SEARCH · PubMed Health

Results for “Biomolecular Condensates”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 127 records · Page 7Linked to original sources

PubMed2002

A new synthesis of galactose-poly(ethylene glycol)-polyethylenimine for gene delivery to hepatocytes.

A synthesis method of conjugating polyethylenimine (PEI) derivatives with terminally galactose-grafted poly(ethylene glycol) (PEG) was developed by using a bifunctional PEG derivative containing both an alpha-vinyl sulfone (VS) and an omega-N-hydroxysuccinimidyl (NHS) ester groups (VS-PEG-NHS). VS-PEG-NHS is commonly used as a crosslinker to modify proteins with ligands by first coupling amine groups to the NHS ester, followed by coupling sulfhydryl groups to the VS ester, because the reaction of VS groups with amine groups of proteins is suppressed below pH 8. However, the 1H-NMR determination of the conjugated products of branched PEI (M(w)=25 kDa) with VS-PEG-NHS at pH 6.0-8.0 indicated that the VS groups were completely bound to the amine groups of PEI as well as the NHS groups. At pH 7.0, all VS groups reacted with the primary, secondary, or tertiary amine groups of PEI in 2 h. Such different reaction behaviors would be due to a higher density of amine groups of PEI as compared with those of proteins. In contrast, the reactions with a small molecular monoamine, such as p-aminophenyl beta-D-galactopyranoside, showed that the NHS groups selectively coupled with the amine groups, and the VS groups remained completely intact. The NHS groups of VS-PEG-NHS were selectively conjugated to amine groups of p-aminophenyl beta-D-galactopyranoside (VS-PEG-Gal). Then, the VS groups of Gal-PEG unit were completely conjugated with the primary, secondary, or tertiary amine groups of PEI. Thus, the use of only two reaction steps could conveniently carry out the conjugation of terminally galactose-grafted PEG to 1 and 5 mol.% of amine functions in PEI. The gel retardation assay of the complexes between Gal-PEG-PEI and plasmid DNA indicated that these polymeric gene carriers possess the potent ability to condense plasmid DNA electrostatically as well as PEI. The transfection efficiency with 1% Gal-PEG-PEI in human hepatocyte-derived cell lines (HepG2), a model of parenchymal cells in liver (hepatocytes), was superior to that of PEI at their corresponding optimal ratios of polymer to plasmid DNA. In HepG2 cells, luciferase activity with 1% Gal-PEG-PEI at an N/P ratio of 20 was 2.1-fold greater than that of PEI at an N/P ratio of 5. In mouse fibroblasts (NIH3T3) that have no ASGP receptors, the transfection efficiency with 1% Gal-PEG-PEI drastically decreased to 1/40 of that with PEI. These data indicate that a new synthesis method can produce polyethylenimine derivatives with terminally galactose-grafted poly(ethylene glycol) for specific gene targeting to the liver.

3T3 Cells↗

PubMed2005

Reactions of indole derivatives with oxiranes and aziridines on silica. Synthesis of beta-carbolin-1-one mimic of pancratistatin.

[reaction: see text] Indole and several indoles functionalized at C-2 were condensed with oxiranes, vinyloxiranes, aziridines, and vinylaziridines in the solid state on the surface of silica. The yields of these reactions were compared to those obtained from Lewis acid-catalyzed ring-opening reactions performed in solution and found to be superior in each case. The solid-phase aziridine opening constituted a key step in the synthesis of the beta-carbolin-1-one mimic of pancratistatin. Methyl 2-indolecarboxylate was found to react on the silica gel surface with N-tosylvinylaziridine in 68% yield. A nine-step synthesis of the pancratistatin mimic has been attained. The additional key transformation in this synthesis involved silica gel-catalyzed opening of an epoxide and hydrolysis of an acetonide. Detailed experimental procedures and full characterization are reported for all new compounds.

Amaryllidaceae Alkaloids↗

PubMed2002

CLOUDS, a protocol for deriving a molecular proton density via NMR.

