SEARCH · PubMed Health

Results for “Restrictive”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 1,423 records · Page 79Linked to original sources

PubMedDate not supplied

Helper T-cell type 1 or type 2 function of xeno-MHC-restricted T-cell clones in a direct xenoantigen recognition.

There have been several reports that xeno-MHC-restricted T-cells have a cytotoxic function through a direct xenoantigen recognition, but yet no report that they have a helper function. Previously we showed that both xeno-MHC-restricted CD4(+) and CD8(+) T-cells recognized xenoantigens directly in a mouse anti-rat combination. In this study, we investigated whether or not xeno-MHC-restricted T-cells had a helper function. Mouse T-cell clones recognizing rat antigens directly were derived from T-cell lines using the limiting dilution method. Phenotype, cytotoxic activity and cytokine production of these clones were analyzed by flow cytometry, 51Cr release assay and ELISA, respectively. Rat-MHC class I-restricted mouse CD8(+) T-cell clones showed a specific cytotoxic activity against rat antigens. One CD4(+) clone produced IL-4 and IL-10, and the other CD4(+) clone produced not T-helper (Th) 2 cytokine but TNF-alpha. Our results suggested that xeno-MHC class I-restricted CD8(+) T-cells should have a cytotoxic function, and xeno-MHC class II-restricted CD4(+) T-cells should have either Th1 or Th2 function.

Animals↗

PubMed2000

Dietary restriction during murine development provides protection against MNU-induced mutations.

The developmental stage is the most rapid period for the accumulation of somatic mutations. Epidemiological studies have also suggested a significant role of early life for cancer susceptibility, showing a protective effect of modest dietary restriction early in life. To determine if mutation rate, diet, and cancer risk are related, we have investigated the effect of dietary restriction on somatic mutations early in life. The diet of mouse dams was restricted during pregnancy and lactation by 10% from ad libitum control. F(1) pups (SWRxMutaMouse) were weaned at 3 weeks of age. Pups from dams that were on a restricted diet were kept under dietary restriction (40% until 5 weeks of age and then 20% until sacrifice). Only females from litters of seven or eight were used in this study. A portion of pups from both groups were treated with N-methyl-N-nitrosourea (MNU, 50mg/kg, i.p.) at 5 weeks of age and all mice were sacrificed at 10 weeks of age. The frequency of induced mutations was reduced by about 30% at the three loci studied, lacZ (P=0.028) and cII (P=0.042) and Dlb-1 (P=0.032) in the small intestine in the restricted group. A similar decrease in the lacZ mutant frequency was observed in the bone marrow, but the results did not reach statistical significance (P=0.074). Few differences in the lacZ mutant frequency were observed in the colon and the mammary epithelium, but variability of the mutant frequencies was such that an effect of similar magnitude could not be excluded statistically. Analysis of 47 cII mutants revealed that the majority of MNU-induced mutations were G:C to A:T transition at non-CpG sites, with no difference in the mutation spectrum between the two dietary groups.

Animals↗

PubMed1995

Energy restriction and severe zinc deficiency influence growth, survival and reproduction of Heligmosomoides polygyrus (Nematoda) during primary and challenge infections in mice.

The objectives of this study were (1) to determine the impact of severe zinc deficiency on the establishment, growth, survival and reproduction of Heligmosomoides polygyrus in the laboratory mouse, during both primary and challenge infection protocols, and (2) to determine whether the observed effects resulted from zinc deficiency per se, or from the accompanying energy restriction. Three diet groups were used: zinc-sufficient (Zn+:60 mg zinc/kg diet), zinc-deficient (Zn-:0.75 mg zinc/kg diet) and energy restricted (ER:60 mg zinc/kg diet pair fed to Zn- mice). Neither Zn- nor ER influenced the establishment of the parasite during a primary infection. However, both significantly influenced the early development of the parasite. The proportion of adult worms recovered 9 days post-infection (p.i.) was highest in Zn- mice, intermediate in ER mice and lowest in Zn+ mice. Worms were also distributed more distally in the intestine of the Zn- mice and worm survival was highest in Zn- mice, intermediate in ER mice and lowest in Zn+ mice at both 4 and 5 weeks p.i. Although the length of female worms was reduced in Zn- mice, neither per capita fecundity nor egg viability was affected by zinc deficiency. Energy restriction, on the other hand, significantly reduced worm fecundity at 5 weeks post-primary infection, but had no effect on egg viability. Zinc concentration of adult H. polygyrus was similar among dietary groups. The effects of zinc deficiency and energy restriction were also investigated 4 and 5 weeks after a challenge infection. Whereas strong host resistance was evident in Zn+ and ER mice, based on comparison of worm numbers between challenged mice and primary infection controls, no evidence of resistance was detected in Zn- mice. As in the primary infection, female worms were shorter in Zn- mice than in ER and Zn+ mice, and energy restriction but not zinc deficiency significantly affected per capita fecundity. However, in contrast to the primary infection, ER mice had elevated rather than reduced fecundity. This study demonstrates a complex interaction between H. polygyrus and zinc and energy restriction, and highlights the importance of controlling for reduced food intake in nutrition-infection studies.

