PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “THYROID HORMONES”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 145 records · Page 8Linked to original sources
PubMed1998

Circulating thyroid hormone concentrations and placental thyroid hormone receptor expression in normal human pregnancy and pregnancy complicated by intrauterine growth restriction (IUGR).

Thyroid hormones are critical to growth and development of the human fetus. Abnormal placental development, a major cause of intrauterine growth restriction (IUGR), is associated with a high perinatal mortality and morbidity. Thyroid status has been postulated to play a role in the pathogenesis of such morbidity. In the present study, we have investigated fetal thyroid function and placental expression of thyroid hormone receptor (TR) alpha and beta variants during normal human pregnancy and in pregnancy associated with IUGR. Measurement of free thyroid hormones and TSH concentrations revealed significant rises in free T4 and free T3 between the second and third trimesters of normal pregnancy. Serum concentrations of free T4 and free T3 were lower in fetuses affected by IUGR, although serum TSH levels were not significantly different. Immunocytochemistry demonstrated the presence of TR alpha1, alpha2, and beta1 proteins within the nuclei of trophoblast and stromal placental cells. Immunostaining for these TR variants increased with increasing gestation in normal placenta. Comparison of IUGR placental samples with normal samples revealed greater immunostaining for TR alpha1, alpha2, and beta1 variants in IUGR. Examination of pretranslational expression of TR alpha1, alpha2, beta1, and beta2 variants by semiquantitative RT-PCR revealed increasing expression of TR alpha1, alpha2, and beta2 messenger RNAs with increasing gestation in normal pregnancy, which "mirrored" post-translational expression. However, and in contrast, there were no significant differences in expression of TR messenger RNAs in normal and IUGR placenta. The present findings of reduction in serum free thyroid hormones and increased expression of TR alpha and beta proteins in association with IUGR highlight the potential importance of thyroid status in influencing long-term fetal outcome in this condition.

Blotting, Western↗
PubMed1994

Half-site arrangement of hybrid glucocorticoid and thyroid hormone response elements specifies thyroid hormone receptor complex binding to DNA and transcriptional activity.

Thyroid hormone receptors bind to thyroid hormone response elements (TREs) as heterodimers with 3,5,3'-L-triiodothyronine (T3) receptor auxiliary protein (TRAP) and retinoid X receptors (RXRs). Currently, it is not known whether TR/TRAP or TR/RXR heterodimers need to bind to both TRE half-sites and whether there is a preferred orientation for TR/RXR heterodimer binding to TREs or transcriptional activation. Accordingly, we created a mutant TR alpha (TR-P box) by changing 3 amino acids in the P box region of the first zinc finger of the DNA-binding domain to that of the glucocorticoid receptor (GR), and we examined wild-type TR alpha and TR-P box complex binding to hybrid response elements containing TRE and glucocorticoid receptor element (GRE) half-sites arranged as a direct repeat with a four-nucleotide gap. TR-P box/RXR heterodimers selectively bound to the hybrid response elements in which GRE half-site was the downstream half-site, whereas TR alpha/RXR bound to hybrid response elements in which GREs were in either position. Additionally, TR/TRAP or TR/RXR heterodimer required two half-sites for binding to DNA, with strong binding to at least one of the half-sites. Last, co-transfection assays and methylation interference studies using the hybrid response elements suggest that the sequential arrangement of strong and weak half-sites in the TRE may be a critical determinant of TR/RXR heterodimer binding and transcriptional activation.

Base Sequence↗
PubMed2005

Tissue responses to thyroid hormone in a kindred with resistance to thyroid hormone harboring a commonly occurring mutation in the thyroid hormone receptor beta gene (P453T).

Resistance to thyroid hormone (RTH) is a dominantly inherited syndrome of reduced tissue responsiveness to thyroid hormone (TH) usually due to mutations in the TH receptor beta gene (TRbeta). We studied pituitary and peripheral tissue responses to graded doses of liothyronine (L-T3) in 5 affected members (2 children and 3 adults) of a family with RTH due to the common TRbeta mutation P453T. Overall, the 5 subjects studied exhibited suppressed thyrotropin response to thyrotropin-releasing hormone of 51% +/- 8%, 12.1% +/- 1.5%, and 6.3% +/- 3% of the 100% baseline on 50, 100, and 200 microg/dL L-T3, respectively. This degree of suppression was greater than that observed in subjects with RTH due to other TRbeta mutations, indicating less resistance. Compared with normal subjects, however, the family described here demonstrated less suppression by L-T3, compatible with their RTH, although of a mild magnitude. The 2 children with RTH demonstrated less L-T3-mediated suppression of prolactin and cholesterol than the adults. Patients often receive thyroid ablative therapy before the diagnosis of RTH and are left with variable degrees of hypothyroidism. Our results demonstrate that graded doses of L-T3 can be used to evaluate RTH patients, even under the condition of limited thyroid reserve, when results are compared with their baseline. We demonstrate that RTH patients can be evaluated either on or off thyroid hormone and still be distinguished from hypothyroid subjects without RTH.

