W1 and cultivar Viola). The first group was derived after eight months of culture and the second, from calluses cultured for a prolonged (more than ten years) time. Using random amplified polymorphic DNA (RAPD) and inter simple sequence repeats (ISSR) methods, the regenerants and the original lines were compared with regard to genetic differences. The regenerants from both groups were shown to differ in DNA polymorphism from the original lines and from one another. The divergence of the regenerants was also different, depending largely on the original genotype. Examination of genetic differences between the first and the second group showed that the variability increased with culturing time. This was particularly evident for regenerants of the Viola cultivar, in which variability ranged from 0-5% (first group of regenerants) to 10% (second group of regenerants).

DNA, Plant↗

PubMed2006

[SSR polymorphism on the waxy gene locus and their relationship to amylose content in wheat].

Variation of one simple sequence repeat (SSR)(AT (AT)n AT) in the 3 end of the waxy gene was analyzed in samples of 32 cultivars, including different wheat cultivars in Shandong region and representing a wide distribution range of amylose content (AC) in cultivated wheat. In this study, we found two fragments were present in all cultivars, one of 204bp, the expected size, and one of 225-346bp. 204bp fragment located on the chromosome 7DS, while 225-346bp fragment located on the chromosome 7AS. That is, Wx-Ala gene and Wx-Dla gene present in all wheat lines, but the larger fragment showed length polymorphism. The result showed that the amylose level is highly positive correlated with the length of the polymorphic SSR. Amplified fragment is long in high AC cultivars and electrophoresis migration rate is small, while the fragment is short in low AC cultivars and electrophoresis migration rate is large. AC is highly diverse among different lines with the various SSR genotypes. Although the SSR variation did not seem to have obvious function in the synthesis of the starch synthase encoded by the waxy gene, the correlation between the SSR and AC level could be used as molecular marker for quality improvement in wheat programs.

Amylose↗

PubMed1991

Position and orientation-dependent effects of a eukaryotic Z-triplex DNA motif on episomal DNA replication in COS-7 cells.

A cluster of simple repeated sequences composed of 5'-(GC)5(AC)18(AG)21(G)9(CAGA)4GAGGGAGAGAGGCAGAGAGGG(AG)27-3 ' located near the origin of replication associated with the Chinese hamster dhfr gene has been shown to adopt multiple Z-form and triplex DNA structures under various experimental conditions (Bianchi, A., Wells, R. D., Heintz, N. H., and Caddle, M. S. (1990) J. Biol. Chem. 265, 21789-21796). Thus, we refer to the cluster of alternating repeats as a Z-triplex DNA motif. Primer extension studies indicate that DNA polymerases traverse the Z-triplex sequence more readily in the Z to triplex direction than in the triplex to Z direction. To examine the effect of these sequences on replication fork travel in living cells, the Z-triplex motif was cloned in both orientations on the early and late side of the SV40 origin of replication in the vector pSV011. Test constructs were cotransfected along with pSV011 into COS-7 cells, and plasmid replication was monitored by the accumulation of DpnI-resistant replication products. A single copy of the Z-triplex motif reduced plasmid replication after 48 h by 20-50%, depending upon the position and orientation of the insert relative to the SV40 origin sequences. The replication of plasmids containing two copies of the Z-triplex motif, in different orientations on either side of the SV40 origin, was reduced by 85-95% as compared to the cotransfected control. Two-dimensional gel analysis of replication intermediates failed to show absolute termination of replication fork travel at the Z-triplex sequences, but rather indicated that the Z-triplex region causes replication intermediates to accumulate during the late phases of replication. These results indicate that the dhfr Z-triplex region has complex effects on both replication fork movement and the termination phases of episomal DNA synthesis in animal cells.

Animals↗

PubMed1985

Complete nucleotide sequence of the murine gamma 3 switch region and analysis of switch recombination sites in two gamma 3-expressing hybridomas.

The heavy chain isotype switch is mediated by a DNA rearrangement between a donor switch region (usually mu) and a recipient switch region (gamma, epsilon, or alpha). Switch regions lie upstream of the appropriate heavy chain constant region gene and are composed of simple sequences repeated in tandem. It is not known to what extent the tandemly repeated sequences are important to the heavy chain switch recombination, and to what extent other features of switch region sequences might contribute to the switch process. We studied switches to the gamma 3 isotype by sequencing the entire gamma 3 switch region. This switch region is composed of forty-four 49 base pair units repeated in tandem. These repeated units share modest homology with the mu switch region repeated elements. Evolution of the gamma 3 switch region seems to involve insertions and deletions of the 49mer elements. We also molecularly cloned rearranged switch regions from two gamma 3-expressing hybridomas and determined the DNA sequences at the mu-gamma 3 recombination sites. We located these switch recombination sites within the germ-line gamma 3 switch region, as well as switch recombination sites from two myelomas. All four sites are found in the 5' one-third of the gamma 3 switch region. We discuss some additional trends in the sequence data near these four recombination sites.

