PubMed Health⌕ Search

SEARCH · PubMed Health

Results for “regulatory element transcripts”

Explore indexed PubMed citations for clinical trials, systematic reviews and public health research. Read source abstracts and follow each citation to its original PubMed record.

Quote a phrase for an exact phrase match. Source license links do not imply unrestricted reuse.

At least 145 records · Page 8Linked to original sources
PubMed1989

Negative transcriptional regulatory element that functions in embryonal carcinoma cells.

We have cloned the polyomavirus mutant fPyF9, which persists in an episomal state in F9 embryonal carcinoma cells (K. Ariizumi and H. Ariga, Mol. Cell. Biol. 6:3920-3927, 1986). fPyF9 carries three copies of exogenous sequences, the prototype of which is a 21-base-pair repeat (box DNA), in the region of the enhancer B domain of wild-type polyomavirus DNA. The consensus sequence, GCATTCCATTGTT, is 13 base pairs long. The box DNA inserted into fPyF9 appeared to come from a cellular sequence and was present in many kinds of DNAs, including F9 chromosomal DNA. The biological function of box DNA was analyzed by chloramphenicol acetyltransferase expression assays, using chimeric plasmids containing box DNA conjugated with simian virus 40 promoter elements. The results showed that box DNA repressed the activities both of the simian virus 40 promoter and enhancer only in transfected undifferentiated F9 cells and not in differentiated LTK- cells. Box DNA functioned independently of orientation and position with respect to the promoter in an enhancerlike manner, although the effect of box DNA was opposite that of the enhancer. The XhoI linker insertion into the consensus sequences of box DNA abolished the repression activity, and the protein(s) recognizing the consensus sequences was identified only in F9 cells, not in L cells. These analyses suggest that box DNA may be a negative regulatory element that functions in undifferentiated cells.

Animals↗
PubMed2002

Neuron-specific expression in vivo by defined transcription regulatory elements of the GnRH gene.

The GnRH-expressing neurons are the ultimate regulator of reproductive function. GnRH gene expression is limited to this small population of neurons in the hypothalamus. Transfections using 3 kb of the rat or mouse 5'-regulatory region provide specific gene expression in the hypothalamic cell line GT1-7. The combination of two elements, a 300-bp enhancer and a 173-bp promoter, recapitulates specificity in GT1-7 cells. It was not known whether these elements could specifically target gene expression throughout development in the whole animal. We demonstrate that the 3-kb rat GnRH regulatory region provides a higher degree of specificity than the equivalent mouse sequence in a mouse hypothalamic cell line. Moreover, combination of the enhancer and the promoter of the rat gene targets expression to GnRH neurons in transgenic mice in a developmentally appropriate manner. Transgene expression is regulated by activin A, a known activator of GnRH gene expression. In contrast, the enhancer on a heterologous promoter produces inappropriate expression in vivo. We conclude that the enhancer and promoter regions of the rat GnRH gene are necessary for targeted expression to hypothalamic neurons and are sufficient to confer regulated, cell type-specific expression to a reporter gene in vivo.

Activins↗
PubMed1991

Elements in the transcriptional regulatory region flanking herpes simplex virus type 1 oriS stimulate origin function.

Like other DNA-containing viruses, the three origins of herpes simplex virus type 1 (HSV-1) DNA replication are flanked by sequences containing transcriptional regulatory elements. In a transient plasmid replication assay, deletion of sequences comprising the transcriptional regulatory elements of ICP4 and ICP22/47, which flank oriS, resulted in a greater than 80-fold decrease in origin function compared with a plasmid, pOS-822, which retains these sequences. In an effort to identify specific cis-acting elements responsible for this effect, we conducted systematic deletion analysis of the flanking region with plasmid pOS-822 and tested the resulting mutant plasmids for origin function. Stimulation by cis-acting elements was shown to be both distance and orientation dependent, as changes in either parameter resulted in a decrease in oriS function. Additional evidence for the stimulatory effect of flanking sequences on origin function was demonstrated by replacement of these sequences with the cytomegalovirus immediate-early promoter, resulting in nearly wild-type levels of oriS function. In competition experiments, cotransfection of cells with the test plasmid, pOS-822, and increasing molar concentrations of a competitor plasmid which contained the ICP4 and ICP22/47 transcriptional regulatory regions but lacked core origin sequences resulted in a significant reduction in the replication efficiency of pOS-822, demonstrating that factors which bind specifically to the oriS-flanking sequences are likely involved as auxiliary proteins in oriS function. Together, these studies demonstrate that trans-acting factors and the sites to which they bind play a critical role in the efficiency of HSV-1 DNA replication from oriS in transient-replication assays.