Adult↗
PubMed1989

Effect of 8-anilino-1-naphthalene sulfonic acid (ANS) on the interaction between thyroid hormone and anti-thyroid hormone antibodies.

Effect of 8-anilino-1-naphthalene sulfonic acid (ANS) on the interaction between thyroid hormone and anti-thyroid hormone antibodies was examined. Addition of 5.1 x 10(6) or 6.3 x 10(6) molar excess of ANS, respectively, enhanced the binding of 125I-T3 or 125I-T4 to their respective autoantibodies. However, further increase in ANS concentration resulted in a decrease in binding. These results suggest that the optimum concentration of ANS for the detection of anti-thyroid hormone antibodies is 5 approximately 6 x 10(6) molar excess of ANS to 125I-T3 or 125I-T4. On the other hand, addition of 10(4) molar excess of ANS concentration decreased the binding of 125I-insulin to anti-insulin antibodies. It was therefore suggested that the effect of ANS could be a nonspecific one and likely due to its negative charge.

Anilino Naphthalenesulfonates↗
PubMed1993

Localization of promoter sequences required for thyrotropin-releasing hormone and thyroid hormone responsiveness of the glycoprotein hormone alpha-gene in primary cultures of rat pituitary cells.

The glycoprotein hormone alpha-gene is regulated by multiple hormones in different pituitary and placental cell types. In thyrotropes, the alpha-gene is stimulated by TRH and repressed by thyroid hormone (T3). We used transient expression assays in primary cultures of rat pituitary cells to examine regulation of the alpha-promoter (alpha Luc) by TRH and T3. The -846 alpha Luc activity was stimulated 3.4-fold by TRH and repressed 44% by T3. GnRH and cAMP stimulated -846 alpha Luc by 8.3- and 8.6-fold, respectively. T3 blocked TRH stimulation, but it had no effect on stimulation by GnRH or cAMP, suggesting that the T3-mediated effects are thyrotrope specific. TRH and T3 responsiveness was preserved with deletions to -346 basepairs (bp). TRH responsiveness was lost after deletion to -280 bp, whereas T3-mediated repression was eliminated by further deletion to -180 bp. A series of DNA fragments between -420 and -180 was linked to -132 alpha Luc to study TRH and T3 responses in greater detail. Sequences between -346 to -180 bp conferred TRH responsiveness and T3 inhibition. TRH responsiveness was not seen after 3'-deletions of this fragment to -244 or -280 bp. These results together with the 5'-deletions provide evidence for two interdependent TRH regulatory regions: one between -346 to -280 bp and another between -244 to -180 bp. T3-dependent repression only requires sequences between -244 and -180 bp. Site-directed cluster mutations were created in each of these two regulatory domains. A mutation in region 1 (-346 to -328 bp) eliminated TRH stimulation, but retained basal suppression by T3.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMed1991

Basal and thyroid hormone receptor auxiliary protein-enhanced binding of thyroid hormone receptor isoforms to native thyroid hormone response elements.

There are three known isoforms of the rat thyroid hormone receptor, TR alpha-1, TR beta-1, and TR beta-2. The first two are expressed in all tissues, whereas TR beta-2 appears to be expressed only in the pituitary. The differences in the roles of the three receptor isoforms are unknown, but may involve preferential interaction with different subsets of thyroid hormone-regulated genes in different tissues. We tested the binding of the three TR isoforms to putative thyroid hormone response elements (TREs) from genes that are expressed in the pituitary or other tissues and are regulated by thyroid hormone. In vitro translated 35S-labeled rat TR alpha-1, rat TR beta-2, and human TR beta-1 receptors were bound to a battery of biotinylated synthetic deoxyribonucleotides containing naturally occurring putative TREs from genes expressed either in only pituitary (rat glycoprotein hormone alpha-subunit, TSH beta-subunit, and GH) or in nonpituitary (rat alpha-myosin heavy chain, malic enzyme, and Moloney murine leukemia virus promoter) tissues. All three receptor forms bound to each of the TREs. TR beta-2 did not show preferential binding to TREs of pituitary-specific genes compared to TR beta-1. Additionally, TR alpha-1 had a similar TRE-binding pattern as the TR beta s, except for possibly less binding to rat glycoprotein hormone alpha-subunit TRE. Finally, rat pituitary and liver nuclear extracts enhanced TR binding to TREs, with the greatest enhancement seen with the alpha-subunit TRE. These studies suggest that all TR isoforms bind similarly to native TREs. Also, TR binding to TREs can be differentially enhanced by interactions with nuclear proteins.