Animals↗

PubMed1993

Amelioration of murine cerebral malaria by dietary restriction.

CBA/T6 strain mice infected with Plasmodium berghei ANKA develop cerebral symptoms and die, with mononuclear cell attachment to the cerebral microvascular endothelium, petechial haemorrhages and breakdown of the blood-brain barrier, some 6-7 days post-inoculation. The effects of dietary restriction on this process were examined. Mice were fed ab libitum (Group 1) or their food was restricted to produce body weight loss of 1.0-2.0% (Group 2), 2.5-3.5% (Group 3), 4.0-6.5% (Group 4) or 7.0-9.5% (Group 5) relative to Group 1. Dietary restriction reduced deaths caused by cerebral malaria from 100% in Group 1 to 47% (Group 2), 43% (Group 3), 10% (Group 4) and 53% (Group 5). Restriction of food intake had no effect on (1) the progression of parasitaemia in infected mice (2) changes in haematocrit, spleen weight, total lymph node cell number or (3) peritoneal exudate cell number in either malaria-infected or uninfected mice. P. berghei ANKA infection did not significantly affect the proportion of lymph node leucocytes that were Thy-1+ T cells or CD8+ T cells, but did lead to significant increases in the CD4+ and B cell populations. Dietary restriction alone increased the lymph node CD4+ cell population but did not affect the increase in B cells in malaria-infected mice. P. berghei ANKA infection and dietary restriction together did not lead to increased CD4+ cell numbers in lymph node leucocytes. The in vitro proliferative response to isolated lymph node cells to concanavalin A or phorbol myristate acetate plus ionomycin was measured and found to be identical in all treatment groups.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗

PubMed2004

Very efficient template/primer-independent DNA synthesis by thermophilic DNA polymerase in the presence of a thermophilic restriction endonuclease.

We have found that, in the presence of a thermophilic restriction endonuclease, thermophilic DNA polymerase efficiently synthesizes and amplifies DNA in the absence of any added template and primer nucleic acid under isothermal conditions. More than 10 microg of DNA can be synthesized by 1 unit of DNA polymerase in 1 h, and the reaction proceeds until available dNTPs are consumed. We used mostly the Tsp509I restriction endonuclease (recognition sequence: decreasing AATT), the TspRI restriction endonuclease (recognition sequence: NNCA(G/C)TGNN decreasing), and Vent (exo(-)) and Vent DNA polymerase. The synthesized double-stranded DNA has a highly repetitive palindromic sequence, e.g. (AAAAATTTTT)(n) and (ATACACTGTATATACAGTGTAT)(n). In every repeating unit, there are one or two recognition sites for the restriction enzyme. Our data show that the high efficiency of the restriction-endonuclease-DNA-polymerase (RE-pol) DNA synthesis results from an efficient exponential amplification involving digestion-elongation cycles: a longer DNA with numerous recognition sites for the restriction enzyme is digested to short fragments, and the short fragments are used as seeds for elongation to synthesize longer DNA. A possible role of RE-pol DNA synthesis in the evolutionary development of genetic materials is briefly discussed.

Archaeal Proteins↗

PubMed1997

Effect of food restriction on life span and immune functions in long-lived Fischer-344 x Brown Norway F1 rats.