We demonstrate the feasibility of computing realistic spatial proton distributions for proteins in solution from experimental NMR nuclear Overhauser effect data only and with minimal assignments. The method, CLOUDS, relies on precise and abundant interproton distance restraints calculated via a relaxation matrix analysis of sets of experimental nuclear Overhauser effect spectroscopy crosspeaks. The MIDGE protocol was adapted for this purpose. A gas of unassigned, unconnected H atoms is condensed into a structured proton distribution (cloud) via a molecular dynamics simulated-annealing scheme in which the internuclear distances and van der Waals repulsive terms are the only active restraints. Proton densities are generated by combining a large number of such clouds, each computed from a different trajectory. After filtering by reference to the cloud closest to the mean, a minimal dispersion proton density (foc) is identified. The latter affords a quasi-continuous hydrogen-only probability distribution that conveys immediate information on the protein surface topology (grooves, protrusions, potential binding site cavities, etc.), directly related to the molecular structure. Feasibility of the method was tested on NMR data measured on two globular protein domains of low regular secondary structure content, the col 2 domain of human matrix metalloproteinase-2 and the kringle 2 domain of human plasminogen, of 60 and 83 amino acid residues, respectively.

Humans↗

PubMed2002

Synthesis of mycothiol, 1D-1-O-(2-[N-acetyl-L-cysteinyl]amino-2-deoxy-alpha-D-glucopyranosyl)-myo-inositol, principal low molecular mass thiol in the actinomycetes.

Members of the actinomycetes produce 1D-1-O-(2-[N-acetyl-L-cysteinyl]amino-2-deoxy-alpha-D-glucopyranosyl)-myo-inositol or mycothiol 1 as principal low molecular mass thiol. Chemical synthesis of a biosynthetic precursor of mycothiol, the pseudodisaccharide 1D-1-O-(2-amino-2-deoxy-alpha-D-glucopyranosyl)-myo-inositol 13 was achieved by the following steps: (1) Enantioselective synthesis gave the glycosyl acceptors (-)-2,3,4,5,6-penta-O-acetyl-D-myo-inositol D-7 and the corresponding L-isomer L-7. (2) Condensation of D-7 and L-7 with the glycosyl donor 3,4,6-tri-O-acetyl-2-deoxy-2-(2,4-dinitrophenylamino)-alpha-D-glucopyranosylbromide afforded the corresponding alpha and beta anomeric products, which could be resolved by silica gel chromatography. (3) Deprotection of these by hydrolysis using an anion exchange resin gave 1D- and 1L-1-O-(2-amino-2-deoxy-alpha-D-glucopyranosyl)-myo-inositol 13 and 15 and the corresponding beta-coupled anomers 14 and 16. Only 13, and to a much lesser extent 15, were used by enzymes present in an ammonium sulphate fraction of a cellfree extract of Mycobacterium smegmatis for the enzymatic synthesis of mycothiol. In the absence of acetyl-SCoA, the immediate biosynthetic precursor of 1, desacetylmycothiol, was the major product.

Actinomycetales↗

PubMed2003

Model studies on the modification of proteins by lipoxidation-derived 2-hydroxyaldehydes.

2-hydroxyaldehydes have been previously identified as products of lipid peroxidation, and although they represent the simplest reducing sugars, their potential for modification of proteins under physiological conditions has not been investigated. Here, 2-hydroxyaldehydes were found to condense with amines in two ways, implicating potential pathways for modification of lysine residues. A fluorescent 4,5-dialkyl-3-hydroxypyridinium with ex/em 327/390 nm and a nonfluorescent 4-alkylimidazolium cross-linking product were isolated and characterized by (1)H NMR, (13)C NMR, high-resolution mass spectrometry, and, in the former case, through independent synthesis. Both reactions appear to proceed through Amadori rearrangement of the initial Schiff base. On the basis of the UV absorbance of the 3-hydroxypyridinium, the latter was estimated to represent modification of 1.5% of the lysines of RNase incubated with 0.5 mM 2-hydroxyheptanal for 10 days at 25 degrees C. The 4-alkylimidazolium is proposed to contribute to the protein cross-linking observed by gel electrophoresis in the incubation of RNase with higher concentrations of 2-hydroxyheptanal.

Aldehydes↗

PubMed2005

Total synthesis of (-)-7-epicylindrospermopsin, a toxic metabolite of the freshwater cyanobacterium aphanizomenonovalisporum, and assignment of its absolute configuration.

