SEARCH · PubMed Health

Results for “Observer Variation”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,315 records · Page 73Linked to original sources

PubMed2004

Ethnicity and diagnostic patterns in veterans with psychoses.

BACKGROUND: Differential diagnosis of schizophrenia and bipolar disorder is a challenging but important task. These conditions often exhibit overlapping clinical symptomatology, but have different prognoses and pharmacological management strategies. Factors other than clinical presentation may influence diagnosis. Past studies suggest that ethnicity is one such factor, with variations observed in diagnostic rates of serious mental illness (SMI). With increasing attention paid to provider cultural competency, we investigate current diagnostic practices within a veteran population. METHOD: Controlling for patient need characteristics and illness severity, we examine whether ethnic differences in diagnosis continue to exist. If so, race may adversely enter the evaluation process. A national database of all SMI veterans explores the relationship between ethnicity and diagnosis. The role of symptomatology is also examined. Given minimal variation in veteran socioeconomic status, the Department of Veterans Affairs (VA) provides a natural setting to address this confounding factor. The 1999 National Psychosis Registry provides a sample of 134,523 veterans diagnosed with schizophrenia, schizoaffective disorder, or bipolar disorder. Multinomial logistic regression yielded odds ratios (OR) for being diagnosed with schizophrenia versus bipolar disorder; the schizoaffective versus bipolar risk was likewise assessed, exploring theoretical aspects of a psychosis-affective 'continuum'. RESULTS: Small effects were observed for being male, single or rural resident. However, the demographic characteristic most strongly associated with a schizophrenia diagnosis was race. The OR for African Americans was 4.05, and 3.15 for Hispanics. Similar though less dramatic results were revealed for schizoaffective disorder. CONCLUSIONS: This study confirms continued ethnic disparities in diagnostic patterns, and highlights the importance of recognizing ethnic differences in symptom presentation while emphasizing greater cultural competency.

Black or African American↗

PubMed1975

High genetic variability in an ecologically variable vertebrate, Bufo viridis.

Allozymic variation in proteins encoded by 26 loci was analyzed electrophoretically in 517 specimens of green toads from 11 populations from Israel and one population from Vis Island in the Adriatic Sea. Genetic variation in this toad is the highest yet reported in any vertebrate. All three genetic parameters, mean number of alleles per locus (A), mean proportion of loci polymorphic per population (P), and mean number of heterozygous loci per individual (H), are very high (A = 1.65, range 1.38-2.04; P = 0.423, range 0.346-0.615; H = 0.133, range 0.108-0.159). Central and marginal mainland populations are only slightly more variable than desert isolates, but much more variable than the Vis Island population. Genetic similarity is very high between mainland populations (S = 0.951, range 0.93-0.97). Frequencies of two alleles (Icd-lc and Tfa) are correlated with an ecological gradient of increasing aridity. Regulatory enzymes appeared to contribute more to overall polymorphism than non-regulatory enzymes. The genetic variation observed suggests that selection for heterozygosity as an adaptive strategy is operating in the ecologically variable environment in which green toads live.

Alleles↗

PubMed1982

Phenotypic variations in re-lysogenization of Bacillus licheniformis with temperate phage.

A bacitracin-producing strain Bacillus licheniformis ATCC 10716 harbors two types of inducible phages (LP52 and DLP 10716). 156 strains re-lysogenized with phage LP52 were independently isolated from a cured strain UM12 of B. licheniformis. Those strains were divided into 12 groups based on colony morphology and pigment production. Some of the re-lysogenized strains grew faster than UM12 and others produced more bacitracin than the cured strain. For example, the production of bacitracin by one of the re-lysogenized strains, L89, was enhanced by about 70% in comparison with UM12. The phenotypic variations observed with re-lysogenized strains might be due to the re-insertion of the phage genome at different sites of the chromosome in addition to the pleiotropic effect assumed.

Bacillus↗

PubMed1997

Centromeric alphoid DNA heteromorphisms of chromosome 21 revealed by FISH-technique.