Animals↗
PubMed2006

TFBScluster web server for the identification of mammalian composite regulatory elements.

Identification of transcriptional regulatory elements represents a critical step in our ability to reconstruct transcriptional regulatory networks from gene expression profiling datasets. To facilitate computational identification of candidate gene regulatory elements from whole genome sequences, we have developed the TFBScluster web server that integrates several tools for the genome-wide identification and subsequent characterization of transcription factor binding site clusters that are conserved in multiple mammalian species. Either the human or mouse genomes can be used as the reference sequence with direct links from the search results to the ENSEMBL and UCSC genome browsers. Moreover, TFBScluster provides seamless integration of transcription factor binding site searches with genome annotation and gene expression profiling data, to allow prioritising computational predictions for subsequent experimental validation. TFBScluster is publicly available at http://hscl.cimr.cam.ac.uk/TFBScluster_genome_portal.html.

Animals↗
PubMed2001

Germ-line transcripts of the immunoglobulin lambda J-C clusters in the mouse: characterization of the initiation sites and regulatory elements.

Transcription of unrearranged immunoglobulin gene segments strongly correlates with their accessibility to the V(D)J recombination machinery. The regulatory mechanisms governing this germ-line transcription are still poorly defined. In order to identify new regulatory elements, we first carried out a detailed characterization of the transcription initiation sites for the J-C germ-line transcripts, using rapid amplification of 5' cDNA ends, assisted by a template switching mechanism at the 5'-end of the RNA. Transcripts were observed that initiated heterogeneously, starting up to 293 (lambda1), 116 bp (lambda2) and 79 bp (lambda3) upstream from the respective Jlambda gene segment. Additional RT-PCR analysis revealed the existence of germ-line transcripts of lambda and also of kappa that initiate even more upstream of these transcription initiation sites, although their frequencies were low. Promoter activity was detected in vitro 5' of Jlambda2, with the minimal promoter activity mapping to the region between positions -35 and -120. In addition, computer analysis allowed the prediction of a nuclear scaffold/matrix attachment (S/MAR) region between the two J-C gene clusters at each hemi-locus. This region between the lambda1/lambda3 clusters binds to the nuclear matrix in vitro, and J-C lambda1 germ-line transcription initiates a short distance downstream from this S/MAR element.

Animals↗
PubMed1994

RNA polymerase III-mediated transcription of the trypanosome U2 small nuclear RNA gene is controlled by both intragenic and extragenic regulatory elements.

Transcription of U2 small nuclear RNA (snRNA) genes in eukaryotes is executed by RNA polymerase II and is dependent on extragenic cis-acting regulatory sequences which are not found in other genes. Here we have mapped promoter elements of the Trypanosoma brucei U2 snRNA gene by transient DNA expression of mutant constructs in insect form trypanosomes. Unlike other eukaryotic U2 snRNA genes, the T. brucei homolog is transcribed by an RNA polymerase III-like enzyme on the basis of its sensitivity to the inhibitors alpha-amanitin and tagetitoxin. Thus, the trypanosome U2 snRNA provides a unique example of an RNA polymerase III transcript carrying a trimethylated cap structure. The promoter of this gene consists of three distinct elements: an intragenic sequence close to the 5' end of the coding region, which is probably required to position the polymerase at the correct transcription start site; and two extragenic elements, located 110 and 160 nucleotides upstream, which are essential for U2 snRNA gene expression. These two elements closely resemble both in sequence and in distance from each other the A and B box consensus sequences of the internal control regions of tRNA genes.

Amanitins↗
PubMed2006

AGRIS and AtRegNet. a platform to link cis-regulatory elements and transcription factors into regulatory networks.