Life-long food restriction is known to slow aging and reduce the rate of occurrence of age-associated disease processes, but the mechanism by which this is accomplished is unknown. In this study we have examined the effect of food restriction on the proliferative response of spleen cells to mitogens and lymphokine production in 6-, 18-, and 30-month-old AL and FR Fischer-344 x Brown Norway (F-344 x BNF1) female rats whose average life span is 137 weeks on an ad libitum (AL) diet and 177 weeks on a food-restricted (FR) diet. In addition, the ability of food restriction to recall antigens was tested in 10-month-old rats by immunizing them with keyhole limpet and hen's egg albumin and measuring proliferative response of draining lymph node cells to these antigens. Our results indicated that the spleen-cell proliferative response to phytohemagglutinin and concanavalin A (Con A) was equal in 6- and 18-month-old rats but declined significantly in 30-month-old AL rats compared to FR rats. Although flow cytometric analyses did not reveal differences for CD4, CD8, and Ig+ cells with age, a significant rise in memory T cells (Ox-22low) in both CD4+ and CD8+ T-cell subset lineage was noted in AL-fed rats at 30 months of age. In FR rats, however, only a minimal shift of naive T cells (Ox-22high) to memory cells was observed. In FR rats, the observed changes in the naive and memory T-cell subsets correlate well with the observed higher levels of the antiinflammatory interleukin-2 (IL-2) and lower levels of the proinflammatory cytokines such as IL-6 and tumor necrosis factor-alpha. The ability of food-restricted animals to recall antigens was lower compared to their age-matched controls, though the proliferative response to T-cell mitogen Con A and superantigen staphylococcal enterotoxin B was higher. These findings indicate that food restriction may selectively act to maintain a lower number of antigen-induced memory T cells with age, thereby maintaining the organism's ability to produce higher levels of IL-2 with age. In summary, the increased cell-mediated immune function noted in aged FR rats appears to be due to the presence of a higher number of naive T cells, which are known to produce elevated levels of the antiinflammatory cytokines, which may in part be responsible for reducing the observed age-related rise in disease.

Aging↗

PubMedDate not supplied

Intracellular diffusion of adenosine phosphates is locally restricted in cardiac muscle.

Recent studies have revealed the structural and functional interactions between mitochondria, myofibrils and sarcoplasmic reticulum in cardiac cells. Direct channeling of adenosine phosphates between organelles identified in the experiments indicates that diffusion of adenosine phosphates is limited in cardiac cells due to very specific intracellular structural organization. However, the mode of diffusion restrictions and nature of the intracellular structures in creating the diffusion barriers is still unclear, and, therefore, a subject of active research. The aim of this work is to analyze the possible role of two principally different modes of restriction distribution for adenosine phosphates (a) the uniform diffusion restriction and (b) the localized diffusion limitation in the vicinity of mitochondria, by fitting the experimental data with the mathematical model. The reaction-diffusion model of compartmentalized energy transfer was used to analyze the data obtained from the experiments with the skinned muscle fibers, which described the following processes: mitochondrial respiration rate dependency on exogenous ADP and ATP concentrations; inhibition of endogenous ADP-stimulated respiration by pyruvate kinase (PK) and phosphoenolpyruvate (PEP) system; kinetics of oxygen consumption stabilization after addition of 2 mM MgATP or MgADP; ATPase activity with inhibited mitochondrial respiration; and buildup of MgADP concentration in the medium after addition of MgATP. The analysis revealed that only the second mechanism considered--localization of diffusion restrictions--is able to account for the experimental data. In the case of uniform diffusion restrictions, the model solution was in agreement only with two measurements: the respiration rate as a function of ADP or ATP concentrations and inhibition of respiration by PK + PEP. It was concluded that intracellular diffusion restrictions for adenosine phosphates are not distributed uniformly, but rather are localized in certain compartments of the cardiac cells.

Adenosine Diphosphate↗

PubMed1987

Dietary self-selection of golden hamsters in response to acute food deprivation and chronic food restriction.