[reaction: see text] The Z and E nitrones 38 and 39 from condensation of aldehyde 20 with hydroxylamine 36 underwent intramolecular dipolar cycloaddition to give the substituted 1-aza-7-oxobicyclo[2.2.1] heptanes 40 and 41 in a ratio of 2:1, respectively. Reductive N-O bond cleavage of 40 followed by carbonylation gave cyclic urea 47 in which inversion of the secondary alcohol was effected via an oxidation-reduction sequence. After conversion of the p-bromobenzyl ether 50 to azide 54, activation of the cyclic urea as its O-methylisourea and reduction of the azide led to spontaneous cyclization to afford the tricyclic nucleus 59 of cylindrospermopsin. Global deprotection, including hydrolysis of the 2,4-dimethyoxypyrimidine appendage to a uracil, and then monosulfation of the resultant diol 60 afforded a substance identical with natural (-)-7-epicylindrospermopsin (1). The asymmetric synthesis of (-)-7-epicylindrospermopsin defines its absolute configuration as 7S,8R,10S,12S,13R,14S.

Alkaloids↗

PubMed1997

[Synthesis of hetero-condensed quinazolones: 1,2,4-triazino[6,1-b]- and 1,2,5-triazino[2,3-b]quinazolones].

In the course of the systematic investigation of heterocondensed quinazolones derivatives of a new heterocyclic ring system, [1,2,5]triazepino[2,3-b]quinazolone have been developed as potential biologically active agents, which are new bioisoteric analogues of cholecystokinin antagonist diazepino[2,1-b]quinazolones. The authors worked out an original synthetic route for preparation of ring analogue [1,2,4]triazino[6,1-b]quinazolines from intermediates of the synthesis, too. Starting 2-alkyl-3-amino-quinazolones are easily prepared by reaction of 2-alkyl-benzoxazone with hydrazine hydrate. In the next step bromination reaction of the alpha-methylene group of 2-alkyl-substituents gave a mono-bromo derivative as major product. In the reaction of the bromo compound with N-nucleophyles 2-alkylamino-3-amino-quinazolones were obtained which reacted with alpha-halogeno-carbonyl compounds and led to the tricyclic quinazolones in ring closure reaction. The structural properties of the heterocyclic compounds were characterized by UV-VIS and NMR data and molecular modelling calculation.

Azepines↗

PubMed2002

Biosynthesis of nodulisporic acid A: precursor studies.

Nodulisporic acid A (NAA) is an indole-diterpene natural product produced by an indeterminate species of the endophytic fungus Nodulisporium. NAA (Figure 1) is structurally related to the paspaline class of fungal metabolites. The biosynthetic origin proposed for these alkaloids involves the acetate/mevalonic acid pathway leading to geranylgeranyl pyrophosphate (GGPP). GGPP is then proposed to condense with tryptophan to form the basic indole-diterpene core. A washed cell procedure was devised to incorporate labeled precursors into NAA by a mutant Nodulisporium culture designated MF6244. Incorporation of 2-(13)C-acetate and 2-(13)C-mevalonolactone into NAA was found to occur in the classical mevalonic acid pattern. In addition to the four mevalonic acid units that form the eastern side of the molecule, three additional isoprenylations occur to form the western and southern regions of NAA. Contrary to published reports on related compounds, incubations of Nodulisporium MF6244 with (14)C- and (13)C-tryptophan showed no incorporation of label into NAA. However, high levels of incorporation into NAA were obtained with known tryptophan precursors (14)C-, (13)C-, and (15)N-anthranilic acid and (14)C- and (13)C-ribose. A novel pathway for the biosynthesis of NAA is presented.

Acetates↗

PubMed2006

Type III polyketide synthase beta-ketoacyl-ACP starter unit and ethylmalonyl-CoA extender unit selectivity discovered by Streptomyces coelicolor genome mining.

