PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “ENTEROTOXINS”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,207 records · Page 67Linked to original sources
PubMed1981

A negative serological relationship between cases of grass sickness in Scotland and Clostridium perfringens type A enterotoxin.

In an attempt to compare the equine grass sickness as reported in Europe with that described in the Republic of Colombia, sera from horses experiencing grass sickness in Scotland were used in neutralisation tests with Clostridium perfringens type A enterotoxin. The sera, from acute and chronic cases of the disease, failed to neutralise either crude or partially-purified enterotoxin. Neither were precipitin lines formed when the sera were treated against the toxin in immunoelectrophoresis. These results suggest that grass sickness in Europe and the equine disease in Colombia have a different aetiology.

Animals↗
PubMed1981

Effect of Escherichia coli heat-stable enterotoxin, cholera toxin and theophylline on ion transport in porcine colon.

1. The effect of heat-stable enterotoxin (ST) of Escherichia coli, cholera toxin (CT), and theophylline (a phosphodiesterase inhibitor) on ion and water transport was studied with an in vivo isolated loop system of the pig colon.2. All three agents abolished net Na absorption as a result of a decrease in the lumen to blood Na flux alone. With all three agents, net Cl absorption was reduced, but not abolished, and net HCO(3) secretion was elicited. Luminal p(CO2) was reduced with CT and theophylline from that observed in normal Ringer alone.3. Theophylline resulted in a prompt and sustained increase in both cyclic adenosine monophosphate (cyclic AMP) and cyclic guanosine monophosphate (cyclic GMP) levels in colonic mucosa studied in vitro. ST selectively elevated cyclic GMP, whereas CT selectively elevated cyclic AMP. These responses paralleled the time course and magnitude of response of the transepithelial electrical potential difference (psi(LB)) measured in vivo.4. Ion replacement studies in the presence or absence of theophylline showed that in the absence of Na, Cl absorption was slightly reduced and HCO(3) secretion was elicited; no further additive effects of theophylline in the absence of luminal Na were observed. In the absence of luminal Cl, net Na absorption was abolished and HCO(3) was absorbed; theophylline resulted in significant net Na and HCO(3) secretion. Theophylline also increased psi(LB) in the absence of either luminal Na or Cl.5. Results suggest that in the presence of theophylline or enterotoxin, the coupled Na-H and Cl-HCO(3) exchange processes that are normally responsible for at least half of the net NaCl absorption by this tissue are interrupted. Active HCO(3) secretion is observed and Cl absorption under these conditions can be entirely explained as a consequence of psi(LB). Thus, these studies indicate that the colon may participate in the production of diarrhoea of enterotoxigenic origin. They also suggest an important functional role of cyclic nucleotides in controlling the acidity and volume of colonic contents.

Animals↗
PubMed1990

[Detection of toxigenic Vibrio cholerae O1 using polymerase chain reaction for amplifying the cholera enterotoxin gene].

A rapid and simple procedure using polymerase chain reaction (PCR) was developed for the detection of cholera enterotoxin (CT) producing character. This method is based on amplifying a 380 base pair (bp) segment of the CT gene (ctx) which controls the production of CT. Two single-stranded oligonucleotides, synthetized to be complementary to the known nucleotide sequences of genes encoding the A-subunit of ctx, were used as extension primers. The oligonucleotide sequences are 5'TCAAACTATATTGTCTGGTC (CT-1) and 5'CGCAAGTATTACTCATCGA (CT-2). As template DNA was used 5 microliter of boiled bacterial culture broth at 95 degrees C for 5 min without the need for DNA extraction. The amplified target DNA were confirmed with only CT producing Vibrio cholerae O1 but not with CT non-producing organisms such as heat labile enterotoxin producing Escherichia coli by electrophoretic analysis of PCR mixture after amplification. A few isolates of CT producing V. mimicus and V. cholerae non-O1 were identified.

Enterotoxins↗
PubMed1990

[Development and testing of cholera enterotoxin gene probe for detection of toxigenic Vibrio cholerae O1].

A DNA probe was developed for the genetic detection from cholera enterotoxin (CT) producing Vibrio cholerae O1 and other organisms. The structural genes of CT (ctx) were cloned from chromosomal DNA of CT producing V. cholerae O1 569B. We subcloned a 552-base-pair fragment encoding a part of CT A-subunit for use of the CT-probe, and made the recombinant plasmid called pSKM24 which has eight copies of the CT-probe. The 32P-labeled CT-probe detected ctx in 72 isolates such as V. cholerae O1, V. cholerae non-O1 and other species of bacteria, but did not react heat-labile enterotoxin genes in enterotoxigenic Escherichia coli (ETEC) by DNA hybridization. The colony hybridization test using the CT-probe is specific, rapid and useful technique for detection of ctx and identification of CT producing V. cholerae.