Adult male golden hamsters were maintained on either Purine Rat Chow (Chow diet) or a self-selection diet consisting of high-protein chow, pure fat, and pure carbohydrate (Choice diet). In Experiment 1, animals were deprived of food for single periods of up to 48 hr. Animals on the Chow diet did not increase intake at any time after deprivation; animals on the Choice diet selectively increased their consumption of fat-derived calories and increased their total caloric intake during the first 6 hr of refeeding, but not thereafter. The nature of the diet did not influence the rate at which animals regained weight following deprivation. In Experiment 2, hamsters were placed on food-restriction schedules (access to food either for 1 hr/day only or on alternate days only) until they lost 20% of starting body weight. Chow-fed animals demonstrated little or no change in food intake either during or after food restriction. Hamsters on the Choice diet consumed more calories and lost weight more slowly than did chow-fed animals during 1-hr/day feeding; intake of fat-derived calories was elevated during restriction. Choice hamsters increased total caloric intake only towards the end of the alternate-days restriction schedule. Choice hamsters were hyperphagic following both types of food-restriction schedules, but no increased preference for fat-derived calories was observed. Factors influencing food consumption of hamsters in response to deprivation and restriction are discussed.

Animals↗

PubMed1981

Clones of helper T cells mediate antigen-specific, H-2-restricted DTH.

It is now well established that in the mouse, helper T cells and killer T cells are two distinct thymus-derived lymphocyte subpopulations, differing from each other in Lyt phenotype and H-2 restriction, among other parameters. Helper T cells are Lyt-1+ and their action in immune responses involves restriction at the H-2I region of the major histocompatibility complex (MHC). Killer cells, on the other hand, are Lyt-23+ and their activity is restricted by H-2K/D (refs 1, 3). In most instances, T cells mediating delayed-type hypersensitivity (DTH) responses share the Lyt phenotype and H-2 restriction of the helper T cell. This raises the question of whether or not helper activity and DTH can be mediated by the same activated T cell. Arguments for both views have been reported. We analysed this question using clones of specific helper T cells, which were obtained by long-term culture in vitro of in vivo primed T cells, followed by single-cell cloning. Here we show that these clones of helper T cells mediate antigen-specific and fully H-2-restricted DTH. The restricting element lies to the left of the I-B region in genetic maps of the mouse MHC.

Animals↗

PubMed2002

Positive selection of MHC class Ib-restricted CD8(+) T cells on hematopoietic cells.

Unlike conventional CD8(+) T cells, major histocompatibility complex (MHC) class Ib-restricted CD8(+) T cells show an activated phenotype in uninfected mice and respond rapidly to foreign invaders. The underlying factors that contribute to these differences are not well understood. We show here that the activated phenotype of MHC class Ib-restricted CD8(+) T cells was partially acquired as a result of interactions in the thymus and reflected an increased capacity to be selected via interactions with MHC molecules on hematopoietic cells. Using bone marrow-chimeric mice, we have shown that MHC class Ib-restricted, but not MHC class Ia-restricted, CD8(+) T cells specific for Listeria monocytogenes were efficiently selected when MHC class I was expressed only on hematopoietic cells. Thus, the distinct functional properties of MHC class Ib-restricted versus MHC class Ia-restricted CD8(+) T cells may result, at least in part, from the different ways in which they are positively selected in the thymus.

Animals↗

PubMed2003

Dietary restriction and nicotine can reduce anxiety in female rats.

Anxiety may play a role in the initiation of smoking and there is evidence to suggest that sex and age may predetermine responses to nicotine. At present, the greatest increase in smoking is in women and it is often accompanied by dieting. The purpose of the present study was to investigate how the impact of dietary restriction might modify the effects of nicotine in female adult and adolescent rats. The effects of nicotine in the elevated plus-maze test of anxiety were compared in free-feeding animals and those subjected to dietary restriction that reduced body weight to 85% of free-feeding weight. In nondeprived adult females, nicotine (0.05-0.5 mg/kg, s.c.) reduced the percentage of time spent on the open arms, indicating anxiogenic effects. However, the effects of nicotine were dramatically changed in food-restricted adult females and 0.05 mg/kg had a striking anxiolytic effect. No significant effects of nicotine were found in the adolescent female rats, suggesting a role of circulating sex hormones in modulating nicotine's effects on anxiety. However, in the adolescent females, dietary restriction significantly increased the percentages of time spent and entries onto the open arms, without changing closed arm entries, indicating an anxiolytic effect. These results raise the important possibility that, in prepubertal girls, dietary restriction may have anxiolytic effects and this might contribute to the onset of anorexia. Circulating female hormones reduce this effect, but in adult females the combination of dietary restriction and nicotine may have important anxiolytic effects that impact on the initiation of regular smoking.