The centromeric heterochromatin of chromosome 21 has been evaluated by the fluorescence in situ hybridization (FISH) technique. It was found that the alphoid DNA sequences of pericentromeric regions of chromosome 21 were highly heteromorphic when a centromeric specific probe was hybridized to these sequences. The variations were so extreme that they could even be arbitrarily classified into at least five sizes by comparison with the length of the short arm (p) of chromosome 18. They are negative (1); small (2); medium (3); large (4); and very large (5). We used 15 normal cases and 12 individuals with trisomy 21 (Down syndrome), and the incidences for these five classes were 3.0%, 22.7%, 59.2%, 13.6% and 1.5%, respectively. At least 3% of the chromosomes no. 21 did not show any trace of hybridization signals, which apparently escape detection at interphase level as well. Although, the variations observed in the present study are continuous, the proposed classification may yield some implications for future investigations.

Centromere↗

PubMed1984

Murine leukemia virus-induced T-cell lymphomagenesis: integration of proviruses in a distinct chromosomal region.

A number of mink cell focus-forming (MCF) proviruses was molecularly cloned from mouse lymphoma DNA. From each clone, flanking probes were prepared to detect common integration regions in other MuLV-induced lymphomas. One clone frequently revealed variations in the molecular structure of the corresponding region (Pim-1) in other lymphomas. The results show the following. Changes in the Pim region are seen in 24 out of 93 lymphomas tested. Over 50% of the early T-cell lymphomas show integration in the Pim-1 region. The alterations are seen in different mouse strains and with various MuLVs. The observed variations are caused by the integration of predominantly MCF genomes. All integrations occur in a region spanning less than 20 kb and are associated with the transcriptional activation of a distinct region within the Pim-1 domain. The activated region does not show any homology with 13 known and three putative oncogenes.

Animals↗

PubMed2004

Geographical variation in acute psychiatric admissions within New York City 1990-2000: growing inequalities in service use?

The paper analyses geographical variations in use of acute psychiatric inpatient services within New York City and how these have changed from 1990 to 2000. We review literature suggesting reasons for the variations observed. Data from the New York State Department of Health Statewide Planning Research and Cooperative System were combined with population census data to produce age standardized ratio indicators of admissions and of bed days, as measures of use of general hospitals for psychiatric conditions, by males aged 15-64, in Zip Code Areas of New York City, in 1990 and 2000. Geographical variations in hospital use were related to proximity to general hospitals with psychiatric beds and to socio-economic status of local populations (as recorded in the 1990 and 2000 population censuses). Areas close to psychiatric hospitals areas show high admission levels. Controlling for this, Zip Code Areas with higher concentrations of poverty, of African American residents or of persons living alone were associated with relatively high admission ratios. These relationships vary somewhat between diagnostic groups. Area inequalities in standardized admission ratios persisted and widened between 1990 and 2000, and the highest hospital admission ratios were increasingly concentrated where social and economic disadvantage was greatest. Various possible reasons for this trend are explored. We conclude that increasing intensity of poverty in disadvantaged areas is not likely to provide an explanation and that the trends are more likely to result from changes in hospital management and funding affecting access to hospital services.

Acute Disease↗

PubMed2004

HIV-1 Vpr: genetic diversity and functional features from the perspective of structure.