Polyketide synthases (PKSs) are involved in the biosynthesis of many important natural products. In bacteria, type III PKSs typically catalyze iterative decarboxylation and condensation reactions of malonyl-CoA building blocks in the biosynthesis of polyhydroxyaromatic products. Here it is shown that Gcs, a type III PKS encoded by the sco7221 ORF of the bacterium Streptomyces coelicolor, is required for biosynthesis of the germicidin family of 3,6-dialkyl-4-hydroxypyran-2-one natural products. Evidence consistent with Gcs-catalyzed elongation of specific beta-ketoacyl-ACP products of the fatty acid synthase FabH with ethyl- or methylmalonyl-CoA in the biosynthesis of germicidins is presented. Selectivity for beta-ketoacyl-ACP starter units and ethylmalonyl-CoA as an extender unit is unprecedented for type III PKSs, suggesting these enzymes may be capable of utilizing a far wider range of starter and extender units for natural product assembly than believed until now.

3-Oxoacyl-(Acyl-Carrier-Protein) Synthase↗

PubMed2001

Two new elastin cross-links having pyridine skeleton. Implication of ammonia in elastin cross-linking in vivo.

Isolation and structure analysis of two amino acids from bovine ligamentum nuchae elastin hydrolysates revealed the presence of pyridine cross-links in elastin. The structures of these amino acids were determined to have 3,4,5- and 2,3,5-trisubstituted pyridine skeletons both with three carboxylic acids and a mass of 396 (C(18)H(28)N(4)0(6)) identified as 4-(4-amino-4-carboxybutyl)-3,5-di-(3-amino-3-carboxypropyl)-pyridine and 2-(4-amino-4-carboxybutyl)-3,5-di-(3-amino-3-carboxypropyl)-pyridine. We have named these pyridine cross-links desmopyridine (DESP) and isodesmopyridine (IDP), respectively. Structure analysis of these pyridine cross-links implied that the formation of these cross-links involved the condensation reaction between ammonia and allysine. The elastin incubated with ammonium chloride showed that DESP and IDP levels increased as the allysine content decreased. DESP and IDP were measured by high pressure liquid chromatography (HPLC) with UV detection and were found in a variety of bovine tissues. The DESP/desmosine (DES) and IDP/isodesmosine (IDE) ratios in aorta elastin were higher than in other tissues. DESP and IDP contents in human aorta elastin were found to be gradually increased with age. The concentration of IDP was significantly elevated in aorta elastin of rat with chronic liver cirrhosis induced by carbon tetrachloride (mean +/- S.D.; 11.1 +/- 0.9 nmol/mg elastin) when compared with normal rats (5.9 +/- 1.5 nmol/mg elastin). Although DESP and IDP are present at only trace concentrations in the tissue elastin, these pyridine cross-links may be useful biomarkers for the aortic elastin damaged by ammonia.

2-Aminoadipic Acid↗

PubMed2004

Facile synthesis of chlorophyll analog possessing a disulfide bond and formation of self-assembled monolayer on gold surface.

A chlorophyll analog forming self-assembled monolayers (SAMs) on a gold surface was synthesized for the first time. 13(2)-(Demethoxycarbonyl)pheophorbide-a, which was converted from naturally occurring chlorophyll-a, was condensed with 2-hydroxyethyl disulfide to give a chlorin dyad linked by a disulfide bond. The chlorin analog was spontaneously immobilized on a gold substrate by soaking in an acetone solution of the dyad for 24 h. The resulting gold plate exhibited a visible absorption spectrum with about 420- and 675-nm maxima as the Soret and Qy peaks, respectively, indicating that chlorin pi-conjugates were modified on the gold substrate through Au-S bonding. Both visible absorption and fluorescence emission bands of the chlorin chromophores on the gold substrate were red-shifted compared with those of the synthesized chlorin dyad in a homogeneous acetone solution. The measured absorbance at the Soret maximum suggests that the chlorin chromophores on the gold plate were densely packed on a gold surface to form a SAM. Cathodic photocurrents were generated from SAMs of the chlorins on a gold substrate with irradiation of visible-lights above 400 nm. Photoinduced electron transfer from chlorins on the gold substrate to oxygen molecules in an electrolyte solution were attributed to the cathodic photocurrent generation.

Chlorophyll↗

PubMed1998

Biosynthesis of Di-myo-inositol-1,1'-phosphate, a novel osmolyte in hyperthermophilic archaea.