Animals↗
PubMed1992

Differential regulation of insulin-like growth factor I by growth hormone and thyroid hormone in the heart of juvenile hypophysectomized rats.

Recent data suggest that the heart can act as both a source and target for the actions of polypeptide growth factors. Insulin-like growth factor I (IGF-I) is a polypeptide that has both mitogenic and differentiation properties that function at the autocrine/paracrine level, and has recently been demonstrated to be expressed in the heart. This knowledge, coupled with the observation that thyroid hormone (T3) promotes relative cardiac growth compared to the proportional increases in body and heart growth evoked by growth hormone (GH), lead us to speculate whether differential induction of cardiac IGF-I may account for the specialized trophic effects of T3 on the heart. Cardiac IGF-I gene expression was studied in an in vivo model in which cardiac growth in the hypophysectomized juvenile rat was stimulated with either GH, T3 or GH + T3. Two week infusions of T3 that resulted in cardiac growth, but no gain in body weight, resulted in a 4.6-fold increase in cardiac IGF-I mRNA levels compared to hypophysectomized controls. GH infusions that resulted in similar cardiac growth, but were accompanied by proportional body growth, had no effect on cardiac IGF-I mRNA levels. These data are the first to demonstrate stimulation of cardiac IGF-I mRNA levels by T3 and further support cardiac autocrine/paracrine actions for this polypeptide growth factor.

Animals↗
PubMed1991

Single base mutation in the hormone binding domain of the thyroid hormone receptor beta gene in generalised thyroid hormone resistance demonstrated by single stranded conformation polymorphism analysis.

Thyroid hormone resistance is a syndrome of considerable clinical heterogeneity. Three mutations in the c-erb A beta gene encoding the human beta thyroid hormone receptor have been described in different kindreds. We report here, in a family affected with peripheral thyroid hormone resistance, a unique point mutation in the ligand binding domain of the c-erb A beta gene resulting in histidine replacement of an arginine residue at position 438. The region in which the mutation occurred was identified by single stranded conformation polymorphism analysis and confirmed by subcloning and sequencing of the mutant alleles from each of the affected members. Binding of tri-iodothyronine to isolated nuclei from family members was normal suggesting the mechanism of thyroid hormone resistance in this family is not mediated by abnormal binding of ligand and receptor.

Adult↗
PubMed1993

Thyroid hormone up-regulates thyroid hormone receptor beta gene expression in rat cerebral hemisphere astrocyte cultures.

Oligonucleotide probes complementary to specific regions of three thyroid receptor cDNAs were used to study the effects of thyroid hormone on the expression of the mRNAs encoding two alpha (alpha 1 and alpha 2) and one beta-thyroid (beta 1) receptors isoforms in rat cerebral hemisphere astrocyte cultures. Both genes are expressed by type 1 astrocytes. The levels of the alpha 1-, alpha 2-, and beta 1-mRNAs did not significantly change between day 8 and day 22, in cultures grown in the absence of thyroid hormone. L-triiodothyronine (L-T3) treatment of the cultures increased the levels of beta 1-mRNAs by fivefold without changing either the levels of the alpha 1- and alpha 2-mRNAs or L-T3 binding capacity. The effect of L-T3 on beta 1-mRNAs was observed after 4 h of treatment and was independent of protein synthesis, suggesting that this effect is likely to be a direct one. Treatment of the cultures by cytosine arabinosine, a drug that kills dividing cells, specifically decreased level of the alpha 1- and alpha 2-mRNAs by 60% and 38%, respectively. Finally, by immunocytochemistry, we showed that the beta 1 receptor-immunoreactivity was either located in the perinuclear region and the cytoplasm or in the nuclei of astrocytes. Taken together with previous data obtained in neuronal cultures where no effect of L-T3 was observed on the levels of the beta 1-mRNAs, our findings indicate that the beta 1 gene is differentially regulated in neurons and astrocytes.(ABSTRACT TRUNCATED AT 250 WORDS)

Animals↗
PubMedDate not supplied

Thyroid hormone receptor mutations and disease: beyond thyroid hormone resistance.

