SEARCH · PubMed Health

Results for “duplex sequencing”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,297 records · Page 72Linked to original sources

PubMed2005

Preferential binding and structural distortion by Fe2+ at RGGG-containing DNA sequences correlates with enhanced oxidative cleavage at such sequences.

Certain DNA sequences are known to be unusually sensitive to nicking via the Fe2+-mediated Fenton reaction. Most notable are a purine nucleotide followed by three or more G residues, RGGG, and purine nucleotides flanking a TG combination, RTGR. Our laboratory previously demonstrated that nicking in the RGGG sequences occurs preferentially 5' to a G residue with the nicking probability decreasing from the 5' to 3'end of these sequences. Using 1H NMR to characterize Fe2+ binding within the duplex CGAGTTAGGGTAGC/GCTACCCTAACTCG and 7-deazaguanine-containing (Z) variants of it, we show that Fe2+ binds preferentially at the GGG sequence, most strongly towards its 5' end. Substitutions of individual guanines with Z indicate that the high affinity Fe2+ binding at AGGG involves two adjacent guanine N7 moieties. Binding is accompanied by large changes in specific imino, aromatic and methyl proton chemical shifts, indicating that a locally distorted structure forms at the binding site that affects the conformation of the two base pairs 3' to the GGG sequence. The binding of Fe2+ to RGGG contrasts with that previously observed for the RTGR sequence, which binds Fe2+ with negligible structural rearrangements.

Base Sequence↗

PubMed2005

Multiplex amplification enabled by selective circularization of large sets of genomic DNA fragments.

We present a method to specifically select large sets of DNA sequences for parallel amplification by PCR using target-specific oligonucleotide constructs, so-called selectors. The selectors are oligonucleotide duplexes with single-stranded target-complementary end-sequences that are linked by a general sequence motif. In the selection process, a pool of selectors is combined with denatured restriction digested DNA. Each selector hybridizes to its respective target, forming individual circular complexes that are covalently closed by enzymatic ligation. Non-circularized fragments are removed by exonucleolysis, enriching for the selected fragments. The general sequence that is introduced into the circularized fragments allows them to be amplified in parallel using a universal primer pair. The procedure avoids amplification artifacts associated with conventional multiplex PCR where two primers are used for each target, thereby reducing the number of amplification reactions needed for investigating large sets of DNA sequences. We demonstrate the specificity, reproducibility and flexibility of this process by performing a 96-plex amplification of an arbitrary set of specific DNA sequences, followed by hybridization to a cDNA microarray. Eighty-nine percent of the selectors generated PCR products that hybridized to the expected positions on the array, while little or no amplification artifacts were observed.

Base Sequence↗

PubMedDate not supplied

Multistep fluorescence resonance energy transfer in sequential chromophore array constructed on oligo-DNA assemblies.

Sequential arrays of chromophores at regulated distances were constructed on a noncovalent DNA molecular assembly system in aqueous media. Photoinduced fluorescence resonance energy transfer (FRET) behaviors were then observed. We designed a number of chromophore/oligo-DNA conjugates with varying sequences. The chromophores eosin (Eo), TexasRed (TR), and tetramethylrhodamine (Rho) were employed as the energy donor, acceptor, and mediator, respectively, based on overlapping excitation and emission spectra. The chromophores were attached via aminolinkers to the 5'-terminals of 10mer oligo-DNAs consisting of AT rich sequences. The arrangement of Eo-Rho or Rho-TR with 10-residue (1 pitch of duplex) distances was ensured by duplex formation of the conjugates with a 20mer matrix oligo-DNA composed of complementary sequences to the conjugates. Single-step FRET from Eo to Rho and from Rho to TR was confirmed on the duplex. The three chromophore conjugates were then mixed with longer matrix oligo-DNAs (30 or 40mer) consisting of complementary sequences to the conjugates, producing Eo-(Rho)(n)-TR (n = 1 or 2) arrays with 10-residue distances. Multistep FRET from Eo to TR through the Rho mediator(s) was observed on the molecular assemblies. This photoenergy transmission system offers a good model for a photoenergy transmission system mimicking photosynthetic systems.