RNA viruses are well known for the enormous genetic variation. Retroviruses share this feature with other RNA viruses, and human immunodeficiency virus type 1 (HIV-1) has been extensively investigated in this regard. Based on the DNA sequence analysis, HIV-1 has been classified into three groups; M, N, and O, with viral subtypes in each group. While the genetic variation between viral isolates has been documented throughout the genome, specifically, the env gene exhibits high variation. Analysis of the env gene from the sequential samples from HIV-1-infected patients reveals variation in the range of 1% per year. The variation observed in individual HIV-1 genes in the form of changes at the nucleotide level, as expected, should result in one of the possible scenarios: (1) no change in the amino acid, (2) conservative change in the amino acid, (3) nonconservative change in the amino acid, and (4) premature stop codon resulting in a truncated protein. Hence, it is likely that the variation may impact on the function of the protein, depending on the nature of the mutation. The goal of this review is to summarize the polymorphisms in Vpr using the available sequence information and discuss their effects on the functions of Vpr from the point of view of its structure. The data generated by several groups provide a base for understanding the consequences of natural polymorphisms in specific regions of the Vpr molecule. However, it is also clear that secondary changes (second site or compensatory mutations) may modify the effect of a specific mutation and a comprehensive analysis is needed to delineate the role of specific residues in Vpr molecule. This is an area which, we hope, will attract investigators for further studies, and may provide information for understanding the molecular basis of Vpr functions.

Acquired Immunodeficiency Syndrome↗

PubMed1986

Relation between peripheral chemoreceptors stimulation and pulmonary arterial blood pressure in rats.

As interactions between peripheral chemoreceptors stimulation (PCS) and pulmonary vasomotor tone remain controversial, experiments were made in rats in order to clear up the effects of PCS on pulmonary arterial pressure (PAP). Different stimulations varying in intensities were used, in rats nervously intact (IR-rats), after vagotomy (XT-rats), after chemodenervation obtained without vagotomy (CDN not XT-rats) or with XT (CDN + XT) and finally after alpha 1-receptors blockade (P-rats = pretreated rats). The observed variations were analysed in view of disentangling reflex part of PCS from a direct activity on the pulmonary vascular bed. Ventilation, PAP and systemic blood pressure (BP) were studied in anaesthetized rats. N2 test, NaCN test, 20 s of 5% O2 inhalation and almitrine bismesylate (ALM) were used as PCS, ranged in the order of their relative intensities, from the ventilatory responses observed in IR-rats. In IR-rats, N2-and CN test produced a similar transient increase of PAP, slightly more extended than the hyperventilation. After XT, the responses were prolonged, but amplified only in CN test. Ventilatory responses disappear after CDN, but as far as pulmonary hypertension is concerned, CDN + XT is more potent than CDN without XT to reduce or even suppress them. This fact is particularly evident with ALM who is the strongest PCS used. Similar reduction of PAP rise was also produced in P-rats in which ventilatory responses remain unchanged. Prolonged hypoxic inhalation induced a progressive fall of systolic BP and of PAP. The return to normal air breathing is followed by BP restoration and a long-lasting PAP increase.(ABSTRACT TRUNCATED AT 250 WORDS)

Almitrine↗

PubMed1988

Variations in the intensity of psychiatric treatment across markets for mental health services in the United States.

Data are analyzed that describe the clinical work of 800 psychiatrists who practiced in one of 62 markets for mental health services in the United States during 1982 or 1983. Intensity of treatment (i.e., mean face-to-face treatment minutes per patient per month) ranges from a low of 107 minutes to a high of 368 minutes. Each of two multiple regression models accounts for 60 percent or more of the observed variation. Most of the variation in intensity of treatment can be accounted for with variables associated with the patient's severity or stage of illness and the type of treatment provided. Patients who fall on the midrange of the severity scale tend to consume the most treatment time per month. None of the economic variables were significant at any reasonable level. These findings have immediate implications for the development of more functional prospective payment systems for the financing of mental health care and for the longer-term debate over the nature of mental health services markets.

Humans↗

PubMed1999

"Normal" thrombin generation.