Thyroid hormone receptors (TRs) are ligand-dependent transcription factors that mediate the biological activities of thyroid hormone (T3). Two THR genes (A and B), located on different chromosomes, yield four T3-binding isoforms with highly conserved sequences in the DNA- and ligand-binding domains. Mutations of THRB cause a human genetic disease, thyroid hormone resistance syndrome (RTH). Comprehensive genomic profiling unveiled the contribution of novel change-of-function mutations of TRbeta to the pathogenesis of RTH. In addition, abnormalities associated with mutations of the THRA gene have been uncovered recently. The phenotypic manifestations of mutated THRB and THRA genes are distinct, indicating isoform-dependent actions of TR mutants in vivo. Therefore, mutant TRs provide a new paradigm to understand the molecular basis of receptor disease.

Animals↗
PubMed1992

The human skeletal alpha-actin promoter is regulated by thyroid hormone: identification of a thyroid hormone response element.

Skeletal alpha-actin mRNA increases in the adult heart during cardiac hypertrophy after the imposition of hemodynamic overload/aortic restriction. 3,3',5-Triiodo-L-thyronine (T3) elicits a cardiac response similar to the effect of prolonged exercise and was recently shown to cause a rapid increase in the amount of skeletal alpha-actin mRNA in hearts from normal and hypophysectomized animals. We used transient transfection analysis to show that T3 induces the expression of the native skeletal alpha-actin promoter between nucleotide positions -2000 and +239 linked to the chloramphenicol acetyltransferase reporter gene in COS-1 fibroblasts and myogenic C2C12 cells. This T3 (10-100 nM)-induced transcriptional activation is dependent on the expression of the thyroid hormone receptors from transfected alpha 1 and beta 1 c-erbA complementary DNA expression vectors. Electrophoretic mobility shift assays were used to identify a thyroid hormone response element (TRE) in the human skeletal alpha-actin gene. This TRE is located between nucleotide positions -173 and -149 with respect to the start of transcription at +1 (5' TGGTCAACGCAGGGGACCCGGGCGG 3'). Electrophoretic mobility shift assay experiments showed that the putative skeletal alpha-actin TRE and defined rodent growth hormone TREs (that bind thyroid hormone receptors in vitro and in vivo) interacted with an identical nuclear factor in vitro in muscle cells that was developmentally regulated during myogenesis. Transient transfection analysis utilizing 5' unidirectional deletions of the skeletal alpha-actin promoter indicated that cis-acting sequences between nucleotide positions -432 and -153, which encompassed the TRE, were required for T3/thyroid hormone receptor-dependent trans-activation in vivo. Furthermore, we demonstrated that the skeletal alpha-actin TRE is juxtaposed next to SRF and SpI binding sites, at its 5' and 3' flanks, respectively. It is also surrounded by sequences densely populated by other SpI, SRF, and CTF binding sites. In conclusion, these results indicate that T3-induced increases in alpha-actin mRNA in animals are mediated by a direct transcriptional mechanism that may involve interactions with ubiquitous proteins.

Actins↗
PubMedDate not supplied

Effect of growth hormone and thyroid hormone on autoimmune thyroiditis in obese chickens.

The effect of thyroxine (T4) and recombinant (rcGH) or purified pituitary-derived (pcGH) chicken growth hormone on the development of spontaneous autoimmune thyroiditis (SAT) was examined in the Obese strain (OS) chicken. Day-old OS chicks were randomly assigned to a control or 1.0 ppm T4 supplemented diet and a vehicle or 500 micrograms rcGH/kg BW daily injection, using a 2 x 2 factorial design. At 4 weeks, sera were analyzed for anti-thyroglobulin autoantibody (TgAAb) using a kinetics-based ELISA. Leucocytic infiltration of the thyroid was assessed using computer-based video imaging techniques. A close correlation between TgAAb and thyroid infiltration was seen with both being decreased (p < 0.05) by the T4/rcGH treatment. Neither the T4 or rcGH alone produced this effect and the rcGH treatment significantly elevated TgAAb. In a second experiment, all but the control group received 1.0 ppm T4 supplementation and two of the T4-treated groups received either 50 or 200 micrograms pcGH/kg BW by daily injection. As before, T4/pcGH significantly reduced TgAAb and thyroid infiltration. T4 alone produced no significant effects. These data support the conclusion that the combined treatment of T4 and cGH exert an immunomodulatory effect within a strain that is predisposed to autoimmune thyroiditis while GH treatment alone exacerbated the condition. These results also show that video imaging techniques can be used to evaluate the extent of histopathology present within the OS thyroid.

Animals↗
PubMed1988

Flight effects on plasma levels of free fatty acids, growth hormone and thyroid hormones in homing pigeons.