Base Sequence↗

PubMed1994

Enhanced DNA sequencing by hybridization.

An enhanced version of DNA sequencing by hybridization (SBH), termed positional SBH (PSBH), has been developed. PSBH uses duplex probes containing single-stranded 3' overhangs, instead of simple single-stranded probes. Stacking interactions between the duplex probe and a single-stranded target should provide enhanced stringency in distinguishing perfectly matched 3' sequences. A second enhancement is the use of enzyme-catalyzed steps, instead of pure physical hybridization. The feasibility of this scheme has been investigated using biotinylated duplex probes containing single-stranded 5-base 3' overhangs, immobilized on streptavidin-coated magnetic beads. Ligation of a single-stranded target, hybridized to the single-stranded region of the duplex probes, provided enhanced discrimination of perfectly matched targets from those containing mismatches. In distinction to the serious complications caused by base composition effects in ordinary SBH, there was little effect of base composition in PSBH. The hardest mismatch to discriminate was the one furthest from the phosphodiester bond formed by ligation. However, mismatches in this position were efficiently discriminated by 3' extension of the duplex probe using a template-dependent DNA polymerase. These results demonstrate that PSBH offers considerable promise to facilitate actual implementations of SBH.

Base Sequence↗

PubMed2006

Gene silencing with siRNA duplexes composed of target-mRNA-complementary and partially palindromic or partially complementary single-stranded siRNAs.

Synthetic small interfering RNA (siRNA) duplexes are widely used to transiently and sequence-specifically disrupt gene expression in mammalian cultured cells. The efficiency and specificity of mRNA cleavage is partly affected by the presence of the nontargeting "passenger" or "sense" siRNA strand, which is required for presentation of the target-complementary or guide siRNA strand to the double-strand-specific RNA silencing protein machinery. We show that siRNA duplexes can be designed that are solely composed of two fully target-complementary guide strands that are sufficiently complementary to each other to form stable duplexes with characteristic 3' overhanging ends. The general feasibility of this approach is documented by transient knockdown of lamin A/C and emerin in HeLa cells. The silencing efficiencies of guide-only siRNA duplexes are comparable to prototypical fully paired passenger/guide duplex siRNAs, even though guide-only siRNA duplexes may contain a significant number of nonWatson-Crick and G/U wobble base pairs. Such siRNA duplexes may offer advantages regarding production costs and specificity of gene silencing.

Base Sequence↗

PubMed1990

The influence of oligonucleotide-effector on the selectivity of sequence specific modification of 16 S rRNA.

The influence of duplex stabilizing oligonucleotide-effector (oligonucleotide, carrying N-(2-hydroxyethyl)phenazinium residues on both ends), on selectivity of site-directed modification of E. coli 16 S rRNA (1542 nucleotides in length) under the conditions of its secondary structure stability was studied. The constant of cooperative binding of the reagent and the oligonucleotide-effector with 16 S rRNA was determined. The accuracy of modification was shown to double in the presence of 50 microM effector at 5 microM concentration of the reagent.

Alkylating Agents↗

PubMed1998

Joint molecular modeling and spectroscopic studies of DNA complexes of a bis(arginyl) conjugate of a tricationic porphyrin designed to target the major groove.