Biosynthesis of di-myo-inositol-1,1'-phosphate (DIP) is proposed to occur with myo-inositol and myo-inositol 1-phosphate (I-1-P) used as precursors. Activation of the I-1-P with CTP and condensation of the resultant CDP-inositol (CDP-I) with myo-inositol then generates DIP. The sole known biosynthetic pathway of inositol in all organisms is the conversion of D-glucose-6-phosphate to myo-inositol. This conversion requires two key enzymes: L-I-1-P synthase and I-1-P phosphatase. Enzymatic assays using 31P nuclear magnetic resonance spectroscopy as well as a colorimetric assay for inorganic phosphate have confirmed the occurrence of L-I-1-P synthase and a moderately specific I-1-P phosphatase. The enzymatic reaction that couples CDP-I with myo-inositol to generate DIP has also been detected in Methanococcus igneus. 13C labeling studies with [2,3-13C]pyruvate and [3-13C]pyruvate were used to examine this pathway in M. igneus. Label distribution in DIP was consistent with inositol units formed from glucose-6-phosphate, but the label in the glucose moiety was scrambled via transketolase and transaldolase activities of the pentose phosphate pathway.

Cell-Free System↗

PubMed2001

Contribution of the anomeric effect to the solution and crystal structure of [1S,2S,6S,7s]-1,6-diaza-4,9-dioxa-2,7-dimethoxycarbonylbicyclo[4.4.1]undecane, a condensation product of L-serine methyl ester with formaldehyde.

The reaction of L-serine methyl ester hydrochloride (1) with paraformaldehyde (2) in dichloromethane in the presence of triethylamine afforded a novel compound: [lS,2S,6S,7S]-1,6-diaza-4,9-dioxa-2,7-dimethoxycarbonylbicyclo[4.4.1]undecane (4) as a 2:3 adduct of 1 with 2. 1H and 13C NMR spectroscopy were unable to discriminate between two possible symmetrical structures. The latter was unambiguously proved by X-ray crystallography. The crystal structure established: (i) the existence of two identical seven-membered rings each containing a N-C-O grouping; (ii) the existence of a long C-O-C-N-C-N-C-O-C sequence in which each nitrogen belongs simultaneously to a N-C-O (oxazolidine) and to a N-C-N (aminal) motifs; (iii) the existence of a chair-like conformation for both seven-membered rings; (iv) the antiperiplanar geometry of pN-C-O and consequently the manifestation of a strong anomeric effect in both N-C-O groupings, whereas anomeric effect was virtually absent in the N-C-N sequence, as corroborated by bond distances and bond angles. Chemical shifts, coupling constants and NOE effects confirm that the conformational features of 4 are preserved in solution.

Bridged Bicyclo Compounds, Heterocyclic↗

PubMed2001

Acid/azole complexes as highly effective promoters in the synthesis of DNA and RNA oligomers via the phosphoramidite method.

The utility of various kinds of acid salts of azole derivatives as promoters for the condensation of a nucleoside phosphoramidite and a nucleoside is investigated. Among the salts, N-(phenyl)imidazolium triflate, N-(p-acetylphenyl)imidazolium triflate, N-(methyl)benzimidazolium triflate, benzimidazolium triflate, and N-(phenyl)imidazolium perchlorate have shown extremely high reactivity in a liquid phase. These reagents serve as powerful activators of deoxyribonucleoside 3'-(allyl N,N-diisopropylphosphoramidite)s or 3'-(2-cyanoethyl N,N-diisopropylphosphoramidite)s employed in the preparation of deoxyribonucleotides, and 3'-O-(tert-butyldimethylsilyl)ribonucleoside 2'-(N,N-diisopropylphosphoramidite)s or 2'-O-(tert-butyldimethylsilyl)ribonucleoside 3'-(N,N-diisopropylphosphoramidite)s used for the formation of 2'-5' and 3'-5' internucleotide linkages between ribonucleosides, respectively. The azolium salt has allowed smooth and high-yield condensation of the nucleoside phosphoramidite and a 5'-O-free nucleoside, in which equimolar amounts of the reactants and the promoter are employed in the presence of powdery molecular sieves 3A in acetonitrile. It has been shown that some azolium salts serve as excellent promoters in the solid-phase synthesis of oligodeoxyribonucleotides and oligoribonucleotides. For example, benzimidazolium triflate and N-(phenyl)imidazolium triflate can be used as effective promoters in the synthesis of an oligodeoxyribonucleotide, (5')CGACACCCAATTCTGAAAAT(3') (20mer), via a method using O-allyl/N-allyloxycarbonyl-protected deoxyribonucleoside 3'-phosphoramidites or O-(2-cyanoethyl)/N-phenoxyacetyl-protected deoxyribonucleotide 3'-phosphoramidite as building blocks, respectively, on high-cross-linked polystyrene resins. Further, N-(phenyl)imidazolium triflate is useful for the solid-phase synthesis of oligoribonucleotides, such as (5')AGCUACGUGACUACUACUUU(3') (20mer), according to an allyl/allyloxycarbonyl-protected strategy. The utility of the azolium promoter has been also demonstrated in the liquid-phase synthesis of some biologically important substances, such as cytidine-5'-monophosphono-N-acetylneuraminic acid (CMP-Neu5Ac) and adenylyl(2'-5')adenylyl(2'-5')adenosine (2-5A core).

