PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “bacterial coding sequence”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,243 records · Page 69Linked to original sources
PubMed2006

Whole genome sequencing of a novel temperate bacteriophage of P. aeruginosa: evidence of tRNA gene mediating integration of the phage genome into the host bacterial chromosome.

Whole genome sequencing of a novel Pseudomonas aeruginosa temperate bacteriophage PaP3 has been completed. The genome contains 45 503 bp with GC content of 52.1%, without more than 100 bp sequence hitting homologue in all sequenced phage genomes. A total of 256 open reading frames (ORFs) are found in the genome, and 71 ORFs are predicated as coding sequence (CDS). All 71 CDS are divided into the two opposite direction groups, and both groups meet at the bidirectional terminator site locating the near middle of the genome. The genome is dsDNA with 5'-protruded cohesive ends and cohesive sequence is 'GCCGGCCCCTTTCCGCGTTA' (20 mer). There are four tRNA genes (tRNA(Asn), tRNA(Asp), tRNA(Tyr) and tRNA(Pro)) clustering at the 5'-terminal of the genome. Analysis of integration site of PaP3 in the host bacterial genome confirmed that the core sequence of (GGTCGTAGGTTCGAATCCTAC-21mer) locates at tRNA(Pro) gene within the attP region and at tRNA(Lys) gene in the attB region. The results indicated that 3'-end of tRNA(Pro) gene of the PaP3 genome is involved in the integration reaction and 5'-end of tRNA(Lys) gene of host bacteria genome is hot spot of the integration.

Chromosomes, Bacterial↗
PubMed1997

Molecular cloning, sequence analysis and functional characterization of the gene kdsA, encoding 3-deoxy-D-manno-2-octulosonate-8-phosphate synthase of Chlamydia psittaci 6BC.

The kdsA gene encoding 3-deoxy-D-manno-2-octulosonate-8-phosphate (Kdo-8-P) synthase of Chlamydia psittaci 6BC was cloned by complementing the temperature-sensitive kdsA mutant Salmonella enterica serovar Typhimurium AG701i50. The sequence analysis of a recombinant DNA fragment revealed an open reading frame of 807 nucleotides which codes for a polypeptide of 269 amino acids with a high degree of similarity to known KdsA proteins. In addition, alignments of Kdo-8-P synthases with bacterial and fungal 3-deoxy-D-arabino-2-heptulosonate-7-phosphate (Dha-7-P) synthases suggested that both classes of enzymes are structurally related and may belong to a family of 2-keto-3-deoxy-aldonic acid synthases. The chlamydial protein was overexpressed and functionally characterized in vitro to synthesize Kdo-8-P from D-arabinose 5-phosphate and phosphoenolpyruvate. A chlamydial DNA region upstream of the gene exhibiting similarities to the consensus sequence of sigma 70 promoters of Escherichia coli was responsible for the heterologous expression of kdsA.

Aldehyde-Lyases↗
PubMed1987

Purification of aconitase from Bacillus subtilis and correlation of its N-terminal amino acid sequence with the sequence of the citB gene.

The DNA sequence for the promoter region of the Bacillus subtilis citB gene has been determined. Presumed "-10" and "-35" regions of the promoter have been identified, and transcriptional and translational start points of citB have been located. To correlate the DNA sequence of citB with the amino acid sequence of its presumed product, aconitase, it was necessary to devise a scheme for purification of this labile enzyme. This procedure relies on the ability to restore enzyme activity at each stage of purification by incubation in a reducing buffer containing a source of ferrous ions. B. subtilis aconitase appears to be a monomer with a molecular weight of approximately 120,000. The amino-terminal amino acids of aconitase fit the sequence predicted by analysis of the citB gene. Thus, citB codes for aconitase.

Aconitate Hydratase↗
PubMed1988

The cloning, expression, and nucleotide sequence of a gene coding for an immunogenic Brucella abortus protein.