DNA Probes↗
PubMed1996

[Characteristics of enterotoxigenic Escherichia coli and E. coli harboring enteroaggregative E. coli heat-stable enterotoxin-1 (EAST-1) gene isolated from a water-borne outbreak].

A water-borne outbreak occurred in A Town in Akita prefecture on March 1995. Enterotoxigenic Escherichia coli (ETEC) strains were isolated from 6 of 13 feces of patients with food poisoning disease and from 1 of 4 drinking water samples. In addition, E. coli strains harboring Enteroaggregative E. coli (EAggEC) heat-stable enterotoxin-1 (EAST-1) gene were isolated from 5 of 13 patient's feces and 1 feces sample obtained from the septic tank. Both of the E. coli strains were isolated from the 3 patient's feces, suggesting that this outbreak was a mixed infectious case. All of the ETEC strains possessed both heat-stable enterotoxin (ST) and EAST-1 genes and their serotype was O148:H28. The EAST-1 gene was detected on a ca. 80 kb plasmid by a southern blot analysis using EAST-1 DNA probe in the 5 of 7 ETEC strains. The southern blot analysis suggested that the location of the EAST-1 gene was genome in the rest of the 2 ETEC strains. A southern blot analysis using ST DNA probe also suggested that the location of the ST gene was genome in all of the ETEC strains. On the other hand, all of the 6 E. coli strains harboring EAST-1 gene could not be serotyped with commercially available OH sera. The location of the EAST-1 gene in all of the isolates was suggested to be genome by the southern blot analysis. All of the isolates lacked aggA gene which has been demonstrated to be involved in expression of aggregative adherence phenotype in EAggEC, suggesting that the EAST-1 gene-harboring strains isolated in this case were distinct from EAggEC. These results indicated that the EAST-1 gene was also harbored by E. coli strains distinct from EAggEC. In addition, a possibility was also suggested that the EAST-1 gene might be a transposon, as well as ST gene. Further study should be conducted in order to elucidate the significance of EAST-1 as a vilurence factor of diarrheagenic E. coli.

Bacterial Toxins↗
PubMed1977

Naturally occurring plasmid carrying genes for enterotoxin production and drug resistance.

Escherichia coli strain 86, isolated from a piglet with diarrhea, carries plasmid-linked genes for resistance to tetracycline, streptomycin, and sulfonamides and for production of heat-labile and heat-stable enterotoxin. Results of (i) genetic experiments involving conjugal transfer and phage P1-mediated transduction and (ii) physical experiments involving electron microscopic examination of plasmid DNA and heteroduplex analysis show that a single conjugative plasmid carries the genes for drug resistance and production of enterotoxin.

Conjugation, Genetic↗
PubMed1977

Activation of the nigrostriatal dopaminergic pathway by injection of cholera enterotoxin into the substantia nigra.

Twenty-four hours after unilateral injection of cholera enterotoxin into the rat substantia nigra there is an increase, in the striatum on the injected side, of basal adenylate cyclase activity, 3,4-dihydroxyphenylacetic acid, and 3-methoxy-4-hydroxyphenylacetic acid. Moreover, there is an increase of motor activity, and rats tend to circle contralateral to the side of the injection. Injection of cholera enterotoxin into brain nuclei may be a useful procedure for pharmacologically activating selected neuronal systems of brain and for studying the pharmacology of drugs that are suspected of interacting with these systems.

3,4-Dihydroxyphenylacetic Acid↗
PubMed2006

Dexamethasone attenuates staphylococcal enterotoxin B-induced hypothermic response and protects mice from superantigen-induced toxic shock.

The superantigenic staphylococcal enterotoxins are important virulence factors and contribute to various diseases, including food poisoning and toxic shock. Dexamethasone, an anti-inflammatory agent, attenuated staphylococcal enterotoxin B (SEB)-induced hypothermia and serum proinflammatory cytokines and improved survival from 0% to 86% in a lethal mouse model of SEB-mediated shock.

Animals↗
PubMed2006

Staphylococcus aureus and staphylococcal enterotoxin A in breaded chicken products: detection and behavior during the cooking process.