Age Factors↗

PubMed1975

Enzymological aspects of the pathways for trimethylamine oxidation and C1 assimilation of obligate methylotrophs and restricted facultative methylotrophs.

Extracts of trimethylamine-grown W6A and W3A1 (type M restricted facultative methylotrophs) contain trimethylamine dehydrogenase whereas similar extracts of Bacillus PM6 and Bacillus S2A1 (type L restricted facultative methylotrophs) contain trimethylamine mono-oxygenase and trimethylamine N-oxide demethylase but no trimethylamine dehydrogenase. Extracts of the restricted facultatives and of the obligate methylotroph C2A1 contain hexulose phosphate synthase-hexulose phosphate isomerase activity; hydroxypyruvate reductase was not detected. Neither the restricted facultatives nor the obligates 4B6 and C2A1 contain all the enzymes of the hexulose phosphate cycle of formaldehyde assimilation as originally proposed by Kemp & Quayle (1967). Organisms PM6 and S2A1 lack transaldolase and use a modified cycle involving sedoheptulose 1,7-diphosphate and sedoheptulose diphosphatase. The obligates 4B6 and C2A1, and the type M organisms W6A and W3A1, use a different modification of the assimilatory hexulose phosphate cycle involving the Entner-Doudoroff-pathway enzymes phosphogluconate dehydratase and phospho-2-keto-3-deoxygluconate aldolase. The lack of fructose diphosphate aldolase and hexose diphosphatase in these organisms may be a partial explanation of their restricted growth-substrate range. Enzymological evidence suggests that all the obligates and the restricted facultatives use a dissimilatory hexulose phosphate cycle to accomplish the complete oxidation of formaldehyde to CO2 and water.

Aldehyde-Lyases↗

PubMed2001

Screening for pre-eclampsia and fetal growth restriction by uterine artery Doppler at 11-14 weeks of gestation.

OBJECTIVE: To examine the value of uterine artery Doppler at 11-14 weeks of gestation in the identification of women at risk of developing pre-eclampsia and fetal growth restriction. METHODS: Uterine artery Doppler was carried out at 11-14 weeks in 3324 consecutive singleton pregnancies attending for routine care in three London hospitals. The right and left uterine arteries were identified using color flow mapping and velocity waveforms were obtained using pulsed Doppler. The mean pulsatility index of the two arteries was determined and the predictive value of a mean pulsatility index > the 95th centile in the prediction of pre-eclampsia and/or fetal growth restriction was calculated. RESULTS: Satisfactory flow velocity waveforms were obtained from both uterine arteries in 3195 (96.1%) of the 3324 pregnancies examined and complete outcome information was obtained for 3045 (95.3%) of these women. The 95th centile of the uterine artery mean pulsatility index was 2.35 and did not change significantly with gestational age. The pregnancy was complicated by pre-eclampsia in 63 (2.1%) cases and by fetal growth restriction in 290 (9.5%) cases. The sensitivity of a mean pulsatility index > 2.35 for pre-eclampsia (with or without fetal growth restriction) was 27.0% but for fetal growth restriction alone it was 11.7%. The respective sensitivities for these complications requiring delivery before 32 weeks of gestation were 60.0% and 27.8%, respectively. CONCLUSION: Uterine artery Doppler at 11-14 weeks of gestation identifies a high proportion of women who develop severe pre-eclampsia and/or fetal growth restriction.

Adult↗

PubMed2002

Temporal sequence of abnormal Doppler changes in the peripheral and central circulatory systems of the severely growth-restricted fetus.

