PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “Bioinformatics”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,207 records · Page 67Linked to original sources
PubMed2005

[Identification and analysis of a mouse gene homologous to human hepatitis B virus pre-S1 protein-binding protein using the bioinformatics method].

OBJECTIVE: To clone and identify the mouse gene homologous to human hepatitis B virus (HBV) pre-S1 protein-binding protein (PS1BP). METHODS: The human PS1BP cDNA sequence was used as the reference sequence to search homologous mouse cDNA sequence from GenBank established by National Center for Biotechnology (NCBI), National Institute of Health (NIH), for its homologous cDNA sequences of mouse by BLASTn tool. The characteristics of mouse PS1BP protein primary structure were predicted by online software. Finally the genomic DNA structure of mouse PS1BP was deduced and compared. RESULTS: The mouse PS1BP was identified and consisted of 1455 nt, coding a protein of 484 aa. The identity of human and mouse PS1BP protein is 84.92% (411/484). The genomic DNA of mouse PS1BP consisted of 3 exons and 2 introns. CONCLUSION: The identification and characterization of mouse PS1BP cDNA and genomic DNA pave a way for further study of their structures and functions.

Amino Acid Sequence↗
PubMed2005

[Bioinformatic analysis of the 14-3-3 gene family in rice].

Using two-step HMM (hidden markov model) scan strategy,eight 14-3-3-like proteins were identified by searching the Oryza sativa L. ssp. japonica protein database. From them four genes were newly detected in this study. We confined the genes expressing in Nipponbare by EST search. Expression analysis also showed each gene expressed diversely within any individual,this tends suggested specific function of particular gene. Alignment of amino acid sequences suggested that there could be isoform function of the specific residues. The analyses of gene structure and chromosome location indicated that rice genome contains both epsilon and no-epsilon forms of 14-3-3 proteins. In addition,we analyzed the evolution of the rice 14-3-3 protein family.

14-3-3 Proteins↗
PubMed2005

Bioinformatics of the Paracoccidioides brasiliensis EST Project.

Paracoccidioides brasiliensis is the etiological agent of paracoccidioidomycosis, an endemic mycosis of Latin America. This fungus presents a dimorphic character; it grows as a mycelium at room temperature, but it is isolated as yeast from infected individuals. It is believed that the transition from mycelium to yeast is important for the infective process. The Functional and Differential Genome of Paracoccidioides brasiliensis Project--PbGenome Project was developed to study the infection process by analyzing expressed sequence tags--ESTs, isolated from both mycelial and yeast forms. The PbGenome Project was executed by a consortium that included 70 researchers (professors and students) from two sequencing laboratories of the midwest region of Brazil; this project produced 25,741 ESTs, 19,718 of which with sufficient quality to be analyzed. We describe the computational procedures used to receive process, analyze these ESTs, and help with their functional annotations; we also detail the services that were used for sequence data exploration. Various programs were compared for filtering and grouping the sequences, and they were adapted to a user-friendly interface. This system made the analysis of the differential transcriptome of P. brasiliensis possible.

Brazil↗
PubMed2005

Genomic profiling. Interplay between clinical epidemiology, bioinformatics and biostatistics.

OBJECTIVES: The current literature on the use of microarrays to generate prognostic profiles is still a methodological wasteland. Many valid questions, such as how profiling studies should be evaluated and what conclusions can be drawn, remain unanswered. Or how can flaws in the collection, analysis and interpretation of data be detected? Undiscovered imperfections can lead to a waste of valuable resources as well as be a latent source of false conclusions. METHODS: Three seminal papers on the prognosis of breast cancer using genomic profiling will be discussed. Six principles of good experimental design will be used for methodological guidance: defining relevant endpoints, avoiding systematic bias, generalizability of results, appropriately sized samples to achieve sufficient power, simple design to improve interpretability, and avoiding artificial assumptions. RESULTS: Severe violations of at least one of the six principles of good experimental design can be found in each of the three papers. A strategy is presented to assess whether a study has achieved a high level of methodological quality. This strategy also helps to establish a suitable protocol for future profiling projects. CONCLUSIONS: Determining the design of a study in a protocol is a first step to avoid impending pitfalls. The protocol should deal with the problem of understanding the complex reality behind genomic profiling. There are basic guiding principles which can help handle the complex task of designing prognostic studies to find genomic signatures.

Biometry↗
PubMed2005

[Cloning and bioinformatics analysis of a thrombin-like enzyme gene from Agkistrodon acutus].

The venoms of Viperidae and Crotalidae snakes contain a large variety of proteins and peptides affecting the hemostatic system, which classified as coagulant, anticoagulant and fibrinolytic factors. To obtaind the thrombin-like enzyme gene of snake venoms, primers 1 5' ATGGTGCTGATCAGAGTGCTAGC 3' and 2 5' CTCCTCTTAA-CTTTTTCAAAAGTTT 3' were designed according to the snake venom thrombin-like enzyme highly conserved regions of 5' and 3'. Total RNA was prepared from the venom glands of a D. acutus specimen collected from Guangxi province of China, RT-PCR was conducted to amplify the gene of the venom thrombin-like enzyme (TLE). A 0.8 kb DNA fragment was specifically amplified, inserted into the pMD18-T vector and transformed into Escherichia coli strain DH5alpha, then identified by PCR and sequencing. The results showed that this cDNA shared great sequence homology (98.5%) with the published snake TLE cDNA sequence, the deduced amino acid sequence of this TLE encoded by the 783 bp consisted of 260 amino acids, which included a signal peptide of 24 amino acids and a matured peptide of 236 amino acids. In conclusion, a new cDNA encoding snake TLE was obtained by amplificantion.