In this study we examined the presence of Staphylococcus aureus and staphylococcal enterotoxin A (SEA) in 20 industrial breaded chicken products obtained from different retail butchers and supermarket stores in Italy. The levels of contamination in the products analyzed were quite low, although the pH values and water activities (a(w)) in the samples considered were in ranges favorable for S. aureus growth. As demonstrated by phenotypic and molecular characterization, in spite of the high percentage of coagulase-positive Staphylococcus strains, only three strains could be referred to the species S. aureus. Moreover, all the strains were negative in PCR assays targeting staphylococcal enterotoxin genes (seA to seE, seG to seJ, and seM to seO), as well as the toxic shock syndrome toxin 1 gene, and no SEA was detected in the retail breaded chicken samples analyzed by a reversed passive latex agglutination assay or by Western blotting. Hence, we evaluated the thermal resistance of two strains of SEA-producing S. aureus in a laboratory-scale preparation of precooked breaded chicken cutlets. The heat treatment employed in the manufacture determined the inactivation of S. aureus cells, but the preformed SEA remained active during product storage at 4 degrees C. The presence of the staphylococci and, in particular, of S. aureus in the retail breaded chicken products analyzed is a potential health risk for consumers since the pH and a(w) values of these kinds of products are favorable for S. aureus growth. The thermal process used during their manufacture can limit staphylococcal contamination but cannot eliminate preformed toxins.

Animals↗
PubMed2006

Immunoquantitative real-time PCR for detection and quantification of Staphylococcus aureus enterotoxin B in foods.

A real-time immunoquantitative PCR (iqPCR) method for detection of Staphylococcus aureus enterotoxin B (SEB) was developed and evaluated using both pure cultures and foods. The assay consisted of immunocapture of SEB and real-time PCR amplification of the DNA probe linked to the detection antibody. iqPCR was compared to an in-house enzyme-linked immunosorbent assay (ELISA) using the same couple of capture-detection antibodies and to commercial kits for detection of S. aureus enterotoxins (SE). The iqPCR was approximately 1,000 times more sensitive (<10 pg ml(-1)) than the in-house ELISA and had a dynamic range of approximately 10 pg ml(-1) to approximately 30,000 pg ml(-1). iqPCR was not inhibited by any of the foods tested and was able to detect SEB present in these foods. No cross-reactivity with SE other than SEB was observed. Application of iqPCR for detection of SEB in cultures of S. aureus revealed the onset of SEB production after 4 h of incubation at 22, 37, and 42 degrees C, which was in the first half of the exponential growth phase. The total amounts of SEB produced by the two strains tested were larger at 42 degrees C than at 37 degrees C and were strain dependent.

Bacterial Toxins↗
PubMed1976

Synthesis of staphylococcal enterotoxin A and nuclease under controlled fermentor conditions.

The production of enterotoxin A and nuclease by Staphylococcus aureus strain 100 was studied in a 1.0-liter fermentor. The effects of the gas flow rate, pH, and dissolved oxygen were evaluated. Toxin and nuclease secretion occurred under all conditions which permitted growth of the organism. Final yields of toxin and nuclease in cultures grown at constant air flow rates, ranging from 50 to 500 cm3 per min, were higher at successively higher flow rates. An optimum flow rate for either toxin or nuclease production was not observed. When the aeration rate alone or aeration rate and pH were held constant, the dissolved oxygen levels in the culture decreased from the initial 100% level to 0 to 5% 3 to 4 h after inoculation. The O2 demand of the culture then maintained this level for an additional 4 to 5 h. This low dissolved oxygen interval was characterized by rapid growth and extracellular protein production. Controlling the dissolved oxygen at a constant level throughout growth did not increase the final levels of toxin and nuclease above those achieved at the respective constant pH values. Growth under the influence of a constant aeration rate of 500 cm3 per min and a constant pH of 6.5 and 7.0 yielded the highest titers of nuclease (1,550 units/ml) and toxin (10.5 mug/ml) obtained in any of the fermentations conducted in this study. Sparging fermentor cultures with pure oxygen at a rate of 100 cm3 per min yielded growth and extracellular protein levels similar to those achieved at the sparge rate of 500 cm3 of air per min. Controlling the dissolved oxygen at 100% of pure oxygen saturation appeared to inhibit the culture, as the final cultural turbidity as well as the levels of toxin and nuclease were reduced. These data indicate that enterotoxin and nuclease secretions are closely associated with the growth of strain 100. Analyses of the production rates of these components indicated that early log phase was the most efficient production interval in the growth cycle and that this efficiency was increased by pH control at 6.7 to 6.8 and dissolved oxygen control at 10% of air saturation.

Enterotoxins↗
PubMed1976

Preparation of labeled staphylococcal enterotoxin A with high specific activity.

Staphylococcal enterotoxin A (SEA) was labeled by the chloramine-T method with 125I to a specific activity of 68 to 300 muCi per mug of SEA and with 131I to specific activity of 8 to 218 muCi per mug of SEA. SEA was partially damaged and aggregated during the labeling and storage. The damage seemed not to be greatly dependent on the specific activity of labeled entertoxin. Crossed immunoelectrophoresis showed two antigenically active and three inactive components in the ascending part of the labeled enterotoxin peak during fractionation by gel chromatography. During storage at 4 degrees C, the antigenic activity of label decreased faster when labeling had been with 131I than when with 125I. The antigenic activity of labeled SEA was lowered remarkably in the ascending part of the protein peak. Greatest release of radioiodine during storage was in the same part of protein peak. According to these results, the most suitable label for radioimmunoassay is obtained from the descending part of protein peak.