We have investigated the influence of alterations in plasma coagulation factor levels between 50% and 150% of their mean values for prothrombin, factor X, factor XI, factor IX, factor VII, factor VIII, factor V, protein C, protein S, antithrombin III (AT-III), and tissue factor pathway inhibitor (TFPI) as well as combinations of extremes, eg, 50% anticoagulants and 150% procoagulants or 50% procoagulants and 150% anticoagulants in a synthetic "plasma" system. The reaction systems were constructed in vitro using purified, natural, and recombinant proteins and synthetic phospholipid vesicles or platelets with the reactions initiated by recombinant tissue factor (TF)-factor VIIa complex (5 pmol/L). To investigate the influence of the protein C system, soluble thrombomodulin (Tm) was also added to the reaction mixture. For the most extreme situations in which the essential plasma procoagulants (prothrombin, and factors X, IX, V, and VIII) and the stoichiometric anticoagulants (AT-III and TFPI) were collectively and inversely altered by 50%, a 28-fold difference in the total available thrombin generated was observed. Variations of most of these proteins 50% above and below the "normal" range, with the remainder at 100%, had only modest influences on the peak and total levels of thrombin generated. The dominant factors influencing thrombin generation were prothrombin and AT-III. When these 2 components were held at 100% and all other plasma procoagulants were reduced to 50%, there was a 60% reduction in the available thrombin generated. No increase in the thrombin generated was observed when the 150% level of all plasma procoagulants other than prothrombin was evaluated. When only prothrombin was raised to 150%, and all other factors were maintained at 100%, the thrombin generated increased by 71% to 121%. When AT-III was at 50% and all other constituents were at 100%, thrombin production was increased by 104% to 196%. The additions of protein C and protein S over the 50% to 150% ranges with Tm at 0.1 nmol/L concentration had limited influence on thrombin generation. Individual variations in factors VII, XI, and X concentrations had little effect on the duration of the initiation phase, the peak thrombin level achieved, or the available thrombin generated. Paradoxically, increases in factor IX concentration to 150% led to lowered thrombin generation, while decreases to 50% led to enhanced thrombin generation, most likely a consequence of factor IX as a competitive substrate with factor X for factor VIIa-TF. Reductions in factor V or factor VIII concentration led to prolongations of the initiation phase, while the reduction of TFPI to 50% led to shortening of this phase. However, none of these alterations led to significant changes in the available thrombin generated. Based on these data, one might surmise that increases in prothrombin and reductions in AT-III, within the normal range, would be potential risk factors for thrombosis and that algorithms that combine normal factor levels may be required to develop predictive tests for thrombosis.

Anticoagulants↗

PubMed1998

O6-Alkylguanine-DNA alkyltransferase: influence on susceptibility to the genetic effects of alkylating agents.

O6-Alkylguanine-DNA alkyltransferase (AGT) repairs DNA containing O6-alkylguanine by a suicide mechanism involving transfer of the alkyl group to its active site. In this way AGT protects cells from the mutagenic and cytotoxic effects of O6-alkylguanine-type lesions such as O6-methylguanine (O6-meG), an observation which has during recent years been confirmed by studies in transgenic animals either over-expressing or completely lacking this activity. While the levels of expression of AGT have been shown to affect strongly the repair of O6-meG after high doses of methylating agents inducing complete and prolonged depletion of the cellular AGT pool, other data suggest that within smaller variations of AGT levels (such as the interindividual variations observed in man or as observed after low or moderate exposures to alkylating agents) the dependence of O6-meG repair is limited. This phenomenon may reflect the intracellular distribution of the repair protein and must be taken into account when assessing the role of AGT in determining susceptibility to alkylating agents of environmental or clinical significance.

Alkylating Agents↗

PubMed2002

Comparison of two transducers for color Doppler imaging of the retrobulbar vessels.