Gene regulatory pathways converge at the level of transcription, where interactions among regulatory genes and between regulators and target genes result in the establishment of spatiotemporal patterns of gene expression. The growing identification of direct target genes for key transcription factors (TFs) through traditional and high-throughput experimental approaches has facilitated the elucidation of regulatory networks at the genome level. To integrate this information into a Web-based knowledgebase, we have developed the Arabidopsis Gene Regulatory Information Server (AGRIS). AGRIS, which contains all Arabidopsis (Arabidopsis thaliana) promoter sequences, TFs, and their target genes and functions, provides the scientific community with a platform to establish regulatory networks. AGRIS currently houses three linked databases: AtcisDB (Arabidopsis thaliana cis-regulatory database), AtTFDB (Arabidopsis thaliana transcription factor database), and AtRegNet (Arabidopsis thaliana regulatory network). AtTFDB contains 1,690 Arabidopsis TFs and their sequences (protein and DNA) grouped into 50 (October 2005) families with information on available mutants in the corresponding genes. AtcisDB consists of 25,806 (September 2005) promoter sequences of annotated Arabidopsis genes with a description of putative cis-regulatory elements. AtRegNet links, in direct interactions, several hundred genes with the TFs that control their expression. The current release of AtRegNet contains a total of 187 (September 2005) direct targets for 66 TFs. AGRIS can be accessed at http://Arabidopsis.med.ohio-state.edu.

Arabidopsis↗
PubMed1999

Regulation of metallothionein gene transcription. Identification of upstream regulatory elements and transcription factors responsible for cell-specific expression of the metallothionein genes from Caenorhabditis elegans.

Metallothioneins are small, cysteine-rich proteins that function in metal detoxification and homeostasis. Metallothionein transcription is controlled by cell-specific factors, as well as developmentally modulated and metal-responsive pathways. By using the nematode Caenorhabditis elegans as a model system, the mechanism that controls cell-specific metallothionein transcription in vivo was investigated. The inducible expression of the C. elegans metallothionein genes, mtl-1 and mtl-2, occurs exclusively in intestinal cells. Sequence comparisons of these genes with other C. elegans intestinal cell-specific genes identified multiple repeats of GATA transcription factor-binding sites (i.e. GATA elements). In vivo deletion and site-directed mutation analyses confirm that one GATA element in mtl-1 and two in mtl-2 are required for transcription. Electrophoretic mobility shift assays show that the C. elegans GATA transcription factor ELT-2 specifically binds to these elements. Ectopic expression of ELT-2 in non-intestinal cells of C. elegans activates mtl-2 transcription in these cells. Likewise, mtl-2 is not expressed in nematodes in which elt-2 has been disrupted. These results indicate that cell-specific transcription of the C. elegans metallothionein genes is regulated by the binding of ELT-2 to GATA elements in these promoters. Furthermore, a model is proposed where ELT-2 constitutively activates metallothionein expression; however, a second metal-responsive factor prevents transcription in the absence of metals.

Animals↗
PubMed1988

Evidence for a nuclear factor(s), IRF-1, mediating induction and silencing properties to human IFN-beta gene regulatory elements.

Transcription of the human interferon-beta (IFN-beta) gene is induced by a variety of agents such as viruses, dsRNA and some cytokines. In this study, we describe a nuclear factor, termed interferon regulatory factor-1 (IRF-1), that is involved in the transcription of IFN-beta and possibly other genes. We demonstrate that IRF-1 functions in virus-induced transcription by interacting with previously identified, IFN-beta regulatory DNA elements. Our data suggest that IRF-1 participates in the transient formation of an induction-specific complex(es) with the regulatory elements. IRF-1 may also be involved in silencing the function of the SV40 enhancer juxtaposed to the regulatory elements in uninduced cells.

Animals↗
PubMed2006

Human polyomavirus JCV late leader peptide region contains important regulatory elements.