Brucella abortus is the causative agent for brucellosis in cattle and man. Development of a single diagnostic test for the differentiation of vaccinated from infected animals and the development of a nonviable 'subunit' vaccine are top priorities of the brucellosis research program in the United States. Preliminary evidence previously showed that a purified 31-kDa protein (thought to be localized at or near the bacterial cell surface) protects against experimental brucellosis in rodents. The gene for this 31-kDa protein has now been cloned in Escherichia coli. The protein is expressed well, apparently from its native promoter, when placed in several different E. coli plasmids. The nucleotide sequence of the flanking and encoding sequences has been determined, and comparison with the N-terminal amino acid (aa) sequence of the mature protein indicates the presence of a putative 28-aa signal sequence. The availability of the 31-kDa protein free of Brucella contaminants now allows rigorous study of the immunological properties of this protein.

Amino Acid Sequence↗
PubMed1992

Molecular design of a eukaryotic messenger RNA and its chemical synthesis.

A designed mRNA consisting of 42 ribonucleotides having the cap structure was synthesized. The capped leader sequence of the brome mosaic virus (BMV) mRNA 4, m7G5'pppGUAUUAAUA (F-1), was synthesized by the phosphotriester method and followed by the capping reaction. A 32-mer consisting of an initiation codon (AUG), the coding region corresponding to a bacterial pheromone cAD1 and two stop codons, was constructed by the 18-mer (F-2) and 14-mer (F-3), which were synthesized by the phosphoramidite method. 2'-,3'-O-Methoxymethylene-guanosine 5'-phosphate was condensed with F-3 using P1-2',3'-O-methoxymethyleneguanosine-5'-yl P2-adenosine-5'-yl pyrophosphate (9) with T4 RNA ligase. The chemically synthesized RNA fragments were ligated successively with T4 RNa ligase to afford the whole RNA molecule.

Amino Acid Sequence↗
PubMed1998

Structure-based assignment of the biochemical function of a hypothetical protein: a test case of structural genomics.

Many small bacterial, archaebacterial, and eukaryotic genomes have been sequenced, and the larger eukaryotic genomes are predicted to be completely sequenced within the next decade. In all genomes sequenced to date, a large portion of these organisms' predicted protein coding regions encode polypeptides of unknown biochemical, biophysical, and/or cellular functions. Three-dimensional structures of these proteins may suggest biochemical or biophysical functions. Here we report the crystal structure of one such protein, MJ0577, from a hyperthermophile, Methanococcus jannaschii, at 1.7-A resolution. The structure contains a bound ATP, suggesting MJ0577 is an ATPase or an ATP-mediated molecular switch, which we confirm by biochemical experiments. Furthermore, the structure reveals different ATP binding motifs that are shared among many homologous hypothetical proteins in this family. This result indicates that structure-based assignment of molecular function is a viable approach for the large-scale biochemical assignment of proteins and for discovering new motifs, a basic premise of structural genomics.

Adenosine Triphosphatases↗
PubMed1991

A 40-kilodalton cell wall protein-coding sequence upstream of the sr gene of Streptococcus mutans OMZ175 (serotype f).

Streptococcus mutans surface proteins may be important in immunization against dental caries. We report the existence of an open reading frame of 1,005 bp that lies 1,162 bases upstream of the S. mutans OMZ175 sr gene and that encodes a cell wall-associated protein. This open reading frame codes for 335 amino acid residues. The first 18-amino acid region is predominantly hydrophobic and resembles a signal peptide, and the hydrophobic C-terminal region may function as an anchor to the bacterial cell wall. On the basis of the predicted antigenic determinants of the deduced amino acid sequence, a 16-residue synthetic peptide corresponding to the middle hydrophilic coiled region was synthesized. Antibodies raised against this synthetic peptide reacted with a protein with an apparent Mr of 40,000 that was identified by Western immunoblotting in a cell wall extract from S. mutans OMZ175. The high reactivity in an enzyme-linked immunosorbent assay of the antibodies with whole S. mutans OMZ175 cells showed that this protein was located on the bacterial cell surface. Furthermore, the antipeptide immunoglobulin G recognized an identical determinant on the cell surface of other members of the S. mutans group. However, the function of this protein is not yet known.