To target selectively the major groove of double-stranded B DNA, we have designed and synthesized a bis(arginyl) conjugate of a tricationic porphyrin (BAP). Its binding energies with a series of double-stranded dodecanucleotides, having in common a central d(CpG)2 intercalation site were compared. The theoretical results indicated a significant energy preference favoring major groove over minor groove binding and a preferential binding to a sequence encompassing the palindrome GGCGCC encountered in the Primary Binding Site of the HIV-1 retrovirus. Spectroscopic studies were carried out on the complexes of BAP with poly(dG-dC) and poly(dA-dT) and a series of oligonucleotide duplexes having either a GGCGCC, CCCGGG, or TACGTA sequence. The results of UV-visible and circular dichroism spectroscopies indicated that intercalation of the porphyrin takes place in poly(dG-dC) and all the oligonucleotides. Thermal denaturation studies showed that BAP increased significantly the melting temperature of the oligonucleotides having the GGCGCC sequence, whereas it produced only a negligible stabilization of sequences having CCCGGG or TACGTA in place of GGCGCC. This indicates a preferential binding of BAP to GGCGCC, fully consistent with the theoretical predictions. IR spectroscopy on d(GGCGCC)2 indicated that the guanine absorption bands, C6=O6 and N7-C8-H, were shifted by the binding of BAP, indicative of the interactions of the arginine arms in the major groove. Thus, the de novo designed compound BAP constitutes one of the very rare intercalators which, similar to the antitumor drugs mitoxantrone and ditercalinium, binds DNA in the major groove rather than in the minor groove.

Arginine↗

PubMed1998

Sequence-specific ligation of DNA using RecA protein.

A method is described that allows the sequence-specific ligation of DNA. The method is based on the ability of RecA protein from Escherichia coli to selectively pair oligonucleotides to their homologous sequences at the ends of fragments of duplex DNA. These three-stranded complexes were protected from the action of DNA polymerase. When treated with DNA polymerase, unprotected duplex fragments were converted to fragments with blunt ends, whereas protected fragments retained their cohesive ends. By using conditions that greatly favored ligation of cohesive ends, a second DNA fragment could be selectively ligated to a previously protected fragment of DNA. When this second DNA was a vector, selected fragments were preferentially cloned. The method had sufficient power to be used for the isolation of single-copy genes directly from yeast or human genomic DNA, and potentially could allow the isolation of much longer fragments with greater fidelity than obtainable by using PCR.

Bacteriophage lambda↗

PubMed2006

Inert benzothiazole functionalised ruthenium(II) complexes; potential DNA hairpin binding agents.

The two enantiomers of [Ru(bpy)2(bbtb)]2+{bpy = 2,2'-bipyridine; bbtb = 4,4'-bis(benzothiazol-2-yl)-2,2'-bipyridine} have been isolated and fully characterised. Both enantiomers have been shown to have a strong association with calf thymus DNA by UV/visible absorption, emission and CD spectroscopy, with the Lambda enantiomer having the greater affinity. The binding of both enantiomeric forms of [Ru(bpy)2(Me2bpy)]2+ and [Ru(bpy)2(bbtb)]2+{Me(2)bpy = 4,4'-dimethyl-2,2'-bipyridine} to a range of oligonucleotides, including an octadecanucleotide and an icosanucleotide which contain hairpin-sequences, have been studied using a fluorescent intercalator displacement (FID) assay. The complex [Ru(bpy)2(bbtb)]2+ exhibited an interesting association with hairpin oligonucleotides, again with the Lambda enantiomer binding more strongly. A (1)H NMR spectroscopic study of the binding of both enantiomers of [Ru(bpy)2(bbtb)]2+ to the icosanucleotide d(CACTGGTCTCTCTACCAGTG) was conducted. This sequence contains a seven-base-pair duplex stem and a six-base hairpin-loop. The investigation gave an indication of the relative binding of the complexes between the two different regions (duplex and secondary structure) of the oligonucleotide. The results suggest that both enantiomers bind at the hairpin, with the ruthenium centre located at the stem-loop interface. NOE studies indicate that one of the two benzothiazole substituents of the bbtb ligand projects into the loop-region. A simple model of the metal complex/oligonucleotide adduct was obtained by means of molecular modelling simulations. The results from this study suggest that benzothiazole complexes derived from inert polypyridine ruthenium(II) complexes could lead to the development of new fluorescent DNA hairpin binding agents.