PURPOSE: To compare blood flow velocity measurements obtained with two different linear probes (7.5 MHz and 12 MHz). MATERIALS AND METHODS: CDI measurements were performed in 31 eyes of 19 individuals with a 12 MHz and a 7.5 MHz probe. Measurements were taken in the ophthalmic artery (OA), central retinal artery (CRA), temporal short posterior ciliary arteries (TSPCA), and nasal short posterior ciliary arteries (NSPCA). With each probe, three measurements of each vessel were obtained, and end-diastolic velocity (EDV), peak systolic velocity (PSV), and resistance index (RI) were calculated. RESULTS: For EDV, the variation among replicates with the 7.5 MHz probe was between 13.99% and 19.51% and with the 12 MHz probe between 15.40% and 23.17%. For PSV, the variation among replicates was between 5.16% and 9.98% and between 6.58% and 10.71%, respectively with each probe. For RI, the variation among the replicates was between 3.10% and 8.97% and between 3.93% and 10.16%, respectively with each probe. The variation between probes was between 15.02% and 23.07% for EDV, between 10.72% and 13.24% for PSV, and between 4.27% and 6.05% for RI. The difference between estimated means was only significant for EDV in the TSPCA (P = 0.019), PSV in the TSPCA (P = 0.0002), as well as NSPCA (P = 0.003) and RI in the CRA (P < 0.001) and NSPCA (P < 0.044). CONCLUSION: The observed variation among three measurements is similar with both the 7.5 MHz and the 12 MHz probes. However, the 7.5 MHz probe tends to measure slightly higher values for some parameters.

Adult↗

PubMed1985

Fine mapping and sequencing of a variable segment in the inverted repeat region of varicella-zoster virus DNA.

A strain variation in the internal and terminal repeats which bind the short unique sequence of varicella-zoster virus (VZV) DNA was found to be due to an insertion or deletion of DNA sequences at a single site. DNA sequence analysis showed that the nucleotide sequence CCGCCGATGGGGAGGGGGCGCGGTACC is tandemly duplicated a variable number of times in different VZV strains and is responsible for the observed variation in mobilities of restriction fragments from this region of VZV DNA. The variable region sequence shares some homology with tandemly repeated regions in the a and c sequences of herpes simplex virus type 1 and probably exists in a noncoding region of the VZV genome.

DNA, Viral↗

PubMed2006

Spatiotemporal variation in survival rates: implications for population dynamics of yellow-bellied marmots.

Spatiotemporal variation in age-specific survival rates can profoundly influence population dynamics, but few studies of vertebrates have thoroughly investigated both spatial and temporal variability in age-specific survival rates. We used 28 years (1976-2003) of capture-mark-recapture (CMR) data from 17 locations to parameterize an age-structured Cormack-Jolly-Seber model, and investigated spatial and temporal variation in age-specific annual survival rates of yellow-bellied marmots (Marmota flaviventris). Survival rates varied both spatially and temporally, with survival of younger animals exhibiting the highest degree of variation. Juvenile survival rates varied from 0.52 +/- 0.05 to 0.78 +/- 0.10 among sites and from 0.15 +/- 0.14 to 0.89 +/- 0.06 over time. Adult survival rates varied from 0.62 +/- 0.09 to 0.80 +/- 0.03 among sites, but did not vary significantly over time. We used reverse-time CMR models to estimate the realized population growth rate (lamda), and to investigate the influence of the observed variation in age-specific survival rates on lamda. The realized growth rate of the population closely covaried with, and was significantly influenced by, spatiotemporal variation in juvenile survival rate. High variability in juvenile survival rates over space and time clearly influenced the dynamics of our study population and is also likely to be an important determinant of the spatiotemporal variation in the population dynamics of other mammals with similar life history characteristics.

Animals↗

PubMed1996

Simulations of Titan's brightness by a two-dimensional haze model.

We have used a 2-D microphysics model to study the effects of atmospheric motions on the albedo of Titan's thick haze layer. We compare our results to the observed variations of Titan's brightness with season and latitude. We use two wind fields; the first is a simple pole-to-pole Hadley cell that reverses twice a year. The second is based on the results of a preliminary Titan GCM. Seasonally varying wind fields, with horizontal velocities of about 1 cm sec-1 at optical depth unity, are capable of producing the observed change in geometric albedo of about 10% over the Titan year. Neither of the two wind fields can adequately reproduce the latitudinal distribution of reflectivity seen by Voyager. At visible wavelengths, where only haze opacity is important, upwelling produces darkening by increasing the particle size at optical depth unity. This is due to the suspension of larger particles as well as the lateral removal of smaller particles from the top of the atmosphere. At UV wavelengths and at 0.89 micrometers the albedo is determined by the competing effects of the gas the haze material. Gas is bright in the UV and dark at 0.89 micrometers. Haze transport at high altitudes controls the UV albedo and transport at low altitude controls the 0.89 micrometers albedo. Comparisons between the hemispheric contrast at UV, visible, and IR wavelengths can be diagnostic of the vertical structure of the wind field on Titan.