DNA↗

PubMed2000

Oligomerization of the chromatin-structuring protein H-NS.

H-NS is a major component of the bacterial nucleoid, involved in condensing and packaging DNA and modulating gene expression. The mechanism by which this is achieved remains unclear. Genetic data show that the biological properties of H-NS are influenced by its oligomerization properties. We have applied a variety of biophysical techniques to study the structural basis of oligomerization of the H-NS protein from Salmonella typhimurium. The N-terminal 89 amino acids are responsible for oligomerization. The first 64 residues form a trimer dominated by an alpha-helix, likely to be in coiled-coil conformation. Extending this polypeptide to 89 amino acids generated higher order, heterodisperse oligomers. Similarly, in the full-length protein no single, defined oligomeric state is adopted. The C-terminal 48 residues do not participate in oligomerization and form a monomeric, DNA-binding domain. These N- and C-terminal domains are joined via a flexible linker which enables them to function independently within the context of the full-length protein. This novel mode of oligomerization may account for the unusual binding properties of H-NS.

Amino Acid Sequence↗

PubMed1999

Folding of pyrimidine-enriched RNA fragments from the vicinity of the internal ribosomal entry site of hepatitis A virus.

Two RNA fragments from the region just upstream of the internal ribosome entry site of Hepatitis A virus (HAV) were studied, a 35mer (HAV-35), 5'U4C3U3C3U4C3U3C2UAU2C3U33(4), and a 23mer (HAV-23), 5(4)U4C3U3C3U4C3U33(4). Secondary structural predictions and nuclease digestion patterns obtained with genomic RNAs suggested that they link two stable Watson-Crick (WC) hairpins in the genomic RNA and do not form conventional WC secondary structure, but do fold to form a condensed, stacked 'domain'. To obtain more information, folding of HAV-23 and -35 RNA fragments was characterized using 1H nuclear magnetic resonance, in H2O as a function of pH and temperature, circular dichroism as a function of NaCl concentration, pH and temperature, and square-wave voltammetry as a function of pH. The results indicate that these oligo-nucleotides form intramolecular structures that contain transient U*U base pairs at pH 7 and moderate ionic strength (100 mM NaCl). This folded structure becomes destabilized and loses the U*U base pairs above and below neutral pH, especially at ionic strengths above 0.1. All of the cytidine protons exchange relatively rapidly with solvent protons (exchange lifetimes shorter than 1 ms), so the structure contains few if any C*CH+base pairs at neutral pH, but can apparently form them at pH values below 6. We present a series of possible models in which chain folding draws the strand termini closer together, possibly serving to pull the attached WC hairpin domains together and providing a functional advantage by nucleating reversible formation of a more viable RNA substrate.

Base Pairing↗

PubMed2006

Mode of action and subsite studies of the guluronan block-forming mannuronan C-5 epimerases AlgE1 and AlgE6.