Transcription is a complex process that relies on the cooperative interaction between sequence-specific factors and the basal transcription machinery. The strength of a promoter depends on upstream or downstream cis-acting DNA elements, which bind transcription factors. In this study, we investigated whether DNA elements located downstream of the JCV late promoter, encompassing the late leader peptide region, which encodes agnoprotein, play regulatory roles in the JCV lytic cycle. For this purpose, the entire coding region of the leader peptide was deleted and the functional consequences of this deletion were analyzed. We found that viral gene expression and replication were drastically reduced. Gene expression also decreased from a leader peptide point mutant but to a lesser extent. This suggested that the leader peptide region of JCV might contain critical cis-acting DNA elements to which transcription factors bind and regulate viral gene expression and replication. We analyzed the entire coding region of the late leader peptide by a footprinting assay and identified three major regions (region I, II and III) that were protected by nuclear proteins. Further investigation of the first two protected regions by band shift assays revealed a new band that appeared in new infection cycles, suggesting that viral infection induces new factors that interact with the late leader peptide region of JCV. Analysis of the effect of the leader peptide region on the promoter activity of JCV by transfection assays demonstrated that this region has a positive and negative effect on the large T antigen (LT-Ag)-mediated activation of the viral early and late promoters, respectively. Furthermore, a partial deletion analysis of the leader peptide region encompassing the protected regions I and II demonstrated a significant down-regulation of viral gene expression and replication. More importantly, these results were similar to that obtained from a complete deletion of the late leader peptide region, indicating the critical importance of these two protected regions in JCV regulation. Altogether, these findings suggest that the late leader peptide region contains important regulatory elements to which transcription factors bind and contribute to the JCV gene regulation and replication.

Blotting, Northern↗
PubMed2003

AGRIS: Arabidopsis gene regulatory information server, an information resource of Arabidopsis cis-regulatory elements and transcription factors.

BACKGROUND: The gene regulatory information is hardwired in the promoter regions formed by cis-regulatory elements that bind specific transcription factors (TFs). Hence, establishing the architecture of plant promoters is fundamental to understanding gene expression. The determination of the regulatory circuits controlled by each TF and the identification of the cis-regulatory sequences for all genes have been identified as two of the goals of the Multinational Coordinated Arabidopsis thaliana Functional Genomics Project by the Multinational Arabidopsis Steering Committee (June 2002). RESULTS: AGRIS is an information resource of Arabidopsis promoter sequences, transcription factors and their target genes. AGRIS currently contains two databases, AtTFDB (Arabidopsis thaliana transcription factor database) and AtcisDB (Arabidopsis thaliana cis-regulatory database). AtTFDB contains information on approximately 1,400 transcription factors identified through motif searches and grouped into 34 families. AtTFDB links the sequence of the transcription factors with available mutants and, when known, with the possible genes they may regulate. AtcisDB consists of the 5' regulatory sequences of all 29,388 annotated genes with a description of the corresponding cis-regulatory elements. Users can search the databases for (i) promoter sequences, (ii) a transcription factor, (iii) a direct target genes for a specific transcription factor, or (vi) a regulatory network that consists of transcription factors and their target genes. CONCLUSION: AGRIS provides the necessary software tools on Arabidopsis transcription factors and their putative binding sites on all genes to initiate the identification of transcriptional regulatory networks in the model dicotyledoneous plant Arabidopsis thaliana. AGRIS can be accessed from http://arabidopsis.med.ohio-state.edu.

3' Untranslated Regions↗
PubMed1991

Sp1 is essential and its position is important for p120 gene transcription: a 35 bp juxtaposed positive regulatory element enhances transcription 2.5 fold.

Human proliferating cell nucleolar antigen p120 is expressed in tumor cells in the early G1 phase of the cell cycle. Deletion analyses of the essential cis-acting region -537/-278 showed that a 58 bp sequence from -457 to -400 is an important cis-acting element. An Sp1 transcription factor binds to the sequence AGAGGCGGGG (-425 to -416) within the -458/-400 cis-acting region. Deletion of the Sp1 binding sequence eliminated transcription. Substitution of the Sp1 box(-437/-406), containing the Sp1 recognition site, for the entire cis-acting region (-537/-278) restored transcription only at a very low level (18%). Deletion of the -537/-278 cis-acting region followed by substitutions showed that the Sp1 box (-437/-406) stimulated transcription 2.4 fold, when juxtaposed and downstream of a 35 bp (-472 GGGCGAGCGTAAGTTCCGGGTGCGGCGGCCGACTA -438) positive regulatory cis-element (PRE) over that by substitution of the Sp1 box alone. When the -406/-278 sequence was downstream of the PRE-Sp1 box, transcription was stimulated 4.4 fold over that produced by substitution of the Sp1 box alone. These results suggest that Sp1 is essential and its proper position in the 5' flanking sequence, juxtaposed and down stream of a 35 bp positive regulatory sequence, is required for efficient transcription.