Atmosphere↗

PubMed1983

Microvascular response in cancellous bone to halothane-induced hypotension in pigs.

The microvascular response in cancellous bone to halothane-induced hypotension was studied simultaneously using Laser Doppler Flowmetry (LDF) and clearance of locally injected 133Xe in the subapical mandibular bone of 16 young pigs. During halothane inhalation, a significant reduction in mean blood pressure to values ranging from 22 to 60 mm Hg was observed. The blood flow, as measured with LDF, increased in more than 60% of the animals with hypotension levels above 30 mm Hg. At hypotension levels below 30 mm Hg, blood flow decreased in all cases. The individual regional vascular resistance, calculated as the quotient between blood pressure and recorded blood flow value, was significantly reduced (p less than 0.001) during hypotension. Rhythmical flow variations, observed in some animals at normotension, disappeared immediately following the start of halothane inhalation, but returned when blood pressure was stabilized at a lower level. For recordings made with 133Xe-clearance, a significant reduction (p less than 0.001) in the logarithmic decay of the washout curves was observed during hypotension. This logarithmic decay was correlated to the reduced blood pressure levels (r = 0.73). No average change in regional vascular resistance could, however, be demonstrated. The lack of correlation between results obtained by the 2 methods may be due to the fact that LDF is sensitive to the total blood flow in a limited tissue volume, while the 133Xe isotope seems to be washed out mainly by the capillary blood flow. It can be further concluded that halothane-induced hypotension levels, applicable to clinical routines, may produce an increase rather than a decrease in total blood flow in cancellous bone tissue.

Animals↗

PubMed1999

Reconstructing the history of human limb development: lessons from birth defects.

A major goal of biology has been to understand the developmental mechanisms behind evolutionary trends. This has led to a growing interest in studying the molecular basis of the evolution of developmental programs such as those mediating the diversification of tetrapod limbs. Over the last 10 y, it has become clear that the genes and general developmental programs used to build a limb are strongly conserved among widely disparate species. This finding suggests that altered regulation of the timing and locations of developmental events may be responsible for the morphologic variation observed among some species. However, genetic analyses of the regulatory regions of genes controlling vertebrate developmental programs are very limited. Characterization of the genetic basis of human birth defects of the limb provides an opportunity to dissect the developmental programs used to modify the architecture of the hominoid limb. This may allow us to assess the relative contributions of altered gene regulation to morphologic variation among species and reconstruct the evolutionary history of the hominid limb. Such insight is also important because morphologic differences in the hominid upper limb have been correlated with the use of tools, and tool making is often regarded as the milestone that marked the emergence of the genus Homo.

Embryonic and Fetal Development↗

PubMed2000

Application of a Fourier series to analysis of the relationship between mandibular form and facial morphology.

The shape of the mandible is used by orthodontists as an aid to orthodontic treatment planning, with different shapes displaying different growth characteristics and being associated with different functional patterns. However, the quantification of shape using conventional linear and angular variables does not always include details of some of the more subtle aspects of form. Fourier analysis enables accurate representation, with few coefficients, of a mandibular outer line from articulare to infradentale. The aim of this study was to investigate, using a cluster analysis, the relationship between variation in mandibular form and overall facial morphology. A cluster analysis of the Fourier amplitudes classified mandibular forms into one of seven groups for both males and females. The cluster analysis showed that the gonial angle and the inclination of lower incisor were associated with facial type according to the mandibular variables. Furthermore, the Fourier descriptions of mandibular form could be related to the observed variation in facial form, each of the clusters based on mandibular form being associated with demonstrable differences in dentofacial morphology.

Adult↗