OBJECTIVE: To identify the temporal sequence of abnormal Doppler changes in the fetal circulation in a subset of early and severely growth-restricted fetuses. METHODS: This was a prospective observational study in a tertiary care/teaching hospital. Twenty-six women who were diagnosed with growth-restricted fetuses by local standards before 32 weeks' gestation and who had abnormal uterine and umbilical artery Doppler velocimetry were enrolled onto the study. To compare Doppler changes as a function of time, pulsed-wave Doppler ultrasound was performed on five vessels in the fetal peripheral and central circulations. Doppler examinations were performed twice-weekly and on the day of delivery if the fetal heart rate tracing became abnormal. Doppler indices were scored as abnormal when their values were outside the local reference limits on two or more consecutive measurements. Biometry for assessment of fetal growth was performed every 2 weeks. Computerized fetal heart rates were obtained daily. Delivery was based on a non-reactive fetal heart rate tracing and not on Doppler information. Patients with a severely growth-restricted fetus who were delivered for maternal indications such as pre-eclampsia were excluded. Perinatal outcome endpoints included: intrauterine death, gestational age at delivery, newborn weight, central nervous system damage of grade 2 or greater, intraventricular hemorrhage and neonatal mortality. RESULTS: Mean gestational age and newborn weight at delivery were 29 (standard deviation (SD), 2) weeks and 818 (SD, 150) g, respectively. The sequence of Doppler velocimetric changes was described by onset time cumulative curves that showed two time-related events. First, for each vessel there was a progressive increase in the percent of fetuses developing a Doppler abnormality. Second, severely growth-restricted fetuses followed a progressive sequence of acquiring Doppler abnormalities which were categorized into 'early' and 'late' Doppler changes. Early changes occurred in peripheral vessels (umbilical and middle cerebral arteries; 50% of patients affected 15-16 days prior to delivery). Late changes included umbilical artery reverse flow, and abnormal changes in the ductus venosus, aortic and pulmonary outflow tracts (50% of patients affected 4-5 days prior to delivery). The time interval between the occurrence of early and late changes was significantly different (P < 0.0001) and late changes were significantly associated with perinatal death (P < 0.01). CONCLUSIONS: Doppler velocimetry abnormalities develop in different vessels of the severely growth-restricted fetus in a sequential fashion. Late changes in vascular adaptation by the severely growth-restricted fetus are the best predictor of perinatal death.

Blood Circulation↗

PubMed2002

Foetal intrauterine growth restrictions with Helicobacter pylori infection.

BACKGROUND: Helicobacter pylori infection has been associated with growth restriction in young children. AIM: To determine whether there is an association between H. pylori infection and intrauterine growth restriction. METHODS: Four hundred and forty-eight consecutive pregnant women (aged 15-44 years), attending for routine examinations in the third trimester, were enrolled. Clinical, demographic and previous obstetric data, as well as smoking history, were collected. At delivery, the weight, height, gender and status of the neonate were recorded; intrauterine growth restriction was defined if the birth weight was below the 10th percentile according to the gestational age for infants born in Australia. RESULTS: Eighty-nine (20%) women were seropositive for H. pylori. The prevalence of H. pylori was significantly lower in Caucasians (17%) vs. non-Caucasians (42%, P < 0.0001). There were 34 (7.5%) cases of intrauterine growth restriction (7% Caucasians, 16% Asians, 12% Aborigines and 0% Pacific Islanders). Intrauterine growth restriction was more common in H. pylori-seropositive women than in H. pylori-seronegative women [13.5% vs. 6%; odds ratio (OR) = 2.41; 95% confidence interval (CI), 1.14-5.08; P = 0.018]. A multiple logistic regression model revealed that smoking (OR = 3.55; 95% CI, 1.62-7.79; P = 0.002), maternal height (OR = 0.48; 95% CI, 0.28-0.80; P = 0.005) and H. pylori seropositivity (OR = 2.59; 95% CI, 1.12-5.95; P = 0.025) were all independent risk factors for intrauterine growth restriction. CONCLUSIONS: H. pylori infection in pregnant women may affect foetal intrauterine growth.

Adolescent↗

PubMed2000

The effect of dietary restriction and menstrual cycle on excess post-exercise oxygen consumption (EPOC) in young women.