Chloramines↗
PubMed1977

Effect of beef broth protein on the thermal inactivation of staphylococcal enterotoxin B1.

Enterotoxin B produced by Staphylococus aureus 243 in brain heart infusion broth was concentrated by dialysis against 40% polyethylene glycol (20 M), partially purified on a Sephadex G-100 column and heated at 110 degrees C in thermal death time cans. Various heating menstrua included 0.04 M Veronal buffer (pH 7.4), beef broth, and fractions of beef broth obtained by ultrafiltration or precipitation with ammonium sulfate. The toxin was assayed serologically using the microslide gel double-diffusion method. The time requiring for 90% inactivation at 110 degrees C (D110 value) obtained in buffer and in beef broth was 18 and 60 min, respectively. When the concentration of beef broth was increased fivefold, the D110 increased to 78 min. The apparent protective effect or protein was further investigated using beef broth protein obtained by precipitation with (NH4)2SO4. The D110 values were 51 and 70 min when the protein concentration in the heating menstruum was 3.8 and 7.7 mg/ml, respectively. However, when the beef broth protein was dialyzed against buffer before use as a heating menstrum, the D110 was only 39 or 41 min at comparable protein concentrations. Results indicated a dialyzable factor, whose protective effect was partially destroyed by trypsin and chymotrypsin but did not by disodium ethylenediaminetetraacetate, was involved in the protection of enterotoxin B during heating.

Animals↗
PubMed1977

Double-antibody solid-phase enzyme immunoassay for the detection of staphylococcal enterotoxin A.

A simple double-antibody enzyme immunoassay that uses a microtechnique was developed for detecting staphylococcal enterotoxin A in food products. Sample preparation can be completed in less than 15 min. Assay sensitivity ranges from 0.4 ng (20-h test time) to 3.2 ng (1- to 3-h test time) of toxin per ml of prepared sample. Separation and detection of enterotoxin from spiked food products ranged between 72 and 98% of the amount added.

Enterotoxins↗
PubMed1978

Minimal water activity for enterotoxin A production and growth of Staphylococcus aureus.

The minimal water activity (alphaw) for growth was correlated with enterotoxin A formation by two strains of Staphylococcus aureus in a salt mixture broth. Within 7 days at 30 degrees C both strains grew and formed enterotoxin A minimally between alphaw 0.864 and 0.867, but at 25 degrees C, the minimal alphaw for both activities was increased to between 0.870 and 0.887 after a 2-week incubation.

Culture Media↗
PubMed1980

Single radial immunodiffusion method for screening Staphylococcal isolates for enterotoxin.

A direct system for screening large numbers of staphylococcal isolates for enterotoxin production has been developed. The system employs polyvalent (serotypes A, B, C, D, and E) immunodiffusion assay slides in conjunction with a multiple-culturing system for toxin production. With the combined system, as many as 50 cultures can be screened simultaneously on a single assay slide having a sensitivity of about 0.3 microgram/ml. The system should be useful for detecting potential enterotoxin in foods containing a predominance of non-enterotoxigenic strains.

Enterotoxins↗
PubMed1982

Chromosomal mapping of a gene affecting enterotoxin A production in Staphylococcus aureus.

In a previous study, transformation demonstrated that a gene governing enterotoxin A production (entA+) in Staphylococcus aureus strain S-6 was located on the chromosome between the purB110 and ilv-129 markers; in contrast, the entA+ gene of strain FRI-196E was shown not to be located in the same position. In the current study, 54 enterotoxin A-producing strains of S. aureus were examined to locate the entA+ gene. Conventional transformation procedures and a series of multiply marked derivatives of NCTC 8325 were used as recipients for chromosomal mapping. Of the 54 strains tested, 23 were found to contain the entA+ gene at the original locus between the purB110 and ilv-129 markers. Twenty-seven strains could not be analyzed either because their DNA was genetically ineffective in transforming strain 8325 (23 strains), or Pur+ Ilv+ transformants could not be recovered (four strains). Four other strains contained an entA+ gene that could not be located in any of the chromosomal linkage groups. A new insertion site for Tn551 was located within the hla+ gene involved in alpha-toxin production. It eliminated alpha-toxin production and was used to separate the entA+ gene from the hla+ marker in the purB110-ilv-129 region. This segment of the chromosome is shown to consist of the purB110, entA+, hla+, and ilv-129 markers in that order.

Chromosome Mapping↗