Base Sequence↗
PubMed1994

The POX1 gene encoding peroxisomal acyl-CoA oxidase in Saccharomyces cerevisiae is under the control of multiple regulatory elements.

Transcription of POX1, the gene encoding peroxisomal acyl-CoA oxidase in the yeast Saccharomyces cerevisiae, is controlled by the carbon source given for cell growth. The gene is repressed in glucose, derepressed in glycerol, and induced in oleate. This regulation is controlled by cis-acting elements in the 5' region of the gene, which bind regulatory proteins. By deletion analysis and DNA band shift assays, we have characterized three such elements in the POX1 upstream sequence, two upstream repression sequences and an upstream activating sequence. Each was able to regulate the transcription of a heterologous gene construct iso-1-cytochrome-c (CYC1)/lacZ.

Acyl-CoA Oxidase↗
PubMed1991

Identification of a thyroid hormone response element in the phosphoenolpyruvate carboxykinase (GTP) gene. Evidence for synergistic interaction between thyroid hormone and cAMP cis-regulatory elements.

Transcription of the gene for the cytosolic form of phosphoenolpyruvate carboxykinase (GTP) (EC 4.1.1.32) (PEPCK) in the liver is regulated by many hormones including thyroid hormone (T3). In order to identify the elements in the promoter which are required for transcriptional induction by T3, we cotransfected a T3 receptor expression vector with a PEPCK-CAT reporter gene into HepG2 cells. Using vectors with deletions in the PEPCK promoter, we identified a single T3 response element (TRE) between positions -332 and -308. This element binds [125I]T3-labeled T3 receptor contained in nuclear extracts prepared from rat liver. Furthermore, the P3(I) element (-250 to -234), a previously described cis-sequence involved in mediating the induction of PEPCK gene transcription by cAMP, is also required for the T3 responsiveness of the promoter. In the absence of either the TRE or the P3(I) binding sites, no stimulation of transcription from the PEPCK promoter by T3 was observed, indicating that both elements are required for the T3 transcriptional regulation. Finally, a synergistic induction of PEPCK gene transcription by T3 and cAMP is described. This interaction requires both T3- and cAMP-responsive cis-acting elements.

Base Sequence↗
PubMed2003

Tissue-specific expression of two human Ca(v)1.2 isoforms under the control of distinct 5' flanking regulatory elements.

Transcriptional regulation may be important for L-type Ca(2+) channel alpha(1C) subunit (Ca(v)1.2) gene expression. In this study, we found two human Ca(v)1.2 isoforms, one strongly and selectively expressed in heart and the other with apparently ubiquitous expression. The promoter for the cardiac isoform has an 'initiator' sequence, and is active in neonatal cardiomyocytes but not in cardiac fibroblasts, H9C2 cells, human aorta-vascular smooth muscle and HEK293 cells. The promoter for the ubiquitously expressed isoform is of the 'housekeeping' type and is active in all cell types examined. These data indicate specific expression patterns of two human Ca(v)1.2 isoforms under the control of distinct 5' flanking regulatory sequences.

Animals↗
PubMed2005

Selection by phage display of peptides targeting the HIV-1 TAR element.

As transcription regulatory element, the HIV-1 TAR RNA element is a promising target to inhibit viral replication; indeed, ligands of TAR RNA could prevent the transcription trans-activation process. Phage display in vitro selection was undertaken to select peptidic ligands of TAR RNA. In preliminary experiments, the selection was performed in a magnesium rich buffer (3 mM), but only phages targeted to plastic wells or streptavidin emerged; in addition, a "super-infectious" phage present in the New England Biolabs library (SVSVGMKPSPRP) selected by others with different targets was cloned, due to a high amplification potential. In contrast, the absence of magnesium or an increasing magnesium concentration (0 to 0.5 mM) led to phage selection with 57 amino acid peptides. K(D)s of 420-550 nM were measured by filter binding assays; a significant specificity was obtained when TAR target was compared with unrelated RNA targets. Surprisingly, the binding of selected peptides does not depend on the magnesium concentration.

Buffers↗
PubMed1991

Regulatory crosstalk at composite response elements.

Transcriptional regulatory factors from different families interact with each other when bound to DNA at composite response elements. This level of communication has two striking consequences: ubiquitous factors can effect cell specificity, and closely related factors from a given family can produce very different regulatory patterns.

Animals↗