The purpose of this study was to evaluate the effect of acute dietary restriction on excess post-exercise oxygen consumption (EPOC) in young women at two different phases of the menstrual cycle. Five young sedentary women (age 21-22 years) participated in this study. Each subject visited the laboratory eight times for measurement of EPOC. They performed cycle ergometer exercise for 60 min at a work rate corresponding to approximately 70% of VO2max under each four different conditions (i.e. standard diet/follicular phase (SF), standard diet/luteal phase (SL), restricted diet/follicular phase (RF) and restricted diet/luteal phase (RL)). The exercise was performed in the morning and VO2 was measured for the last 15 min of each hour for 7 h after the exercise. As a control, VO2 was also measured with an identical time schedule under the same four conditions but without exercise. EPOC was calculated as the difference of the VO2-time integral for 7 h between the exercise and control trial days in each of the four conditions (i.e. SL, SF, RL and RF). The diet was precisely controlled during 2 days (i.e. the test day and the day preceding it). The standard diet was 1600 kcal day-1 and the restricted diet was half of the standard diet. A two-way (dietary and menstrual cycle factors) ANOVA indicated that EPOC was significantly affected only by the dietary factor. The dietary restriction decreased EPOC compared to the standard dietary condition (SF 8.6 +/- 2.1, RF 5.3 +/- 1.6, SL 8.9 +/- 4.8, RL 4.0 +/- 1.2 l). These data indicate that for young sedentary women, EPOC is significantly lowered by prior acute dietary restriction but is not influenced by different phases of the menstrual cycle.

Adult↗

PubMed2000

Influence of aging and caloric restriction on activation of Ras/MAPK, calcineurin, and CaMK-IV activities in rat T cells.

The signaling cascade mediated by Ras (p21ras) and MAPK (mitogen-activated protein kinase) and calcium/calmodulin regulating enzymes, calcineurin (CaN) and CaMK-IV, are considered to be essential for T-cell growth and function. In the present study, the effect of aging and caloric restriction (CR) on the induction of Ras and MAPK activation by concanavalin A (ConA) was studied. Splenic T cells were isolated from young (4-6 months) and old (22-24 months) rats that had free access to food (control group), and from caloric restricted old (22-24 months) rats that beginning at 6 weeks of age were fed 60%(40% caloric restriction) of the diet consumed by the control rats. We found that the induction of Ras activity in T cells isolated from control old rats was lower (P<0.001) than that in control young rats. However, the levels of Ras activity in T cells isolated from CR old rats were similar to the levels in the age-matched control rats. The induction of MAPK activity in T cells isolated from control old rats and CR old rats was significantly less than in T cells isolated from control young rats, and caloric restriction significantly (P<0.05) reduced the age-related decline in MAPK activation. We also measured the induction of CaN and CaMK-IV activities by ConA in T cells from control young and old and CR old rats. The induction of both CaN and CaMK-IV activity decreased with age. Caloric restriction significantly (P<0.05) reduced the age-related decline in CaN activity, but had no significant effect on CaMK-IV activity. The changes in Ras/MAPK activation and in CaN and CaMK-IV activity with age or with CR were not associated with alterations in their corresponding protein levels. Thus, caloric restriction has a differential effect on the activation of the upstream signaling molecules that are altered with age.

Aging↗

PubMed2000

Restrictive left ventricular filling pattern after myocardial infarction: significance of concomitant preserved systolic function.

Restrictive left ventricular (LV) filling identifies a high risk subgroup, following myocardial infarction (MI). The extent and significance of systolic dysfunction in this group is not clear. The aim of our study was to determine the incidence and extent of systolic dysfunction in patients with restrictive filling and nonrestrictive filling examining the prognostic implications. Doppler parameters of LV diastolic function were measured in 102 post-MI subjects within 4 days. Restrictive filling was defined as the presence of E:A ratio > 2 or E:A ratio 1-2 with MDT < or = 140 msec. Follow-up was to a median of 11 months. Restrictive filling (group A) was found in 19 (19%) of 102 patients. Patients with this pattern were more likely to have systolic dysfunction than those without (group B); 63% and 35%, respectively, P = 0.024. Eight (42%) of 19 patients in group A had relatively preserved systolic function. At 11 months 14 patients had developed heart failure (HF), 6 in group A (32%) and 8 in group B (10%), P = 0.012. There were two deaths (11%) in group A and 7 (8%) in group B, P = ns. Seven (88%) of 8 patients in group A with relatively preserved systolic function were alive and free of heart failure at follow-up compared to 4 of 11 patients (36%) in group A with systolic dysfunction (P = 0.026). Restrictive filling can be associated with relatively preserved systolic function after MI and these patients have a relatively good outcome. Patients with restrictive filling post-MI are a heterogeneous group emphasizing the evaluation of both systolic and diastolic function.

Aged↗