Agkistrodon↗
PubMed2006

The human cornea proteome: bioinformatic analyses indicate import of plasma proteins into the cornea.

Increased biochemical knowledge of normal and diseased corneas is essential for the understanding of corneal homeostasis and pathophysiology. In a recent study, we characterized the proteome of the normal human cornea and identified 141 distinct proteins. This dataset represents the most comprehensive protein study of the cornea to date and provides a useful reference for further studies of normal and diseased human corneas. The list of identified proteins is available at the Cornea Protein Database. In the present paper, we review the utilized procedures for extraction and fractionation of corneal proteins and discuss the potential roles of the identified proteins in relation to homeostasis, diseases, and wound-healing of the cornea. In addition, we compare the list of identified proteins with high quality gene expression libraries (cDNA libraries) and Serial Analysis of Gene Expression (SAGE) data. Of the 141 proteins, 86 (61%) were recognized in cDNA libraries from the corneas of dogs and rabbits, or humans with keratoconus, and 98 (69.5%) were recognized in SAGE data of mouse and human corneas. However, the percentages of identified genes in each of the protein functional groups differed markedly. Thus, exceptionally few of the traditional blood/plasma proteins and immune defense proteins that were identified in the human cornea were recognized in the gene expression libraries of the cornea. This observation strongly indicates that these abundant corneal proteins are not expressed in the cornea but originate from the surrounding pericorneal tissue.

Animals↗
PubMed2006

Modelling epidermal homeostasis as an approach for clinical bioinformatics.

Modelling in systems biology currently lacks clinical applications. As a possible approach leading to clinical relevance the modelling of tissue homeostasis is proposed. As an example a model of epidermal homeostasis is presented which reproduces central morphological and kinetic characteristics of epidermal tissue. Each individual cell is modelled as an agent. The tissue arises as an emergent phenomenon from the interactions of agents. Each agent's behaviour is qualitatively modelled by a simple differentiation state-flow program. Epithelialisation under the influence of parameters concerning stem-cell location is briefly demonstrated.

Computational Biology↗
PubMed2006

Bioinformatics and microbial biodiversity: analysis of vibrios by the GenEnv system.

Sequence-based approaches to prokaryotic systematics and typing represent a modern and promising strategy in epidemiology and environmental microbiology. GenEnv, a database-driven system for bacterial typing, was developed in order to provide user friendly tools for supporting biomolecular analysis of bacteria. The family Vibrionaceae represents a heterogeneous taxon of aquatic microrganisms, harbouring a plethora of genomes currently analyzed by different molecular techniques. Under the query "Vibrio", GenEnv retrieved 256 organisms, included in a total number of 19 families. Overall, 548 sequences, comprising 16S rRNA (n=402), rpoB (n=1), gyrB (n=145) were available. In addition, GenEnv system allowed primer design, homology analysis and restriction maps, for immediate applications to the study of Vibrionaceae.

Bacterial Typing Techniques↗
PubMed2026

Integrated bioinformatics and SEM analysis reveal GPAM as a key mediator of fibrosis in NAFLD with metabolic dysfunction.

Nonalcoholic fatty liver disease (NAFLD) is a complex condition influenced by metabolic and genetic factors, yet the shared genetic architecture underlying its progression remains poorly understood. The aim of this study was to employ genomic structural equation modeling (GSEM) to elucidate the genetic architecture linking NAFLD with key metabolic traits-including insulin resistance, body mass index (BMI), hemoglobin A1c (HbA1c), and liver fibrosis using summary statistics from large-scale genome-wide association studies. By harmonizing 2.18 million variants across five genome-wide association studies (GWAS) datasets, we identified 134 genome-wide significant loci that mapped to 24 genes. GSEM revealed a latent genetic structure composed of two distinct dimensions: a metabolic regulation factor primarily driven by insulin resistance, BMI, and HbA1c; and a structural pathology factor specifically associated with liver fibrosis. These factors explained 65.5% and 78.1% of the genetic variance in BMI and fibrosis, respectively, with minimal correlation (rg = 0:07), indicating their genetic distinctness. Additionally, integrating Mendelian randomization with liver transcriptome profiling, we characterized how the 24 genes contribute to disease and identified mitochondrial glycerol-3-phosphate acyltransferase (GPAM) as the key gene that causally links lipid metabolism to fibrogenesis. In conclusion, we present the first genetically grounded mechanism for the progression of NAFLD to fibrosis. This mechanism encompasssses genetic variants, dysregulated gene expression, metabolic disturbances, and the processes involved in fibrotic remodeling. This research establishes a genetic framework for understanding the pathogenesis of NAFLD and highlights novel therapeutic targets for intervention.

Non-alcoholic Fatty Liver Disease↗