Animals↗

PubMed1995

Microsatellite instability in colorectal adenocarcinoma cell lines that have full-length adenomatous polyposis coli protein.

Almost 20% of colon cancers are characterized by genomic instability at simple repeated sequences. This instability is the result of a deficient DNA mismatch repair system. Sporadic, as well as hereditary carcinomas of the proximal colon display this effect. In this study, we examined colorectal adenocarcinoma cell lines, with or without wild-type adenomatous polyposis coli (APC) protein, for the presence of microsatellite instability. The three cell lines that maintained full-length APC protein also displayed the highest level of instability, suggesting a negative correlation between APC mutations and microsatellite instability. This data, in addition to other studies that show a negative correlation between microsatellite instability and mutations in p53 and K-ras, support the idea of a second pathway for colorectal cancer development.

Adenocarcinoma↗

PubMed1995

Allelic loss of sequences from the long arm of chromosome 10 and replication errors in endometrial cancers.

Thirty-seven endometrial cancers were subjected to an allelotype analysis in an attempt to identify chromosomal regions that are lost in a significant portion of tumors and to identify tumors characterized by replication errors. Thirty-nine highly polymorphic microsatellite markers representing all chromosomal arms, excluding the X and the short arms of the acrocentrics, were examined. An average of 20 informative cases were evaluated for each marker. Genetic alterations were detected in 30 of the 37 tumors. Replication errors were identified in 8 tumor specimens. Loss of heterozygosity was observed for loci on all chromosomes examined with the exception of chromosomes 4 and 20. The two most frequent sites of loss were at the marker loci examined on 10q (40%) and 17p (29%). Six additional simple sequence repeat markers from 10q were genotyped in an effort to refine the region of 10q loss. The chromosome 10 markers used in these studies were physically mapped with the use of a panel of somatic hybrids that retain defined portions of chromosome 10. The observed patterns of loss of sequences on 10q suggest a role for a tumor suppressor gene in the 10q23-26 region in the development or progression of endometrial cancers.

Alleles↗

PubMed1995

Linkage disequilibrium and haplotype analysis among Polish families with spinal muscular atrophy.

Spinal Muscular Atrophy (SMA) is an inherited degenerative disorder of anterior horn cells that results in progressive muscle weakness and atrophy. The autosomal recessive forms of childhood-onset SMA have been mapped to chromosome 5q11.2-13.3, in a number of studies examining different populations. A total of 9 simple sequence repeat markers were genotyped against 32 Polish families with SMA. The markers span an approximately 0.7 cM region defined by the SMA flanking markers D5S435 and MAP1B. Significant linkage disequilibrium (corrected P < .05) was detected at four of these markers, with D/Dmax values of < or = .89. Extended haplotype analysis revealed a predominant haplotype associated with SMA. The apparently high mutation rate of some of the markers has resulted in a number of haplotypes that vary slightly from this predominant haplotype. The predominant haplotype and these closely related patterns represent 25% of the disease chromosomes and none of the nontransmitted parental chromosomes. This predominant haplotype is present both in patients with acute (type I) and in chronic (types II and III) forms of SMA and occurs twice in a homozygous state, both times in children with chronic SMA.

Adolescent↗

PubMed1994

Alu-Alu recombination results in a duplication of seven exons in the lysyl hydroxylase gene in a patient with the type VI variant of Ehlers-Danlos syndrome.

The type VI variant of the Ehlers-Danlos syndrome (EDS) is a recessively inherited connective-tissue disorder. The characteristic features of the variant are muscular hypotonia, kyphoscoliosis, ocular manifestations, joint hypermobility, skin fragility and hyperextensibility, and other signs of connective-tissue involvement. The biochemical defect in most but not all patients is a deficiency in lysyl hydroxylase activity. Lysyl hydroxylase is an enzyme that catalyzes the formation of hydroxylysine in collagens and other proteins with collagen-like amino acid sequences. We have recently reported an apparently homozygous large-duplication rearrangement in the gene for lysyl hydroxylase, leading to the type VI variant of EDS in two siblings. We now report an identical, apparently homozygous large duplication in an unrelated 49-year-old female originally analyzed by Sussman et al. Our simple-sequence-repeat-polymorphism analysis does not support uniparental isodisomy inheritance for either of the two duplications. Furthermore, we indicate in this study that the duplication in the lysyl hydroxylase gene is caused by an Alu-Alu recombination in both families. Cloning of the junction fragment of the duplication has allowed synthesis of appropriate primers for rapid screening for this rearrangement in other families with the type VI variant of EDS.