Animals↗

PubMed2002

A novel method for SNP detection using a new duplex-specific nuclease from crab hepatopancreas.

We have characterized a novel nuclease from the Kamchatka crab, designated duplex-specific nuclease (DSN). DSN displays a strong preference for cleaving double-stranded DNA and DNA in DNA-RNA hybrid duplexes, compared to single-stranded DNA. Moreover, the cleavage rate of short, perfectly matched DNA duplexes by this enzyme is essentially higher than that for nonperfectly matched duplexes of the same length. Thus, DSN differentiates between one-nucleotide variations in DNA. We developed a novel assay for single nucleotide polymorphism (SNP) detection based on this unique property, termed "duplex-specific nuclease preference" (DSNP). In this innovative assay, the DNA region containing the SNP site is amplified and the PCR product mixed with signal probes (FRET-labeled short sequence-specific oligonucleotides) and DSN. During incubation, only perfectly matched duplexes between the DNA template and signal probe are cleaved by DSN to generate sequence-specific fluorescence. The use of FRET-labeled signal probes coupled with the specificity of DSN presents a simple and efficient method for detecting SNPs. We have employed the DSNP assay for the typing of SNPs in methyltetrahydrofolate reductase, prothrombin and p53 genes on homozygous and heterozygous genomic DNA.

Animals↗

PubMed1998

Sequence-specific DNA binding by EcoKI, a type IA DNA restriction enzyme.

The type I DNA restriction and modification enzymes of prokaryotes are multimeric enzymes that cleave unmethylated, foreign DNA in a complex process involving recognition of the methylation status of a DNA target sequence, extensive translocation of DNA in both directions towards the enzyme bound at the target sequence, ATP hydrolysis, which is believed to drive the translocation possibly via a helicase mechanism, and eventual endonucleolytic cleavage of the DNA. We have examined the DNA binding affinity and exonuclease III footprint of the EcoKI type IA restriction enzyme on oligonucleotide duplexes that either contain or lack the target sequence. The influence of the cofactors, S-adenosyl methionine and ATP, on binding to DNA of different methylation states has been assessed. EcoKI in the absence of ATP, with or without S-adenosyl methionine, binds tightly even to DNA lacking the target site and the exonuclease footprint is large, approximately 45 base-pairs. The protection is weaker on DNA lacking the target site. Partially assembled EcoKI lacking one or both of the subunits essential for DNA cleavage, is unable to bind tightly to DNA lacking the target site but can bind tightly to the recognition site. The addition of ATP to EcoKI, in the presence of AdoMet, allows tight binding only to the target site and the footprint shrinks to 30 base-pairs, almost identical to that of the modification enzyme which makes up the core of EcoKI. The same effect occurs when S-adenosyl homocysteine or sinefungin are substituted for S-adenosyl methionine, and ADP or ATPgammaS are substituted for ATP. It is proposed that the DNA binding surface of EcoKI comprises three regions: a "core" region which recognises the target sequence and which is present on the modification enzyme, and a region on each DNA cleavage subunit. The cleavage subunits make tight contacts to any DNA molecule in the absence of cofactors, but this contact is weakened in the presence of cofactors to allow the protein conformational changes required for DNA translocation when a target site is recognised by the core modification enzyme. This weakening of the interaction between the DNA cleavage subunits and the DNA could allow more access of exonuclease III to the DNA and account for the shorter footprint.

Adenosine Triphosphate↗

PubMed2000

Synthesis of oligonucleotide derivatives containing a bis-pyrene residue in the main chain.