Amino Acid Sequence↗
PubMedDate not supplied

Recombination property of the HIV-1 gp120 gene.

Using a chimeric primer consisting of the nucleotide sequence derived from the HIV-1 envelope gene coding for the second conserved region of gp120, and the highly conserved sequence derived from the human immunoglobulin gene coding for the VHIII domain, it has been identified in sera of AIDS patients HIV-1 field isolates carrying the complete and active Chi recombination hot spot (GCTGGTGG). The recombination between the HIV-1 gene coding for the central portion of gp120 and the bacterial gene coding for the clp protease was also demonstrated in vivo. These results point out serious concern that vectored AIDS vaccine candidates carrying the HIV-1 env gene on viral and bacterial vectors could become the source of potentially new infectious diseases rather than an effective instrument for AIDS prevention.

AIDS Vaccines↗
PubMed1996

Posttranscriptional regulation of EcoP1I and EcoP15I restriction activity.

Efficient establishment of a DNA restriction-modification (R-M) system in a non-modified cell requires a tight control of the potentially lethal activity of the restriction enzyme. The type III R-M systems EcoP1I and EcoP15I can be transferred to non-modified Escherichia coli cells by transfection, conjugation or transformation and become established without difficulty. Modification activity is expressed immediately after the R-M genes enter the cell, whereas the expression of restriction activity is delayed until complete protection of the cellular DNA is achieved by methylation. We have shown by Western blot analysis that the expression of the modification polypeptide subunit positively regulates the amount of restriction subunit present in the cell. The finding that ribosomal alterations affected the expression of restriction activity pointed to additional control at the translational level. The analysis of EcoP1I expression in E. coli strains mutated in either of the ribosomal proteins S12 (rpsL) or S4 (rpsD) suggests that the level of in vivo restriction activity can be modulated both by a decrease in the efficiency of translation and by varying ribosomal accuracy conditions. In addition, we have preliminary evidence from in vivo gene fusion studies that the res gene may code for more than one gene product.

Anti-Bacterial Agents↗
PubMed1976

Transcription of Escherichia coli ribosomal DNA in Proteus mirabilis.

Transcription of Escherichia coli ribosomal DNA introduced into Proteus mirabilis on F14 is described. We have developed an assay for E. coli coded ribosomal RNA involving fingerprinting of ribonuclease T1 digests of RNA isolated from ribosomal subunits. Sequence differences in the ribosomal RNA of the two species have allowed us to detect E. coli coded 16S, 23S, and 5S ribosomal RNA in ribosomal subunits of the E. coli-P. mirabilis hybrid. The proportion of E. coli coded rRNA in the hybrid is found at a level which is compatible with the number of E. coli (and P. mirabilis) ribosomal DNA sequences. The resulting ribosomal RNA appears in ribosomes in a form which indicates extensive compatibility of E. coli coded ribosomal RNA with P. mirabilis ribosomal proteins and maturational factors.

Base Sequence↗
PubMed1981

Antigenic variability of bacterial RNA polymerases.

Radioimmunoassay analysis of enteric and some other Gram-negative bacteria has shown that the antigenic structure of the RNA polymerase alpha subunit is more conserved than that of the beta and beta' subunits. Since anti-alpha antibodies do not affect RNA polymerase activity, the constraints which determine the low variability of the antigenic structure of the alpha subunit are not directly related to its functional role. The antigenic determinants of the alpha subunit located on the surface of the RNA polymerase molecule are more conserved than those involved in contacts with other subunits; an opposite tendency characterizes the beta subunit. The range of variability of the antigenic determinants buried inside the RNA polymerase molecule suggests that the subunits are attached to each other rather loosely. Immunological comparison of RNA polymerases provides a simple method for reconstructing bacterial genealogies. The genealogy of the bacteria examined is essentially in agreement with phylogenetic trees based on 16S and 5S rRNA sequence characterization. This argues against extensive interspecific transfer of genes coding for components of the transcription and translation apparatus.

Bacillaceae↗
PubMed1987

Cloning and expression in Escherichia coli, Bacillus subtilis, and Streptococcus sanguis of a gene for staphylokinase--a bacterial plasminogen activator.