Base Sequence↗

PubMed1994

Identification of a microsatellite instability phenotype in meningiomas.

To better understand the molecular mechanisms responsible for meningioma tumorigenesis we previously utilized subtractive hybridization protocols to identify genes the expression or structure of which is altered in these common brain tumors. Here we show that a CA dinucleotide repeat element present in one complementary DNA isolated by this approach has undergone a contraction in size in a meningioma cell line. Extension of this initial observation has revealed widespread genetic alterations affecting simple repeat sequences in this and other meningiomas. These data indicate that genetic instability may play a previously unrecognized role in the etiology of meningiomas.

Base Sequence↗

PubMed1994

Common regions of deletion in chromosome regions 3p12 and 3p14.2 in primary clear cell renal carcinomas.

Nearly all clear cell renal cell carcinomas (RCCs) exhibit loss of alleles on the short arm of chromosome 3. Loss and mutation at the von Hippel-Lindau (VHL) gene at 3p25 probably occurs in most RCCs and, since the VHL gene was recently cloned, data on VHL involvement in RCCs is accumulating. However, the region 3p14-p12, a region that contains the familial RCC-associated t(3;8)(p14.2;q24) chromosome translocation and the small cell lung carcinoma-associated homozygous deletion at 3p13-12, has also been reported to exhibit allele loss in a large fraction of RCCs. In order to focus future studies on potential suppressor genes in the 3p14-p12 region, we have studied allele loss in 30 RCCs with 9 polymorphic simple sequence repeat markers spanning 3p21.1-p12. Partial losses in the 3p21-p12 region were observed, allowing determination of common regions of loss of heterozygosity overlap in 15 RCCs. Results suggested that most RCCs exhibit loss in a region which brackets the t(3;8) familial chromosome translocation at 3p14.2, and some show additional deletions within the U2020 small cell lung carcinoma deletion at 3p12.

Adenocarcinoma, Clear Cell↗

PubMed1994

Genetic mapping of the BRCA1 region on chromosome 17q21.

Chromosome 17q21 harbors a gene (BRCA1) associated with a hereditary form of breast cancer. As a step toward identification of this gene itself we developed a number of simple-sequence-repeat (SSR) markers for chromosome 17 and constructed a high-resolution genetic map of a 40-cM region around 17q21. As part of this effort we captured genotypes from five of the markers by using an ABI sequencing instrument and stored them in a locally developed database, as a step toward automated genotyping. In addition, YACs that physically link some of the SSR markers were identified. The results provided by this study should facilitate physical mapping of the BRCA1 region and isolation of the BRCA1 gene.

Base Sequence↗

PubMed1994

An allelotype of squamous carcinoma of the head and neck using microsatellite markers.

The detection in tumors of genomic regions with a high frequency of loss of heterozygosity has led to the localization and subsequent cloning of a number of tumour suppressor genes. To identify such regions involved in the development of squamous carcinoma of the head and neck we have analyzed 28 paired normal and tumor DNA samples. Using the polymerase chain reaction to amplify 50 simple sequence repeats or microsatellite markers we have studied all 22 q limbs and 17 of the p limbs in 21 patients. In informative cases we observed a high incidence of loss of heterozygosity at five specific chromosomal regions: 3p (44%); 5q (43%); 9q (35%); 11q (45%); and 17p (31%). In addition, further analysis of tumors showing loss of heterozygosity at 5q suggests that a gene at or near the APC locus is involved in squamous carcinoma of the head and neck.

Carcinoma, Squamous Cell↗

PubMed1993

[DNA fingerprint method of the cultured cells].

DNA fingerprint method is very available not only to examine the cross-contamination of cultured cell lines and their origins and but to know the somatic mutation frequency in the cultured cells by exposure of radiation and chemicals. The method for DNA fingerprint was grouped in the following four types in term of probe; multilocus minisatellite probe, simple sequence repeat probe, locus specific minisatellite probe and repeat unit sequence variation in minisatellites.

Cell Line↗

PubMed1994

Defective mismatch repair in extracts of colorectal and endometrial cancer cell lines exhibiting microsatellite instability.