Significant increases in circulating levels of free fatty acids (FFA) and growth hormone (GH), were observed in homing pigeons after a flight of 48 km, lasting 60-80 min. No significant change in plasma levels of thyroxine (T4) and triiodothyronine (T3) was observed. Nor was there any change in T3/T4 ratio. The increase in plasma FFA is attributed to the increased release into circulation of at least one adipokinetic hormone, GH. It may be concluded that in free sustained homing flight under normal weather conditions and within the specific distance and duration, metabolic fuel and hormonal homeostasis is maintained.

Animals↗
PubMed1983

Effects of trifluoperazine on rat prolactin, growth hormone, thyroid stimulating hormone and adrenocorticotrophin secretion in vitro.

We have studied the effects of trifluoperazine, a proposed inhibitor of calmodulin directed cellular function, on adrenocorticotrophic hormone (ACTH), thyroid stimulating hormone (TSH), prolactin (Prl) and growth hormone (GH) secretion from primary cultures of rat adenohypophyseal cells. 5 X 10(-6)M and 10(-5)M trifluoperazine caused a significant (P less than 0.005) reversible dose-related decrease in basal Prl secretion but was less effective on basal GH secretion, significant reversible inhibition (P less than 0.005) occurring only with 10(-5)M. Trifluoperazine did not consistently alter basal ACTH or TSH secretion but did inhibit 10(-2)M theophylline stimulation of ACTH, Prl and GH secretion and 1.5 X 10(-7)M TRH stimulation of TSH and Prl secretion. Paradoxically 10(-5)M trifluoperazine enhanced theophylline stimulation of TSH secretion. Our results show trifluoperazine to have differential effects on Prl, GH, ACTH and TSH secretion, which are consistent with the known calcium dependence of pituitary hormone secretion and may suggest a role for calmodulin in this process.

Adrenocorticotropic Hormone↗
PubMed1988

Effects of rose bengal on serum levels of thyroid hormones and thyroid peroxidase activity in male mice.

The thyrotoxic effect of Rose bengal (RB) (4,5,6,7-tetrachloro-2',4',5',7'-tetraiodofluorescein disodium salt; Food Red No. 105) was examined in male (C57BL/6N X C3H/N) F1 mice. They were given drinking-water containing RB at levels of 0 (control), 0.125 and 0.250% for 2 weeks. The effect resulted in decreases in serum levels of 3,5,3'-triiodothyronine (T3) and thyroxine (T4), and slight increases in serum 3,3',5'-triiodothyronine (rT3) levels and thyroid weight, but no difference in the values for the body-weight gain, serum thyroid stimulating hormone (TSH) levels and thyroid peroxidase (TPO) activities. However, the in vitro inhibitory effect of RB on TPO activity was observed by addition of RB to the TPO-catalyzed guaiacol oxidation. These results suggest that RB might have weak goitrogenic properties, inhibiting the peripheral conversion of T4 to T3 and/or inhibiting TPO to lead a decrease of T4 and T3 formation.

Animals↗
PubMed1998

TLS (translocated-in-liposarcoma) is a high-affinity interactor for steroid, thyroid hormone, and retinoid receptors.

Nuclear receptors for steroid hormones, thyroid hormone, retinoids, and vitamin D are thought to mediate their transcriptional effects in concert with coregulator proteins that modulate receptor interactions with components of the basal transcription complex. In an effort to identify potential coregulators, receptor fusions with glutathione-S-transferase were used to isolate proteins in nuclear extracts capable of binding nuclear hormone receptors. Glutathione-S-transferase fusions with mouse retinoid X receptor-alpha enabled the selective isolation of a 65-kDa protein (p65) from nuclear extracts of rat and human cells. Binding of p65 to mouse retinoid X receptor-alpha was centered around the DNA-binding domain. p65 also bound regions encompassing the DNA-binding domain in estrogen, thyroid hormone, and glucocorticoid receptors. p65 was identified as TLS (translocated-in-liposarcoma), a recently identified member of the RNP family of nuclear RNA-binding proteins whose members are thought to function in RNA processing. The N-terminal half of TLS bound to thyroid hormone receptor with high affinity while the receptor was bound to appropriate DNA target sites. Functional studies indicated that the N-terminal half of TLS can interact with thyroid hormone receptor in vivo. TLS was originally discovered as part of a fusion protein arising from a chromosomal translocation causing human myxoid liposarcomas. TLS contains a potent transactivation domain whose translocation-induced fusion with a DNA-binding protein (CHOP) yields a powerful transforming oncogene and transcription factor. The transactivation and RNA-binding properties of TLS and the nature of its interaction with nuclear receptors suggest a novel role in nuclear receptor function.

Animals↗