The oligonucleotide having the bis-pyrene residue in the main chain was synthesized. The preparation of the bis-pyrene was started from the conversion of 2,2-bis-(bromomethyl)-1,3-propanediol into the protected bis-amino derivative. The reaction of the bis-amino derivative with 1-pyrenebutyric acid using DCC/HOBT afforded the desired bis-pyrene. This compound was then converted to the protected phosphormidite. The oligonucleotides possessing the bis-pyrene were synthesized by using the amidite. The oligonucleotides having the bis-pyrene residue can bind to DNA sequence in an aqueous solution to give the duplex with comparable thermal stability as that of the unmodified DNA/DNA duplex. The significantly enhanced pyrene-excimer fluorescence was observed upon hybridization of the bis-pyrene modified oligonucleotides with DNA.

Base Sequence↗

PubMed1999

Helical periodicity of (PNA)2.(DNA) triplexes in strand displacement complexes.

To study the helical structure in a P-loop formed by an invasion of oligopyrimidine peptide nucleic acid (PNA) into DNA duplex, bent DNA fragments containing a homopurine.homopyrimidine sequence between two bent DNA loci were prepared. As the spacer DNA length between the two bent loci varied by 1 bp over one helical turn, the electrophoretic mobility, reflecting the overall extent of DNA bending, was modulated sinusoidally in non-denaturing 5% polyacrylamide gel. When the bent DNA fragments differing in the spacer DNA length were preincubated with an oligopyrimidine PNA, the gel mobilities were changed due to a P-loop formation. By analyzing the gel mobility data with variations of the P-loop size, average helical parameters at the P-loop structure were determined. (PNA)2. (DNA) triplex within a P-loop had the helical periodicities of 15. 6(0.2) bp per turn at 20 degrees C and 17.4(0.7) bp per turn at 10 degrees C. In addition, the results indicate that a helical unwinding by 57(7) degrees at 20 degrees C and 37(13) degrees at 10 degrees C is present at the two junctions between a P-loop and its adjacent DNA duplex.

DNA↗

PubMed1986

Palindromic oligonucleotides containing 7-deaza-2'-deoxyguanosine: solid-phase synthesis of d[(p)GG*AATTCC] octamers and recognition by the endodeoxyribonuclease EcoRI.

Octadeoxynucleotides with the sequence d[(p)GG*AATTCC] have been prepared by solid-phase synthesis employing regular and base-modified phosphoramidites. These oligomers which contain an isosterically altered recognition sequence of the endodeoxyribonuclease Eco RI form duplexes under appropriate salt conditions. Since G* can represent 7-deaza-2'-deoxyguanosine the oligomers were used as probes to study their cleavage by the endodeoxyribonuclease Eco RI. The enzymatic hydrolysis of the modified octamer was strongly decreased compared to the regular DNA-fragment. This shows that guanine N-7 located at the cleavage site is important for the recognition process by the enzyme. The residual enzymatic activity is discussed on the basis of reduced specificity towards the recognition fragment. The fact that this cleavage occurs already under regular conditions indicates that the process described here bases on an intrinsic property of the oligomer and is different from the star activity.

Base Sequence↗

PubMed2004

The hepatitis C virus Core protein is a potent nucleic acid chaperone that directs dimerization of the viral (+) strand RNA in vitro.

The hepatitis C virus (HCV) is an important human pathogen causing chronic hepatitis, liver cirrhosis and hepatocellular carcinoma. HCV is an enveloped virus with a positive-sense, single-stranded RNA genome encoding a single polyprotein that is processed to generate viral proteins. Several hundred molecules of the structural Core protein are thought to coat the genome in the viral particle, as do nucleocapsid (NC) protein molecules in Retroviruses, another class of enveloped viruses containing a positive-sense RNA genome. Retroviral NC proteins also possess nucleic acid chaperone properties that play critical roles in the structural remodelling of the genome during retrovirus replication. This analogy between HCV Core and retroviral NC proteins prompted us to investigate the putative nucleic acid chaperoning properties of the HCV Core protein. Here we report that Core protein chaperones the annealing of complementary DNA and RNA sequences and the formation of the most stable duplex by strand exchange. These results show that the HCV Core is a nucleic acid chaperone similar to retroviral NC proteins. We also find that the Core protein directs dimerization of HCV (+) RNA 3' untranslated region which is promoted by a conserved palindromic sequence possibly involved at several stages of virus replication.