A replication error (RER+) phenotype, characterized by somatic instability in simple repeated sequences, is associated with several types of cancer. To determine if a defect in DNA replication fidelity or repair of replication errors might explain this instability, we compared both processes in cell-free extracts from RER+ endometrial and colorectal cancer cell lines to RER- cell lines. SV40 origin-dependent replication of a microsatellite sequence is highly accurate in cell extracts regardless of their RER phenotype. However, extracts from RER+ cell lines are defective in mismatch repair, while extracts of RER- cell lines are not. Lack of repair was observed when the signal (a nick) for strand-specific repair was either 3' or 5' to the mispair. One colorectal cancer cell line contained deletions in both alleles of the putative mismatch repair gene hMSH2, and one endometrial cancer cell line contained a 4-base pair duplication in one hMSH2 allele. No hMSH2 mutation was detected in the other allele or in the other five RER+ cell lines. Repair was readily detected when each of the defective extracts was mixed with a repair-proficient extract, demonstrating that no trans-acting inhibitor is present. Attempts to complement the repair deficiencies by mixing two different defective extracts identified three combinations that restored repair. The data suggest that: (i) defective repair is associated with colorectal and endometrial cancer and, by extrapolation, with other types of cancer; (ii) mutations in the hMSH2 gene, and possibly other genes, result in defective mismatch repair; (iii) the defect(s) in these lines likely involves pre-incision events or the excision step, but not the incision, polymerization, or ligation steps; and (iv) at least four functional complementation groups for mismatch repair may be involved in human cancer.

Cell Line↗

PubMed1993

Allelic loss on a chromosome 17 in ductal carcinoma in situ of the breast.

Multiple tumor suppressor genes are implicated in the oncogenesis and progression of invasive carcinoma of the breast. To investigate the chronology of genetic changes we studied loss of heterozygosity on chromosome 17 in ductal carcinoma in situ, a preinvasive breast cancer. A microdissection technique was used to separate tumor from normal stromal cells prior to DNA extraction and loss of heterozygosity was assayed mainly using simple sequence repeat polymorphism markers and the polymerase chain reaction. Loss of heterozygosity on 17p was observed in 8 of 28 tumors (29%) when compared with normal control DNA, whereas no loss was seen on 17q, suggesting that at least one locus on 17p is involved early in the development of breast cancer.

Alleles↗

PubMed1993

Linkage localization of X-linked Charcot-Marie-Tooth disease.

Charcot-Marie-Tooth disease (CMT), also known as hereditary motor and sensory neuropathy, is a heterogeneous group of slowly progressive, degenerative disorders of peripheral nerve. X-linked CMT (CMTX) (McKusick 302800), a subdivision of type I, or demyelinating, CMT is an X-linked dominant condition with variable penetrance. Previous linkage analysis using RFLPs demonstrated linkage to markers on the proximal long and short arms of the X chromosome, with the more likely localization on the proximal long arm of the X chromosome. Available variable simple-sequence repeats (VSSRs) broaden the possibilities for linkage analysis. This paper presents new linkage data and recombination analysis derived from work with four VSSR markers--AR, PGKP1, DXS453, and DXYS1X--in addition to analysis using RFLP markers described elsewhere. These studies localize the CMTX gene to the proximal Xq segment between PGKP1 (Xq11.2-12) and DXS72 (Xq21.1), with a combined maximum multipoint lod score of 15.3 at DXS453 (theta = 0).

Charcot-Marie-Tooth Disease↗

PubMed1995

Most liver epithelial cell lines from C3B6F1 mice exhibit parentally-biased loss of heterozygosity at the Lci (Liver cell immortalization) locus on chromosome 4.

Liver epithelial cell lines established from F1 animals generated from hepatocarcinogen-sensitive C3H/HeJ and -resistant C57BL/6J mice were analysed for loss of heterozygosity at more than 60 simple sequence repeat marker loci distributed over all of the autosomal chromosomes. Nineteen of 20 clonal cell lines showed loss of heterozygosity at a chromosome 4 locus, designated Lci (Liver cell immortalization) and in most of the cases (18 of 19), alleles from the hepatocarcinogen-resistant parental strain, C57BL/6J, were lost. Detailed deletion mapping localized the putative suppressor gene for immortalization to within a 2 cM interval which includes a cluster of genes for gap junctional proteins. We also observed a loss of heterozygosity on chromosomes 7, 14, or 17 in more than 50% of the cell lines.

Animals↗