AlgE1, AlgE5 and AlgE6 are members of a family of mannuronan C-5 epimerases encoded by the bacterium Azotobacter vinelandii, and are active in the biosynthesis of alginate, where they catalyse the post-polymerization conversion of beta-D-mannuronic acid (M) residues into alpha-L-guluronic acid residues (G). All enzymes show preference for introducing G-residues neighbouring a pre-existing G. They also have the capacity to convert single M residues flanked by G, thus 'condensing' G-blocks to form almost homopolymeric guluronan. Analysis of the length and distribution of G-blocks based on specific enzyme degradation combined with size-exclusion chromatography, electrospray ionization MS, HPAEC-PAD (high-performance anion-exchange chromatography and pulsed amperometric detection), MALDI (matrix-assisted laser-desorption ionization)-MS and NMR revealed large differences in block length and distribution generated by AlgE1 and AlgE6, probably reflecting their different degree of processivity. When acting on polyMG as substrates, AlgE1 initially forms only long homopolymeric G-blocks >50, while AlgE6 gives shorter blocks with a broader block size distribution. Analyses of the AlgE1 and AlgE6 subsite specificities by the same methodology showed that a mannuronan octamer and heptamer respectively were the minimum substrate chain lengths needed to accommodate enzyme activities. The fourth M residue from the non-reducing end is epimerized first by both enzymes. When acting on MG-oligomers, AlgE1 needed a decamer while AlgE6 an octamer to accommodate activity. By performing FIA (flow injection analysis)-MS on the lyase digests of epimerized and standard MG-oligomers, the M residue in position 5 from the non-reducing end was preferentially attacked by both enzymes, creating an MGMGGG-sequence (underlined and boldface indicate the epimerized residue).

Azotobacter vinelandii↗

PubMed1997

Synthesis of 4-cyanophenyl 1,5-dithio-beta-D-glucopyranoside and its 6-deoxy, as well as 6-deoxy-5-ene derivatives as oral antithrombotic agents.

Condensation of 5-thio-D-glucopyranose pentaacetate with 4-cyanobenzenethiol, in the presence of trimethylsilyl triflate, gave 4-cyanophenyl 2,3,4,6-tetra-O-acetyl-1,5-dithio-alpha-D-glucopyranoside 7 and 3,4,6-tri-O-acetyl-2,5-anhydro-5-thio-D-mannose bis(4-cyanophenyl) dithioacetal 9 in a 2:3 ratio. The latter is probably formed from the 4-cyanophenyl 2,3,4,6-tetra-O-acetyl-1,5-dithio-beta-D-glucopyranoside 6 via a transannular participation of the ring sulfur atom. When 2,3,4,6-tetra-O-acetyl-5-thio-alpha-D-glucopyranosyl bromide was used as donor and the reaction was carried out in the presence of potassium carbonate, 6, 7, 4-cyano-2-(2,3,4,6-tetra-O-acetyl-5-thio-alpha-D-glucopyranosyl)phenyl and 4-cyano-2-(2,3,4,6-tetra-O-acetyl-5-thio-beta-D-glucopyranosyl)phenyl 1,5-dithio-beta-D-glucopyranoside (14 and 16) were formed in a 23:4:2:1 ratio. The mechanism of formation of 14 and 16 is discussed. Condensation of 2,3,4,-tri-O-acetyl-6-deoxy-5-thio-alpha-D-glucopyranosyl bromide with 4-cyanobenzenethiol in the presence of potassium carbonate gave 4-cyanophenyl 2,3,4-tri-acetyl-6-deoxy-1,5-dithio-alpha- and beta-D-glucopyranoside (29 and 30) as well as 4-cyano-2-(2,3,4-tri-O-acetyl-6-deoxy-5-thio-alpha-D-glucopyranosyl)phen yl 2,3,4-tri-O-acetyl-6-deoxy-1,5-dithio-beta-D-glucopyranoside in a ratio of approximately 1:8:1. Compound 30 could be obtained in a higher overall yield using 2 as starting material and converting it via its 4-cyanophenyl 2,3,4-tri-O-acetyl-6-O-methanesulfonyl-1,5-dithio-beta-D-glucopyranoside derivative into the 4-cyanophenyl 2,3,4-tri-O-acetyl-6-deoxy-6-iodo-1,5-dithio-beta-D-glucopyranoside 33 which gave 30 on reduction with sodium borohydride-nickel(II) chloride. Treatment of 33 with silver acetate gave 4-cyanophenyl 2,3,4-tri-O-acetyl-6-deoxy-1,5-dithio-beta-D-xylo-hex-5-enopyranoside 35. The compounds obtained on deacetylation of 6, 9, 14, 30 and 35 showed a stronger oral antithrombotic effect in rats as compared to beciparcil, used as reference.

Administration, Oral↗