3' Untranslated Regions↗

PubMed2000

Accomodation of S-cis-tamoxifen-N(2)-guanine adduct within a bent and widened DNA minor groove.

The non-steroidal anti-estrogen tamoxifen [TAM] has been in clinical use over the last two decades as a potent adjunct chemotherapeutic agent for treatment of breast cancer. It has also been given prophylactically to women with a strong family history of breast cancer. However, tamoxifen treatment has also been associated with increased endometrial cancer, possibly resulting from the reaction of metabolically activated tamoxifen derivatives with cellular DNA. Such DNA adducts can be mutagenic and the activities of isomeric adducts may be conformation-dependent. We therefore investigated the high resolution NMR solution conformation of one covalent adduct (cis-isomer, S-epimer of [TAM]G) formed from the reaction of tamoxifen [TAM] to N(2)-of guanine in the d(C-[TAM]G-C).d(G-C-G) sequence context at the 11-mer oligonucleotide duplex level. Our NMR results establish that the S-cis [TAM]G lesion is accomodated within a widened minor groove without disruption of the Watson-Crick [TAM]G. C and flanking Watson-Crick G.C base-pairs. The helix axis of the bound DNA oligomer is bent by about 30 degrees and is directed away from the minor groove adduct site. The presence of such a bulky [TAM]G adduct with components of the TAM residue on both the 5'- and the 3'-side of the modified base could compromise the fidelity of the minor groove polymerase scanning machinery.

Antineoplastic Agents, Hormonal↗

PubMed2002

RNA interference (RNA(i)) induction with various types of synthetic oligonucleotide duplexes in cultured human cells.

Various types of synthetic oligonucleotide duplexes against the Photinus luciferase gene were tested on their induction of the sequence-specific RNA interference (RNAi) activity in transfected human cells. Results indicate that RNA duplexes with ribonucleotide 3' overhangs rather than those with deoxyribonucleotide 3' overhangs induce more efficient RNAi activity, and that sense-stranded DNA/antisense-stranded RNA hybrids induce a moderate RNAi activity. These results suggest that there is a difference in the potential of oligonucleotide duplexes to be RNAi mediators, i.e. short interfering RNAs (siRNAs), between human RNAi and invertebrate RNAi. The data further show that different siRNAs induce different levels of RNAi.

Animals↗

PubMed2004

Single unpaired nucleotides facilitate HIV-1 reverse transcriptase displacement synthesis through duplex RNA.

During reverse transcription of viral RNA, HIV-1 reverse transcriptase (RT) encounters RNA stem-loop structures that require displacement synthesis activity in which RT disrupts the RNA helix to access the template strand. A primer extension assay was developed to assess HIV-1 RT RNA displacement synthesis activity in vitro. Initial results revealed that HIV-1 RT performs only limited amounts of RNA displacement through long stretches of RNA duplex, with the majority of synthesis stalling at sequence-dependent pause positions. DNA displacement synthesis through the same sequence, however, proceeded rapidly to the end of the template. The RNA folding algorithm mfold indicated that the presence of an unpaired nucleotide, or "bulge," along the RNA duplex would promote helix melting ahead of the DNA primer terminus to create a small gap of nondisplacement synthesis. Primer extension assays using substrates possessing single-nucleotide bulges in the nontemplate strand near pause sites resulted in diminished pausing at positions within the predicted melted region. Surprisingly, the bulges also reduced pausing distal to the bulge at positions that are expected to remain base-paired. Further analysis revealed that stalling during RNA displacement synthesis results from the displaced RNA re-annealing to the template strand thus forcing the primer terminus to become unpaired and, therefore, not extendable. Introduction of a bulge facilitates displacement synthesis through distal regions by increasing RT processivity in the vicinity of a bulge and reducing the impact of branch migration on primer extension.

Base Sequence↗