The gene coding for the bacterial plasminogen activator staphylokinase was cloned from the Staphylococcus aureus phage 42D, a serogroup F phage used for lysotyping, onto the standard Escherichia coli plasmid vector pACYC184. The coding and flanking sequences of the sak42D gene were largely identical to those of a sak gene cloned from the serologically different S. aureus phage SøC (Sako and Tsuchida 1983). Subcloning of a 2.5 kb phage 42D DNA fragment onto plasmid pGB3631 allowed the sak42D gene to be introduced into the gram-positive hosts Bacillus subtilis and Streptococcus sanguis. The sak42D gene was expressed and secreted most efficiently by B. subtilis cells (25 micrograms/ml of culture supernatant) reduced in exoprotease production. In this host expression and secretion of Sak was initiated at the early growth phase and continued through the logarithmic phase. Formation of Sak was, however, also observed with the other cloning hosts. The Sak elaborated by the heterologous hosts was serologically identical with authentic Sak derived from S. aureus.

Amino Acid Sequence↗
PubMed1991

Sequence and expression in Escherichia coli of a Mycoplasma hominis gene encoding elongation factor Tu.

We describe the molecular cloning and the complete nucleotide (nt) sequence of a Mycoplasma hominis gene common to a broad range of Mycoplasma species, as defined by hybridization analysis with the cloned gene. Production of M. hominis protein in Escherichia coli was assayed by use of a monoclonal antibody. The nt sequence analysis revealed a 1194-bp open reading frame that could encode a 43 516-Da protein. Computer-aided sequence comparison indicated that the gene codes for elongation factor Tu.

Amino Acid Sequence↗
PubMed2004

Recombinant protein expression plasmids optimized for industrial E. coli fermentation and plant systems produce biologically active human insulin-like growth factor-1 in transgenic rice and tobacco plants.

Human insulin-like growth factor-1 (hIGF-1) is a growth factor with clinical significance in medicine. The therapeutic potential of recombinant hIGF-1 (rthIGF-1) stems from the fact that hIGF-1 resembles insulin in many aspects of physiology. The expression of hIGF-1 in transgenic tobacco and rice plants using different expression cassettes is reported here. In the present study, two coding sequences were tested, one with the original human sequence, but partially optimized for expression in E. coli and the other with a plant-codon-optimized sequence that was expected to give a higher level of expression in plant systems. Three different hIGF-1 recombinant expression constructs were generated. All expression constructs utilized the maize ubiquitin 1 promoter with or without a signal sequence. Analyses conducted using a hIGF-1 specific ELISA kit showed all transgenic plants produced hIGF-1 and the accumulated hIGF-1 increased from the E. coli codon bias to higher levels when the hIGF-1 coding sequence was codon-optimized to match that of the maize zeamatin protein--the most transcribed gene in maize endosperm suspension cells. Further analyses that compared the functionality of the bacterial signal peptide Lam B in plants showed that this leader peptide led to lower expression levels when compared to transgenic plants that did not contain this sequence. This indicated that this expression construct was functional without removal of the bacterial signal sequence. The maize ubiquitin 1 promoter was found to be more active in rice plants than tobacco plants indicating that in this case, there was a class preference that was biased towards a monocot host. Biological analyses conducted using protein extracts from transgenic plants showed that the rthIGF-1 was effective in stimulating the in vitro growth and proliferation of human SH-SY5Y neuroblastoma cells. This indicated that the plant-produced rthIGF-1 was stable and biologically active. As some plants have been reported to express an endogenous insulin-like protein, we also looked for any effect of the human growth factor in transgenic plants, but no developmental or morphological differences with wild type tobacco or rice plants were detected. Since insulin and hIGF-1 share some overlapping roles, hIGF-1 may become a substitute therapeutic agent in subjects with certain defects in their insulin receptor signaling. Hence, if the full beneficial potential of rthIGF-1 is achieved, it is expected that in the future the demand will likely increase significantly.

Bacterial Outer Membrane Proteins↗